ID: 1168802291

View in Genome Browser
Species Human (GRCh38)
Location 20:651400-651422
Sequence GACAGGACGTTAAAAGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168802288_1168802291 9 Left 1168802288 20:651368-651390 CCTACGGTTCTAGCACGGAAGGC 0: 1
1: 0
2: 0
3: 1
4: 12
Right 1168802291 20:651400-651422 GACAGGACGTTAAAAGCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 108
1168802284_1168802291 18 Left 1168802284 20:651359-651381 CCCTCAGAGCCTACGGTTCTAGC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1168802291 20:651400-651422 GACAGGACGTTAAAAGCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 108
1168802285_1168802291 17 Left 1168802285 20:651360-651382 CCTCAGAGCCTACGGTTCTAGCA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1168802291 20:651400-651422 GACAGGACGTTAAAAGCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168802291 Original CRISPR GACAGGACGTTAAAAGCCAG TGG Intronic
900468816 1:2840604-2840626 GGCAGGAAGTTCAAAGCCTGGGG + Intergenic
902774888 1:18668265-18668287 GCCAGGACGTTGAAATTCAGAGG - Intronic
903066088 1:20700433-20700455 GAGAGAACGTGAGAAGCCAGGGG + Intronic
904373249 1:30064103-30064125 GGCAGGAAGTTAAACGGCAGTGG - Intergenic
905519122 1:38584500-38584522 GACAGCAGGTCAAATGCCAGTGG - Intergenic
908214326 1:61935259-61935281 GCTAGGTCCTTAAAAGCCAGTGG - Intronic
909380600 1:74993895-74993917 GACAGGCCATTAAAAACCTGTGG + Intergenic
920733902 1:208513808-208513830 GACAAGGCCTTCAAAGCCAGAGG + Intergenic
922392118 1:225155563-225155585 TACAGGACTATAAAATCCAGAGG - Intronic
923888545 1:238185181-238185203 GAGAGCACGTTAAAAGCCCAAGG + Intergenic
1068998809 10:63240182-63240204 GACAGGGTTTTAAAAGACAGTGG + Intronic
1070661254 10:78306920-78306942 GGCAGGATGTTAAGAGCCTGTGG + Intergenic
1070994067 10:80760177-80760199 GACAGGAGGTCCACAGCCAGAGG - Intergenic
1071275666 10:84052606-84052628 GACAGGACTTGAGAAGGCAGGGG + Intergenic
1072823189 10:98578914-98578936 GACAAGGAATTAAAAGCCAGGGG - Intronic
1075405200 10:122190681-122190703 GACAGGCCGTTAAAAATCAGGGG + Intronic
1078360149 11:10661690-10661712 GGCAGGACGGTGAAAGTCAGAGG - Intronic
1079257536 11:18845184-18845206 GCCAGAACGTTAAATGTCAGAGG - Intergenic
1081163753 11:39784588-39784610 GTCAGGCAGTTAGAAGCCAGAGG - Intergenic
1083675235 11:64321504-64321526 GACAGGCAGTGAACAGCCAGGGG - Intronic
1086584581 11:88435889-88435911 GACATGATTTTAAAAACCAGTGG + Intergenic
1088760930 11:112928062-112928084 GAAAGGACCTTACAAGGCAGAGG - Intergenic
1094075265 12:26465478-26465500 GACAGCAAGTTATGAGCCAGTGG + Intronic
1095261330 12:40103263-40103285 GAAAGGACGTTCTAAGCAAGGGG - Intronic
1099204127 12:79708946-79708968 GACAGAAAATTAATAGCCAGAGG - Intergenic
1101844899 12:108355481-108355503 GACTGGACATTAAAAGACATGGG + Intergenic
1104806758 12:131594376-131594398 GGTTGGACATTAAAAGCCAGAGG + Intergenic
1105801551 13:23907558-23907580 TACAGGGCCTTAAAAGCCATTGG + Intergenic
1107409423 13:40144596-40144618 GACAGGAAGATAAAAGCAGGAGG + Intergenic
1114259910 14:21029163-21029185 GACTGGCCTTTTAAAGCCAGTGG + Intronic
