ID: 1168801610

View in Genome Browser
Species Human (GRCh38)
Location 20:647011-647033
Sequence CACTGCCCTCTAAGGGAACT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168801610_1168801616 15 Left 1168801610 20:647011-647033 CCAAGTTCCCTTAGAGGGCAGTG 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1168801616 20:647049-647071 TTACTCTGTTCCCTTTCCCCAGG 0: 1
1: 0
2: 4
3: 33
4: 305
1168801610_1168801617 16 Left 1168801610 20:647011-647033 CCAAGTTCCCTTAGAGGGCAGTG 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1168801617 20:647050-647072 TACTCTGTTCCCTTTCCCCAGGG 0: 1
1: 0
2: 5
3: 33
4: 325
1168801610_1168801618 24 Left 1168801610 20:647011-647033 CCAAGTTCCCTTAGAGGGCAGTG 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1168801618 20:647058-647080 TCCCTTTCCCCAGGGACTCTTGG 0: 1
1: 0
2: 4
3: 54
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168801610 Original CRISPR CACTGCCCTCTAAGGGAACT TGG (reversed) Exonic
901055235 1:6446136-6446158 CATTGCCCTCCATGGGAGCTGGG + Intronic
901157561 1:7150616-7150638 TTCTGCCCTTCAAGGGAACTGGG - Intronic
902197727 1:14810213-14810235 TCCTGCCCTCTAAGGTACCTCGG - Intronic
902479136 1:16702478-16702500 CACTGCCCTCCATGGGAGCTGGG - Intergenic
905480645 1:38259572-38259594 AACTGCCCTCTAAGGAGAGTGGG + Intergenic
907670162 1:56467346-56467368 CACTGGCTTCTGAGGGAACCTGG + Intergenic
909550936 1:76897736-76897758 CTCTGCCTAATAAGGGAACTGGG + Intronic
913105019 1:115606160-115606182 CTCTGCCTTCTAAAGGACCTGGG + Intergenic
913465764 1:119140981-119141003 TATTACCCTCTAAGAGAACTGGG - Intergenic
914885017 1:151577555-151577577 CACTGCCCTTTGGGGGATCTTGG + Intronic
919973590 1:202596582-202596604 CACAGCCATCAAAGGGAAGTTGG + Exonic
922088702 1:222375284-222375306 CACTTTCCTCTAAGGAAAATGGG + Intergenic
923752018 1:236754955-236754977 AAGTGCCCTCTAAGGGAGCTCGG - Intronic
1068231068 10:54169499-54169521 CACAGCCTAATAAGGGAACTGGG - Intronic
1069757665 10:70782968-70782990 CATTCGCCTCTAAGGGATCTGGG + Intronic
1072930299 10:99656581-99656603 CCCTACCCTCTAAAGGAATTTGG - Intergenic
1073535722 10:104275094-104275116 CACTGCCCTCTCTGGGACTTGGG + Intronic
1074740874 10:116483394-116483416 CTCTGCCTAATAAGGGAACTGGG - Intergenic
1077612279 11:3650683-3650705 CTCTGCCTAATAAGGGAACTGGG - Intronic
1078064776 11:8071277-8071299 CACTGCTCTCCCAGGGAAGTGGG + Intronic
1078169350 11:8916839-8916861 AAGTTCCCTCTAAGGGAAATTGG + Intronic
1078605868 11:12775145-12775167 CACAGCCCTCTAACTGAACTAGG - Intronic
1080676514 11:34432934-34432956 CACTGACCTCCAAGGGTAGTTGG - Intergenic
1081983023 11:47281799-47281821 CTTTGCTCTCTAAGGGACCTTGG + Intronic
1087841693 11:102927378-102927400 CAATGACCTCTAAGGCAACCTGG - Intergenic
1089342225 11:117765833-117765855 CTCTGGCCTCAGAGGGAACTGGG - Intronic
1089629176 11:119773236-119773258 CACTGCCCTCTATGGAGACACGG - Intergenic
1090041826 11:123298771-123298793 CGCTGCGCTCTCAGGGACCTGGG + Intergenic
1090196390 11:124820586-124820608 CTCTGCCCTCTGAGTGAACTAGG + Intergenic
