ID: 1168805178

View in Genome Browser
Species Human (GRCh38)
Location 20:668535-668557
Sequence GCGACTTACCCAAGGTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1428
Summary {0: 1, 1: 7, 2: 70, 3: 343, 4: 1007}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168805178_1168805182 11 Left 1168805178 20:668535-668557 CCATGTGACCTTGGGTAAGTCGC 0: 1
1: 7
2: 70
3: 343
4: 1007
Right 1168805182 20:668569-668591 GGGCTCAAATCCTCCATTTGAGG 0: 1
1: 0
2: 2
3: 3
4: 112
1168805178_1168805181 -9 Left 1168805178 20:668535-668557 CCATGTGACCTTGGGTAAGTCGC 0: 1
1: 7
2: 70
3: 343
4: 1007
Right 1168805181 20:668549-668571 GTAAGTCGCATAACTTATCTGGG 0: 1
1: 0
2: 0
3: 8
4: 131
1168805178_1168805180 -10 Left 1168805178 20:668535-668557 CCATGTGACCTTGGGTAAGTCGC 0: 1
1: 7
2: 70
3: 343
4: 1007
Right 1168805180 20:668548-668570 GGTAAGTCGCATAACTTATCTGG 0: 1
1: 0
2: 0
3: 14
4: 121
1168805178_1168805183 18 Left 1168805178 20:668535-668557 CCATGTGACCTTGGGTAAGTCGC 0: 1
1: 7
2: 70
3: 343
4: 1007
Right 1168805183 20:668576-668598 AATCCTCCATTTGAGGAATGTGG 0: 1
1: 0
2: 1
3: 27
4: 221
1168805178_1168805186 26 Left 1168805178 20:668535-668557 CCATGTGACCTTGGGTAAGTCGC 0: 1
1: 7
2: 70
3: 343
4: 1007
Right 1168805186 20:668584-668606 ATTTGAGGAATGTGGACCAGAGG 0: 1
1: 0
2: 3
3: 12
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168805178 Original CRISPR GCGACTTACCCAAGGTCACA TGG (reversed) Intronic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901148959 1:7087642-7087664 GTGACTTGCCTAAGGTCACATGG - Intronic
901197420 1:7447902-7447924 GCTATTTGCCCAAGGTCACATGG + Intronic
901219546 1:7575557-7575579 GTGACTAGCCCAAAGTCACATGG - Intronic
901797718 1:11690502-11690524 GCGACTTGCTCGAGGTCATAGGG + Intronic
901801925 1:11713266-11713288 CTGTCTTGCCCAAGGTCACACGG + Intronic
901805951 1:11738680-11738702 GTGACTTGCCTAAGGTCACTAGG + Intronic
901824133 1:11849586-11849608 GCCACTTGCCCAAGGCCACTAGG + Intergenic
901839700 1:11946154-11946176 GGGACTTGCCCCAGGTCACATGG + Intronic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902377252 1:16035587-16035609 GTGACTTGACCAAGGTCACAAGG - Intergenic
902381085 1:16052567-16052589 AGGACTTGCCCAAGGTCACCCGG - Intronic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902382430 1:16058842-16058864 GTGACTTGACCAAGGTCACAAGG - Intronic
902431034 1:16363323-16363345 GAGACTTGCCCAAGGTCACAAGG + Intronic
902434228 1:16386983-16387005 GGAACTTACCCAAGGTCACAAGG - Intronic
902525758 1:17056235-17056257 GGGGCTTATCCAAGGTCACATGG - Intergenic
902556803 1:17251619-17251641 ACAACTTGTCCAAGGTCACATGG + Intronic
902596230 1:17511408-17511430 GTGGCTTTCCCAAAGTCACAGGG + Intergenic
902654194 1:17856442-17856464 GAGACTTACCCAAGGCCATGCGG + Intergenic
902795171 1:18796168-18796190 GTGACTGGCCCAAGGTCACACGG - Intergenic
903008220 1:20312397-20312419 GTGTCTTATCCAAGGTCACCTGG + Intronic
903010131 1:20323985-20324007 GTCACCTGCCCAAGGTCACATGG + Intronic
903030401 1:20459793-20459815 ATGCCTTGCCCAAGGTCACATGG - Intergenic
903049436 1:20589724-20589746 ATGACTTGCCCAAGGTCACACGG + Intronic
903086717 1:20867467-20867489 GTGACTTGGCCAAAGTCACATGG - Intronic
903143757 1:21356405-21356427 GGGACTTGCCCAAGACCACAGGG - Intergenic
903186457 1:21632053-21632075 GTGACCCGCCCAAGGTCACATGG + Intronic
903239621 1:21974228-21974250 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903243429 1:21999156-21999178 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903247413 1:22025971-22025993 GGGACTTGCCCAAAGCCACAAGG - Intergenic
