ID: 1168805157

View in Genome Browser
Species Human (GRCh38)
Location 20:668400-668422
Sequence ATACCTATCCTGCAACTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168805152_1168805157 14 Left 1168805152 20:668363-668385 CCTTCCTCTGCCCTAAGAGTGAC 0: 1
1: 1
2: 2
3: 17
4: 206
Right 1168805157 20:668400-668422 ATACCTATCCTGCAACTGACAGG 0: 1
1: 0
2: 0
3: 6
4: 61
1168805150_1168805157 26 Left 1168805150 20:668351-668373 CCCAGACAGGTACCTTCCTCTGC 0: 1
1: 0
2: 2
3: 19
4: 197
Right 1168805157 20:668400-668422 ATACCTATCCTGCAACTGACAGG 0: 1
1: 0
2: 0
3: 6
4: 61
1168805155_1168805157 4 Left 1168805155 20:668373-668395 CCCTAAGAGTGACTATAGAAGGC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1168805157 20:668400-668422 ATACCTATCCTGCAACTGACAGG 0: 1
1: 0
2: 0
3: 6
4: 61
1168805156_1168805157 3 Left 1168805156 20:668374-668396 CCTAAGAGTGACTATAGAAGGCT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1168805157 20:668400-668422 ATACCTATCCTGCAACTGACAGG 0: 1
1: 0
2: 0
3: 6
4: 61
1168805153_1168805157 10 Left 1168805153 20:668367-668389 CCTCTGCCCTAAGAGTGACTATA 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1168805157 20:668400-668422 ATACCTATCCTGCAACTGACAGG 0: 1
1: 0
2: 0
3: 6
4: 61
1168805151_1168805157 25 Left 1168805151 20:668352-668374 CCAGACAGGTACCTTCCTCTGCC 0: 1
1: 0
2: 2
3: 25
4: 195
Right 1168805157 20:668400-668422 ATACCTATCCTGCAACTGACAGG 0: 1
1: 0
2: 0
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168805157 Original CRISPR ATACCTATCCTGCAACTGAC AGG Intronic
909806137 1:79875840-79875862 ATAACTATCCTGCCTCTGCCTGG + Intergenic
920909691 1:210204609-210204631 ATACCCACTCAGCAACTGACAGG + Intergenic
1064792791 10:18977314-18977336 ATAACTCTCCTCCAACTGCCTGG - Intergenic
1066293382 10:34034004-34034026 ATACCTATCCTGGGAATGAAAGG - Intergenic
1068412251 10:56671531-56671553 ATCCCTATACTACAACTGAAGGG + Intergenic
1078963371 11:16306410-16306432 ATACCTAATCTTCTACTGACTGG - Intronic
1092032099 12:5294739-5294761 GTACATATCCTGCAACTGTTAGG - Intergenic
1096301894 12:50436188-50436210 ATATATATCCCGCTACTGACTGG + Intronic
1098667843 12:73186280-73186302 AGACCTAACCTGTAACTGATTGG - Intergenic
1101559117 12:105838961-105838983 AGACCTCTCCTGCACCTGTCTGG + Intergenic
1106997171 13:35498976-35498998 ATACCTATTCTTCAATTGCCTGG - Intronic
1112307499 13:98288328-98288350 ATGGCTATTCTGGAACTGACGGG + Intronic
1112872612 13:103993542-103993564 CTACCAATCCTGAAACTTACAGG - Intergenic
1113482375 13:110630869-110630891 ACAGCTGTCCTGCAACTGCCCGG + Intronic
1118000399 14:61517871-61517893 ATACCTATCCTGTTCCTGGCTGG + Intronic
1125046824 15:35251270-35251292 TTACCCCTCCTGCAACTAACTGG + Intronic
1126326434 15:47482548-47482570 ATACATATCCTGCACGTGACTGG - Intronic
1140998593 16:80286105-80286127 ATGGCTATTCTGGAACTGACTGG + Intergenic
1141963985 16:87429064-87429086 ATACCTAGGCTGGAACTTACGGG + Intronic
1144643836 17:16954984-16955006 CTCCCTACCCTGCAACTGGCAGG + Intronic
1155842258 18:30660185-30660207 AGACCAAACCTACAACTGACTGG + Intergenic
1163187567 19:15649770-15649792 ATCCCCATCCTGCATCTGAGGGG + Intronic