1114642567 14:24233164-24233186 AACAGGGCGTTAAAGCCCAGGGG + Exonic
1116556236 14:46312681-46312703 GACAGGGCATTAAAAAGCAGTGG + Intergenic
1122058253 14:99119609-99119631 GACAGGACTTTAAAGAACAGTGG - Intergenic
1125217064 15:37287271-37287293 GAGAGGTCGCTAAGAGCCAGAGG + Intergenic
1130912759 15:88282400-88282422 TACAGGACTTTAAGACCCAGTGG + Intergenic
1132611301 16:817593-817615 GACCGTCTGTTAAAAGCCAGCGG - Intergenic
1133389990 16:5402397-5402419 GACAAGACGTGAGAGGCCAGTGG + Intergenic
1133770611 16:8865449-8865471 GACAGGATGATAGAAGGCAGGGG + Intronic
1146269458 17:31474999-31475021 GAAGGAACGTTTAAAGCCAGGGG + Intronic
1147018403 17:37511073-37511095 GTTCAGACGTTAAAAGCCAGTGG + Intronic
1153380722 18:4436299-4436321 GACAGGAACCTAAAAGCCAGTGG + Intronic
1153841120 18:9008911-9008933 GGCTGGACATTAAAAGCAAGAGG + Intergenic
1159517290 18:69473871-69473893 GATAGGAAGCTAAAAGCAAGAGG - Intronic
1161548230 19:4895479-4895501 GACAGGACGACAAATGTCAGAGG - Intronic
1162954902 19:14092143-14092165 GGCTGGACGTTAAAATCTAGCGG + Exonic
1162985837 19:14269000-14269022 GCCAGCACTTTAAAAGGCAGGGG - Intergenic
1164580659 19:29433014-29433036 TCCAGGACGTTAAAAGGCACAGG + Intergenic
1166037426 19:40179103-40179125 AAGAGGCCGTTAGAAGCCAGAGG - Intergenic
1167155573 19:47736601-47736623 GATGGGACCTCAAAAGCCAGAGG + Intronic
1168099697 19:54134380-54134402 GACAGGACCTAGAAAGTCAGAGG - Intergenic
928979025 2:37119191-37119213 GTCCGGACCATAAAAGCCAGAGG + Intronic
935361207 2:102247525-102247547 AACAGGAAATTCAAAGCCAGAGG + Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
942491394 2:176493168-176493190 GACAGGGAGTTAAAATTCAGAGG - Intergenic
942513512 2:176727738-176727760 GACAATAAGTTAAAACCCAGAGG + Intergenic
943520367 2:188942338-188942360 GACAGGAAGTTACAAGCCAATGG - Intergenic
944103404 2:196053863-196053885 GACAGGCAGTTAAGAGCTAGAGG + Intronic
946512597 2:220375315-220375337 TAAAGGAAGTTAAAAGCCTGTGG + Intergenic
948957962 2:241309018-241309040 GACAGGAGGTGAAAAGCACGGGG - Intronic
1168802291 20:651400-651422 GACAGGACGTTAAAAGCCAGTGG + Intronic
1169045176 20:2529268-2529290 CACAGGGCGTTCAAATCCAGGGG - Intergenic
1169380180 20:5099524-5099546 GACAGTATCTTAAAAGCTAGAGG - Intronic
1174730931 20:52916504-52916526 GACAGGACTTAAAAAGCAAAGGG - Intergenic
1175285148 20:57832945-57832967 GACTGGACTTGAAATGCCAGGGG - Intergenic
1185274456 22:49944328-49944350 GATGGGACGTTAGACGCCAGGGG - Intergenic
956196421 3:66657393-66657415 GACAGGACTTTAAAAAACAGAGG + Intergenic
959761173 3:109967048-109967070 GACAGGAGGTAAAAATCAAGTGG - Intergenic
961964192 3:130885648-130885670 AACAAGACGTTAAAAAGCAGGGG - Intronic
962773180 3:138631980-138632002 GCCAGGAAGCTAATAGCCAGGGG + Intronic
963341692 3:144043021-144043043 GATAGTACATTAAAAGGCAGAGG - Intronic
965487442 3:169295147-169295169 GACAGGAGGTTCAAAGCCAAAGG - Intronic
967104002 3:186240838-186240860 AAGAGGACCTTAAAAGCCTGAGG + Intronic
969699155 4:8756760-8756782 GACAAGACATGAAAAACCAGGGG + Intergenic
974777322 4:66502115-66502137 GAAAGGACATTAAAAGACAATGG - Intergenic