903250777 1:22052017-22052039 GTGACTTGCCCCAGATCACAGGG - Intergenic
903269312 1:22177787-22177809 GAGATTCACCCAGGGTCACACGG - Intergenic
903284199 1:22266997-22267019 GTGACTTGCCCAAGGCCACAAGG + Intergenic
903301258 1:22380159-22380181 GTCCCTTGCCCAAGGTCACAAGG - Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903422385 1:23227293-23227315 GACACTTGCCCAAGGTCTCACGG + Intergenic
903451235 1:23455138-23455160 GCAGCTTGCCCGAGGTCACACGG - Intronic
903464782 1:23544610-23544632 GTAACTTACCCAAGGCCACAGGG + Intergenic
903576346 1:24341905-24341927 GCAACTTTCCCGAGGTGACACGG - Intronic
903642263 1:24868067-24868089 GCGGCTTGCCCAAGGCTACACGG - Intergenic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903742202 1:25564875-25564897 GTGACTTGCCCAAGGTCTCACGG + Intronic
903755105 1:25655176-25655198 AGGACTTTCCCAAGATCACACGG - Intronic
903885624 1:26539475-26539497 ATGACTTGCCCAAGGTTACAAGG - Intronic
903892859 1:26581456-26581478 GCAACTTGCCCAAGGTCACATGG - Intergenic
903954465 1:27015492-27015514 GGGACTTCCCCAAGGTCACGTGG - Intergenic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904046817 1:27614239-27614261 GTGACTTGCCCAAGGCCACATGG + Intronic
904102541 1:28044289-28044311 GTGACTTGTCCAAGGTCATAGGG - Intronic
904208401 1:28869952-28869974 ATGACATGCCCAAGGTCACAAGG - Intergenic
904324541 1:29719736-29719758 GTCACTTGCCCAGGGTCACATGG + Intergenic
904328683 1:29744208-29744230 GAGACTCACCCAGGGGCACATGG - Intergenic
904405923 1:30287856-30287878 GTGATTTGTCCAAGGTCACAGGG + Intergenic
904417807 1:30373758-30373780 GTGACACACCCAAGGTCACACGG + Intergenic
904463703 1:30695484-30695506 GGAACTTGCCCGAGGTCACATGG + Intergenic
904478499 1:30779544-30779566 ACCACACACCCAAGGTCACAAGG + Intergenic
904483223 1:30807150-30807172 GTGCCCTCCCCAAGGTCACACGG + Intergenic
904565811 1:31427732-31427754 GAGGCCTAGCCAAGGTCACATGG + Intronic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904703856 1:32375900-32375922 GTAACTTGCCCAAGTTCACATGG - Intronic
904752477 1:32749532-32749554 GTGACTTGCTCAAGTTCACATGG + Intronic
904807569 1:33142569-33142591 GAGACTTGCTCAGGGTCACATGG + Intergenic
904900987 1:33856833-33856855 GCCACCTCTCCAAGGTCACATGG - Intronic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
905043442 1:34978154-34978176 GTAATTTGCCCAAGGTCACATGG - Intergenic
905242423 1:36589486-36589508 GCCACTTGCATAAGGTCACAGGG + Intergenic
905282621 1:36858987-36859009 GCAACTTGCCTGAGGTCACATGG + Intronic
905357224 1:37393166-37393188 GTAATTAACCCAAGGTCACATGG - Intergenic
905562687 1:38940082-38940104 GGGATTTGCCTAAGGTCACATGG - Intronic
905597789 1:39223381-39223403 GCAGCTTGCCCAAGATCACAAGG - Intronic
905788909 1:40779803-40779825 GTGACTTGCCCAAGGTCCCCAGG + Intergenic
905894264 1:41534933-41534955 GTGACTTGCCCAAGGTCACCTGG - Intronic
905894426 1:41535792-41535814 GTGTCTTGCCCAAAGTCACAAGG + Intronic
906072740 1:43029023-43029045 GCTACCTGCCCCAGGTCACACGG - Intergenic
906248216 1:44291971-44291993 GTCACTTACCCCAGGACACATGG - Intronic
906265495 1:44425625-44425647 GAGACTTACCCAGCATCACACGG - Intronic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906676294 1:47695868-47695890 GAGACTAATCCAAGGTCACAGGG - Intergenic
906683237 1:47745124-47745146 AGGACTTGGCCAAGGTCACATGG + Intergenic
906718868 1:47991185-47991207 ATGACTTGCCCAAGGTCACGTGG - Intronic
906774025 1:48512485-48512507 GGGACTTGCCCAAGGCCACAGGG + Intergenic
906791312 1:48660751-48660773 ATGGCTTACCCAAAGTCACACGG - Intronic