1091178343 11:133581249-133581271 CACCGCCCACTAAGGCCACTAGG + Intergenic
1092218024 12:6695831-6695853 CCCTGCCCTCTAGGGGAGCTTGG + Intronic
1092269880 12:7015385-7015407 CCCAGCTCTCTCAGGGAACTGGG - Intronic
1093047812 12:14470137-14470159 CACATCTCTCCAAGGGAACTTGG - Intronic
1093930409 12:24949920-24949942 CAATGCCCTCAAACAGAACTGGG + Intergenic
1094731852 12:33185753-33185775 CATTGCTCTATAAGGGAATTAGG + Intergenic
1096982738 12:55737704-55737726 CAAGGCCCTCTAAGAGAAGTTGG - Intergenic
1100766510 12:97872064-97872086 CACTCCCCTATGAGGGAAGTTGG - Intergenic
1101210481 12:102530622-102530644 CACTTCCCTCTGAGCGAGCTTGG - Intergenic
1101711416 12:107270419-107270441 CACTTCTCCCTAAGGGACCTTGG - Intergenic
1107900998 13:45013612-45013634 CACACCCTTCTTAGGGAACTGGG - Intronic
1108569112 13:51731767-51731789 AGCTGCCCTTTAATGGAACTGGG - Intronic
1108898480 13:55365858-55365880 CACTGCCCCCTTTGGGAACCAGG - Intergenic
1112516641 13:100058905-100058927 CACTGCACTCTTAGGCAACAAGG + Intergenic
1114707667 14:24743714-24743736 CCCTGCCCTCCAAGAGATCTTGG - Intergenic
1120589975 14:86363717-86363739 CACTGCACTCTCAGGGGTCTGGG + Intergenic
1121126020 14:91407197-91407219 CACAGCCCTCAACAGGAACTGGG + Intronic
1121289516 14:92762614-92762636 CTCTGCCTAATAAGGGAACTGGG - Intergenic
1123886089 15:24729527-24729549 CACTGACCTCTGAGGGACCAGGG - Intergenic
1127197593 15:56606350-56606372 CACTGCACTCCAAGAAAACTAGG - Intergenic
1129972838 15:79795461-79795483 CACTTTCCTCAAAGAGAACTTGG - Intergenic
1130876063 15:88015559-88015581 CACTGCTCTCTAAGCACACTGGG + Intronic
1131256016 15:90863002-90863024 CAGTGCTCTCTAAGGGGCCTTGG - Intergenic
1134197097 16:12167678-12167700 CACTGCCCTCTTAGAGATGTGGG + Intronic
1134241943 16:12512984-12513006 CACTGCCCTCTGGGGGGACAAGG - Intronic
1135568083 16:23527423-23527445 CACTACTGTCTCAGGGAACTGGG + Intronic
1138060674 16:53886931-53886953 CACTGCCCGCTAAAGAAACGTGG - Intronic
1140285031 16:73594999-73595021 CACAGGTCTCTAAGGGAACATGG + Intergenic
1142710525 17:1720964-1720986 CCCTGCCCTCTAGCGGTACTGGG - Intronic
1144377352 17:14657509-14657531 CCCTGCCCTCACAGGAAACTGGG - Intergenic
1147377937 17:40033845-40033867 CACTCTCCTCTGGGGGAACTGGG + Intronic
1147938648 17:44029322-44029344 CACTGCCCTGTCAGGGAAGAAGG + Intergenic
1148735055 17:49860588-49860610 CCCTGCCCTTGAAGGGCACTGGG + Intergenic
1148812555 17:50303136-50303158 TCCTGTCCTCTAAGGCAACTGGG - Intergenic
1149006932 17:51815692-51815714 CACTGACCTCTTGGGGATCTAGG - Intronic
1154078154 18:11225465-11225487 CACTGCCCTTTACAGGACCTAGG + Intergenic
1157230420 18:45910594-45910616 CACTGCCCTCTGCTGGAACACGG + Exonic
1157505056 18:48220165-48220187 CTCTGCCTTCAGAGGGAACTGGG - Intronic
1158279707 18:55810595-55810617 CACTGCCCAAAAATGGAACTAGG - Intergenic
1162792727 19:13071401-13071423 GGCTGCCCTCTCAGGGAACATGG + Intronic
1163237225 19:16036868-16036890 CACTGCCCTCCAAGAGGAGTCGG + Intergenic
1165359584 19:35327858-35327880 CACTGCCCTCTATGGGCAGCTGG - Intronic