1164265179 19:23609226-23609248 AGACCAAACCTGCAAATGACTGG - Intronic
930418487 2:51119889-51119911 ATGACTATCCTGCTATTGACTGG + Intergenic
934098346 2:88627717-88627739 ATACCTTTCCTACAACAGATTGG + Intergenic
934994810 2:98948134-98948156 AGACCTATCCTGCAAATGCCTGG + Intergenic
942022204 2:171877287-171877309 ATACCAAGGCTTCAACTGACTGG + Intronic
942023392 2:171889293-171889315 ACACCTATCCTAAAACTGACAGG + Intronic
942876107 2:180800653-180800675 ATACCTATCTTGCCAATGAGAGG + Intergenic
946701343 2:222417304-222417326 ATATTTTCCCTGCAACTGACTGG + Intergenic
1168805157 20:668400-668422 ATACCTATCCTGCAACTGACAGG + Intronic
1169379606 20:5095317-5095339 AAACCTATCCTGCCTCTCACTGG + Intronic
1171096523 20:22337274-22337296 AGACCTTTCCTGCAAATGAATGG - Intergenic
972734686 4:41829224-41829246 ATACTTATTCTCCAACTGCCAGG + Intergenic
975153636 4:71046591-71046613 ATACCAAGCCTACAACTAACCGG + Intergenic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
982859684 4:160433589-160433611 AAACCAAACCTGCAACTGATAGG - Intergenic
983545911 4:168963996-168964018 ATAACTAAAATGCAACTGACAGG + Intronic
984953836 4:185025979-185026001 ATGTCTATTTTGCAACTGACAGG - Intergenic
989682463 5:44045711-44045733 AGACCAAACCTACAACTGACTGG - Intergenic
990711089 5:58581795-58581817 ATACCTATCAGTCAACTGACAGG + Intergenic
992648327 5:78833029-78833051 ACACCTATCCTGCAGGTGCCGGG - Intronic
1000934977 5:167296587-167296609 ATACTTATCCTGCAGTTGACTGG - Intronic
1002216456 5:177638181-177638203 AGACCAAACCTGCATCTGACTGG - Intergenic
1003510917 6:6779666-6779688 AGACCTATCCTTCAAGTTACTGG - Intergenic
1005248072 6:23911560-23911582 ATACCCTTCCTGCAATTAACTGG + Intergenic
1006876454 6:37301628-37301650 ATTTATATCCAGCAACTGACAGG - Intronic
1008404135 6:51100142-51100164 ATACCTATGCTTCCACTGAGAGG - Intergenic
1009452443 6:63817619-63817641 AGAGCTAACCTGCAAATGACTGG + Intronic
1012239470 6:96855775-96855797 ATATCTACCTTGCAACTTACAGG + Intergenic
1013502440 6:110766280-110766302 ATGCCTGGCCTGCAAATGACAGG - Intronic
1014087370 6:117362975-117362997 ATAAATATACTGCAACTGCCTGG - Intronic
1019489421 7:1304930-1304952 TAACCTCACCTGCAACTGACAGG + Intergenic
1035773568 8:2170040-2170062 TGACCTACCCTGCATCTGACTGG + Intergenic
1042382475 8:68133370-68133392 ATTCTTATCCTGCAATTGACTGG - Intronic
1046357128 8:113102114-113102136 GTACATATCCTGTAAATGACAGG + Intronic
1050391127 9:5145592-5145614 AGACCCAGCCTGCAACTGATTGG - Intronic
1058140962 9:101356650-101356672 ATACATACCTTGCACCTGACTGG - Intergenic
1058374458 9:104306420-104306442 AGACCGAACCTGCAATTGACTGG + Intergenic
1058489319 9:105479358-105479380 ATACCTATCCTTGATCTGTCTGG - Exonic
1187428141 X:19197093-19197115 GTACCTACCCAGCAACTGTCAGG + Intergenic
1188413041 X:29897521-29897543 AAACTTATCCAGCAAGTGACAGG + Intronic
1192142220 X:68655462-68655484 ATACCTATCACCCAGCTGACAGG - Intronic
1196410699 X:115415120-115415142 CTACATATCCTACAACTCACAGG - Intergenic
1197302142 X:124794234-124794256 ATAGTTAGCCTGCTACTGACTGG - Intronic
1199032262 X:143014124-143014146 AGACCTGCCCTGCAACTGAGAGG + Intergenic