906800339 1:48731674-48731696 GCAAATTCCCCAAGGTGACAGGG + Intronic
906805349 1:48775349-48775371 GAGACTTGCCCAGGGTCTCATGG - Intronic
906949244 1:50321093-50321115 GTCACTTGCCCAAGTTCACATGG + Intergenic
906951179 1:50335495-50335517 AGAACTTACCCAAGGTCACAGGG + Intergenic
906964844 1:50446182-50446204 GTGACTTAGCTGAGGTCACACGG + Intronic
907262950 1:53235305-53235327 GGAACTTGCCCAAGGTCACATGG + Intronic
907309472 1:53531043-53531065 GTGACCTGCCCAAGGTCACAGGG + Intronic
907329043 1:53659496-53659518 AGGACTTCCTCAAGGTCACATGG + Intronic
907393571 1:54174484-54174506 GACACTTGCCCAAGGTCACCTGG + Exonic
907412074 1:54290028-54290050 GGCACTTGTCCAAGGTCACATGG + Intronic
907492390 1:54816373-54816395 GCAACTTGCCCAAGGTAACACGG - Intronic
907557795 1:55359805-55359827 GTGAATTGCACAAGGTCACATGG + Intergenic
907560268 1:55381490-55381512 GTCACTTGCCCAAAGTCACATGG + Intergenic
907783355 1:57587758-57587780 GAGACTTGCCCAAGGCCACTAGG + Intronic
907785687 1:57610443-57610465 GGGACTTGCCCAATGTCACCTGG + Intronic
907803977 1:57800118-57800140 GCAACTTGGCCAAGGTTACATGG + Intronic
907873210 1:58462040-58462062 GTTACTTACCCAAGGACTCAGGG + Intronic
907896698 1:58699570-58699592 ACGACTCGCCCAAGGTCACACGG + Intronic
907987889 1:59550873-59550895 GTAACTTGCCCAAGGCCACATGG - Intronic
908255318 1:62298607-62298629 GTGACTTACCCAAGGTCACACGG - Intronic
908463832 1:64372035-64372057 GTAACTTGACCAAGGTCACATGG - Intergenic
908653283 1:66359957-66359979 GCAACTTGCCCAAGCTCAGAGGG - Intronic
909428158 1:75552139-75552161 GTGGCTTGCCCAAGATCACAGGG - Intronic
909547070 1:76859849-76859871 GCCATTTGCCCAAGGTCACTTGG - Intergenic
912391434 1:109305979-109306001 GTGACTTGTCCAAGGTCACAGGG + Intronic
912420526 1:109539534-109539556 GCAACTTGCCCAAGGTCACACGG + Intergenic
912853322 1:113145754-113145776 AGGACTTGCCCAAGGCCACATGG + Intergenic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913112342 1:115667571-115667593 GGGACCTGCTCAAGGTCACAGGG + Intronic
913186736 1:116375214-116375236 GTGACTTGCTCAAGGTCAAACGG + Intronic
913681450 1:121189594-121189616 GAGGCTTGTCCAAGGTCACACGG + Intronic
914033281 1:143977231-143977253 GAGGCTTGTCCAAGGTCACACGG + Intergenic
914156165 1:145090736-145090758 GAGGCTTGTCCAAGGTCACACGG - Intronic
914343871 1:146781788-146781810 GTGATGCACCCAAGGTCACATGG + Intergenic
914433438 1:147640214-147640236 AGGAGTTGCCCAAGGTCACAGGG + Intronic
915063471 1:153205570-153205592 GCAACTTGCCTAAGGTTACAAGG - Intergenic
915525030 1:156470670-156470692 GTAACTTACCCAAGGTCACATGG - Intronic
915538351 1:156551437-156551459 GGGATTTGCTCAAGGTCACATGG + Intronic
915725214 1:158012366-158012388 GTGACTTGCACAAGGTCACACGG - Intronic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
915972395 1:160363899-160363921 GTGACTTATCCAAGGTCACCAGG + Intergenic
916444322 1:164857766-164857788 GCAACATATCAAAGGTCACATGG - Intronic
916592026 1:166201096-166201118 GTGGCTTGCCCAAGTTCACATGG - Intergenic
916788173 1:168101591-168101613 GTAACTTGCCCAAGGTCACGTGG - Intronic
916886847 1:169077867-169077889 GTGACTTGCCCAAAGTCATACGG + Intergenic
916970930 1:170014963-170014985 ATAACTTGCCCAAGGTCACATGG + Intronic
917259451 1:173150949-173150971 GTGACTTTCACAAAGTCACATGG + Intergenic
917262372 1:173184195-173184217 ATGACTTTCCCAAGGTTACATGG + Exonic
917630726 1:176888838-176888860 GTAACTTGCCCAAGGTCACATGG - Intronic
917630828 1:176889798-176889820 GTGACTTGCCCAGGGTCATAGGG + Intronic
917733492 1:177899462-177899484 GTAACTTACCCAAGGTTACAAGG + Intergenic