1165362967 19:35348053-35348075 CCCTGCCCTCTAAGGAGAATGGG - Intergenic
1165412096 19:35668336-35668358 CACTGCCCTCTCAGTAAAGTGGG - Intronic
1165924503 19:39318881-39318903 CTCCGCCCTCTATGGGCACTTGG + Intergenic
1202713175 1_KI270714v1_random:28384-28406 CACTGTCCTCCATGGGAGCTGGG - Intergenic
925408837 2:3627148-3627170 CAGTGACCTCTGCGGGAACTTGG + Intronic
931255854 2:60571853-60571875 GACTGCTCTCTGATGGAACTAGG + Intergenic
932613737 2:73218847-73218869 CTCTGCCCTCTCAGGGAAAGGGG + Exonic
936023951 2:109016919-109016941 CACTGCCCCCTATGGAAACTCGG + Intergenic
936666358 2:114601011-114601033 CACAGCCTTCTAAGGTAAGTTGG - Intronic
938935417 2:136123417-136123439 CATTGCCCTTTGAGGGAATTTGG + Intergenic
940133488 2:150410252-150410274 GTCTTCCCTCTAAGGGAAGTAGG + Intergenic
940422918 2:153499849-153499871 CCCTGCACTCTCAGGGGACTGGG - Intergenic
940575807 2:155503015-155503037 CCTTGCCCTCTAAAGGCACTCGG - Intergenic
942909076 2:181219912-181219934 CACTGACCACTAAGAAAACTTGG - Intergenic
943778778 2:191797836-191797858 GACTGCACTCTAAGGGAACATGG + Intergenic
948202076 2:236136508-236136530 CCCTGCCTTCCAGGGGAACTGGG - Intergenic
949014902 2:241703232-241703254 CTCTGTCCTCTAGGGGAGCTGGG + Intronic
949041376 2:241851434-241851456 CACTGCCCTCTGTGTGATCTGGG + Intronic
1168801610 20:647011-647033 CACTGCCCTCTAAGGGAACTTGG - Exonic
1168989280 20:2080357-2080379 CACATCCCTCTAAAGGAAATGGG + Intergenic
1169596638 20:7207576-7207598 CACTGCCTTCCAAGAGAACGGGG - Intergenic
1170010435 20:11716819-11716841 CACTGACCTGTAATGGAGCTTGG + Intergenic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1172781735 20:37440410-37440432 CCCTGCCCCCCAAGGGCACTGGG + Intergenic
1182697141 22:32205358-32205380 CACTGCCCGCTGAGGGGAGTGGG + Intergenic
1183365357 22:37403913-37403935 CACTCCCCTCAAAGGGCTCTTGG + Intronic
1184112749 22:42404884-42404906 CCCTGCCCACTAAGTGAACATGG - Intronic
1185076810 22:48687554-48687576 GACTGCCTTCTCAGGGAACCTGG - Intronic
949755959 3:7410959-7410981 CACTGCCCTCTGAAGGCTCTAGG + Intronic
952066413 3:29576798-29576820 CACTGGGCTTTAAGGGAACATGG - Intronic
952671244 3:35972104-35972126 CACTGCCTTCTAAGGCTACTTGG - Intergenic
954461132 3:50627680-50627702 CCCTGCCCTCTAGGGGACCAGGG - Intronic
955098811 3:55826898-55826920 CACTGCCCTCCAGGAGAATTGGG - Intronic
957019228 3:75105996-75106018 CACTGCCCTGGAAGGGACCTGGG + Intergenic
962272959 3:133991667-133991689 CACTCCCCTCTTAAGGAACAAGG - Intronic
962446665 3:135472086-135472108 GTCTGCTCTCTAAGGGAAGTGGG - Intergenic
969279815 4:6162181-6162203 CACTGCCCTCTAGTGGGACGAGG - Intronic
974899971 4:67984804-67984826 CGCTGTCTTCTAAGGCAACTGGG - Intergenic
980374321 4:131923716-131923738 CACTCCCCTCCAAGAAAACTTGG + Intergenic
980389018 4:132120941-132120963 CTCAGCCTACTAAGGGAACTGGG - Intergenic
980524188 4:133968230-133968252 CACTACTTTCCAAGGGAACTTGG - Intergenic
982211332 4:153039093-153039115 CTCTGCCCTGGCAGGGAACTTGG - Intergenic
984484179 4:180345575-180345597 CACTGCCCTCAAAGGGCATCAGG - Intergenic