977395124 4:96461565-96461587 GAAATAAAGTTAAAAGCCAGAGG - Intergenic
981566791 4:146110323-146110345 GACAGGAGAGAAAAAGCCAGTGG + Intergenic
987177606 5:15332180-15332202 GACAGGAAGTAAATAGCCACTGG - Intergenic
991295552 5:65076466-65076488 TACAAGACGTTTAAAGGCAGAGG + Intergenic
991728200 5:69558439-69558461 GACAGGATTTTAAAAGGGAGAGG - Intergenic
991804629 5:70413586-70413608 GACAGGATTTTAAAAGGGAGAGG - Intergenic
991866755 5:71069436-71069458 GACAGGATTTTAAAAGGGAGAGG + Intergenic
993524589 5:88948645-88948667 GACAGCACCCCAAAAGCCAGAGG - Intergenic
994315957 5:98333403-98333425 GACTGGATGTTAAAAGGCATTGG + Intergenic
994616399 5:102109187-102109209 CACAGGAAGTTATAAGCCAGAGG + Intergenic
1000159649 5:158584681-158584703 AACAGGAAGTTAAAAAGCAGGGG - Intergenic
1003050489 6:2776549-2776571 GTCAGGAGTTTAAAAGCCAAAGG + Intronic
1004701298 6:18082118-18082140 GACACCACGTTAAGAGCCAAAGG - Intergenic
1009957388 6:70472047-70472069 CACAGGAGATTCAAAGCCAGTGG + Intronic
1015408169 6:132860907-132860929 GAGAGGACGGTAAAAGTCAGAGG - Intergenic
1015723384 6:136270716-136270738 GACAGGAGGATAAAAACCAATGG + Intronic
1016891257 6:149008992-149009014 GACTGCACCTTAAAAGACAGGGG + Intronic
1018518822 6:164619978-164620000 AGCAGTACTTTAAAAGCCAGTGG + Intergenic
1019900430 7:4016214-4016236 CACATGCCGTGAAAAGCCAGCGG + Intronic
1026808702 7:73444293-73444315 AACAGGACACTAAAAGGCAGTGG + Intronic
1027706977 7:81548031-81548053 GACAAGACGTTAAAAGGAAAGGG - Intergenic
1034985750 7:155514108-155514130 GACAGTACGTAAAAAGGCAGAGG + Intronic
1039400969 8:37268972-37268994 GGAAGGACTTGAAAAGCCAGTGG + Intergenic
1039845891 8:41325190-41325212 GACAGGGCGGAAAAAACCAGTGG - Intergenic
1042065256 8:64867900-64867922 GTCAGGACTTTAAAAGCCTCTGG - Intergenic
1043883753 8:85574590-85574612 TACAGGAGGCTAAAAGTCAGAGG + Intergenic
1045398963 8:101792081-101792103 GACAAGGAGTTAAAAGGCAGGGG + Intronic
1053143953 9:35699401-35699423 GACAGGACATTCAAAGCGTGTGG - Exonic
1053547114 9:39034790-39034812 GATTGGACATTAAAAGCAAGGGG - Intergenic
1053811431 9:41856458-41856480 GATTGGACATTAAAAGCAAGGGG - Intergenic
1054619163 9:67330981-67331003 GATTGGACATTAAAAGCAAGGGG + Intergenic
1057722670 9:97545553-97545575 GTCAGGAGGTTAGAAGGCAGCGG + Intronic
1058815756 9:108681347-108681369 GACCTGATGTCAAAAGCCAGTGG - Intergenic
1060022733 9:120146285-120146307 CACAAGAAGATAAAAGCCAGAGG - Intergenic
1060090394 9:120737909-120737931 GACAGGAATTTCAAGGCCAGAGG - Intergenic
1186749817 X:12609838-12609860 GGCAGGCAGTGAAAAGCCAGTGG + Exonic
1194169675 X:90565753-90565775 GACAAGATTTTAAAAGGCAGGGG - Intergenic
1194437897 X:93892238-93892260 AACAAGAAGTTAAAAGACAGAGG - Intergenic
1194887150 X:99330692-99330714 GGCTGGACATTAAAAGCAAGTGG + Intergenic
1194948802 X:100100119-100100141 GTCAGTACGTTAAAAGCCCCCGG - Intergenic
1195719214 X:107849920-107849942 GACAGGAGGTTGGCAGCCAGGGG - Intronic
1200482502 Y:3723363-3723385 AACAAAACGTTAAAAACCAGAGG + Intergenic
1200515915 Y:4143527-4143549 GACAAGATTTTAAAAGGCAGGGG - Intergenic