984858878 4:184219423-184219445 CACTCCCCTCTCAGGGGACTTGG + Intronic
985603033 5:844675-844697 CTCTGCACCCAAAGGGAACTCGG + Intronic
988346284 5:30041864-30041886 CCCTGCACTCTAGGGGACCTGGG + Intergenic
994224033 5:97231219-97231241 CACTGCCCCCTAGAGGAACAAGG - Intergenic
994699825 5:103120140-103120162 GACTGCCCTCTAAAGGACCCGGG - Exonic
994753318 5:103764748-103764770 CCCTGCCCTCTCAGGGGCCTGGG - Intergenic
997432028 5:133847428-133847450 CACTGCCCTCTCAGAGAACCAGG - Intergenic
1000209162 5:159095398-159095420 CGCGTCCCTCCAAGGGAACTCGG - Intronic
1001600335 5:172924177-172924199 CTCTGCCCTCTCTGGGCACTAGG + Intronic
1004828954 6:19456333-19456355 CCCTGCCCTCTAAGGCAAGCTGG - Intergenic
1009294120 6:61922581-61922603 CACTGCACTCACAGGGAACCAGG + Intronic
1013088034 6:106873485-106873507 GACTGCCCTCTAAGGGGGGTAGG - Intergenic
1017907433 6:158766789-158766811 AACTGCTTTCTAAAGGAACTGGG + Exonic
1018492573 6:164309093-164309115 AACTGACCTCTAAGCTAACTGGG + Intergenic
1018789965 6:167140739-167140761 CACTTCCCTGTCAGAGAACTGGG - Intergenic
1021297365 7:18924581-18924603 CGCTGCCTTCTAAGGAAAATGGG - Intronic
1022805200 7:33814445-33814467 CACTGGACTCTAAGGGAATGAGG + Intergenic
1030082848 7:105792220-105792242 CACTTCCCTCTAGGGAAACTAGG - Intronic
1032196322 7:129790917-129790939 AAGTGCCCTCTGAGTGAACTTGG - Intergenic
1033554275 7:142474787-142474809 CACTGCCCTCTAGGAGTGCTTGG + Intergenic
1033556544 7:142492892-142492914 CACTGCCCTCTAGGAGGGCTCGG + Intergenic
1036580811 8:10073958-10073980 CACTGATCTCTAAGGGATCTAGG + Intronic
1038045460 8:23762086-23762108 CTCTGCCTACTAAGGGAAGTGGG + Intergenic
1041880562 8:62745231-62745253 CACTGTCCTCAAAGGAACCTTGG + Intronic
1044932725 8:97265515-97265537 CACTGCCCACTGAGGTAATTGGG - Intergenic
1047803382 8:128333025-128333047 TCCTGCCCTCTAAGAGAACAGGG - Intergenic
1050480473 9:6082404-6082426 CTCTGCCCTCTAAAGGAATGGGG - Intergenic
1057147830 9:92770390-92770412 CCCTGACCCCTAAGGGACCTTGG - Intergenic
1059418924 9:114179062-114179084 CTCAGCCCTCTAAGGGAAGCAGG - Intronic
1062363340 9:136197690-136197712 CAATGGCCTCTACGGGAGCTTGG - Exonic
1185445939 X:258103-258125 CACTGCCCTCCCAGGGTAATCGG + Intergenic
1192413256 X:70953770-70953792 CTCTGCCCTTTAAGGCAGCTGGG - Intergenic
1193191732 X:78579125-78579147 CACTGCCATCAAAGGCAACAAGG - Intergenic
1196702516 X:118687142-118687164 GGCTGCCTTCTATGGGAACTCGG + Intergenic
1197634761 X:128902594-128902616 CACTGCCATGGCAGGGAACTGGG + Intergenic
1199038203 X:143078593-143078615 CACTGCCTACTGAGGGAAATGGG - Intergenic
1199615667 X:149652894-149652916 CACTGCCACCTCAGGGGACTGGG - Intergenic
1199642832 X:149880972-149880994 CACTGCCACCTCAGGGGACTCGG + Intergenic
1199947075 X:152678916-152678938 CACTGCCACCTCAGGGGACTCGG + Intergenic
1199962606 X:152789538-152789560 CACTGCCACCTCAGGGGACTCGG - Intergenic
1199965965 X:152821252-152821274 CACAGCCCTCTTGGGGCACTAGG + Intergenic
1201972666 Y:19814343-19814365 CTCTGCCCTCTAAAGGAAATGGG + Intergenic