917818929 1:178740858-178740880 GCGATTTGCCCAAGGTTGCAGGG - Intronic
918094281 1:181321830-181321852 CCGATTTGCACAAGGTCACATGG - Intergenic
918105874 1:181414750-181414772 GTGACTTTCTCAAGGTCACGTGG + Intronic
919745787 1:201008475-201008497 ATGACTAGCCCAAGGTCACAAGG + Intronic
919818179 1:201455233-201455255 GGGAGTTGTCCAAGGTCACAGGG + Intergenic
919954205 1:202396302-202396324 GTAACATGCCCAAGGTCACATGG - Intronic
919979688 1:202635150-202635172 GCAACTTGCCCAAAGTCCCATGG + Intronic
920177406 1:204111317-204111339 GCAACTTGCCCTAGGTCACTTGG + Intronic
920346504 1:205309087-205309109 GAGATTTGCCCAAGGCCACAAGG - Intronic
920356989 1:205381060-205381082 CTAACTCACCCAAGGTCACAGGG + Intergenic
920365866 1:205448155-205448177 GTGACTGGGCCAAGGTCACACGG + Intronic
920438674 1:205964264-205964286 GAGACTCACCCAAGGCCACATGG + Intergenic
920468764 1:206208112-206208134 GAGGCTTGTCCAAGGTCACACGG + Intronic
920689208 1:208132897-208132919 GCAACTTGCCCAAGGTCACATGG + Intronic
920872640 1:209806627-209806649 GTAACTTACCCAGGGTCACACGG - Intergenic
920872920 1:209808927-209808949 GTGATTTACTCAAGGTCACATGG + Intergenic
921167976 1:212520826-212520848 ATGACTTGCCCAAGGTCACAAGG + Intergenic
921514826 1:216077041-216077063 GTAACTTTCCCAAGGTCACATGG - Intronic
921964604 1:221075166-221075188 GTAACTTTCTCAAGGTCACAAGG - Intergenic
922109167 1:222540609-222540631 GCAACTTGCTCAGGGTCACATGG - Intronic
922945117 1:229507764-229507786 GTGACTTACACCAGATCACACGG + Intronic
923143778 1:231183849-231183871 GTGACTCACCTAATGTCACAGGG + Intronic
923221689 1:231900514-231900536 ATGACTTGCCCAAGGTCACCTGG + Intronic
923641560 1:235766605-235766627 GTAACTTACCTAAGATCACATGG - Intronic
924623415 1:245681530-245681552 GGGACTTACACAGGGTCACGTGG + Intronic
1063454312 10:6172554-6172576 GTGACTTATCCAAGACCACAGGG + Intronic
1063735069 10:8743763-8743785 GAAACTTGCCCAAGGTCACATGG - Intergenic
1064105877 10:12500625-12500647 GCAACTCGTCCAAGGTCACAAGG - Intronic
1065134944 10:22658854-22658876 GTAACTCACCCGAGGTCACAAGG + Intronic
1065761392 10:28986430-28986452 GGGACTTACCCATGGTCTAATGG - Intergenic
1065850445 10:29783333-29783355 GCGATTTGCTCAAGGTCACATGG + Intergenic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1066425863 10:35307088-35307110 GCGTGTTACCCGAGGGCACAAGG - Intronic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1067370459 10:45677571-45677593 GTAACCTCCCCAAGGTCACATGG - Intergenic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1068012205 10:51466010-51466032 GCAATTTGCCCAAGGTCATAAGG + Intronic
1068216308 10:53986918-53986940 GTGACTTGACCAAGGCCACAGGG + Intronic
1068605976 10:59005468-59005490 GTGATTTGCCCAAGGTTACAGGG + Intergenic
1068737217 10:60427788-60427810 GCAATTTTCCCAAGGTCACCAGG + Intronic
1069606367 10:69741201-69741223 GCAACCTATCCAAGGACACATGG - Intergenic
1069750660 10:70743359-70743381 AGCATTTACCCAAGGTCACATGG + Intronic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1069872577 10:71542271-71542293 GTAACTTGCCCAAGGTCACATGG - Intronic
1069925303 10:71846210-71846232 GCAACTTGCCCAAGGTCGTACGG + Intronic
1070306857 10:75244932-75244954 GTGACTTATCCAAAGTCCCACGG + Intergenic
1070400780 10:76051763-76051785 GAGACTGAACCAAGATCACAGGG + Intronic
1070492423 10:76990111-76990133 GGAACTTACTCAAAGTCACATGG + Intronic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1070743200 10:78916155-78916177 GTGAGTTACCCAAGGTCACAGGG + Intergenic
1070758552 10:79008849-79008871 GTAACGTGCCCAAGGTCACAGGG + Intergenic
1070770478 10:79079602-79079624 GCGACTTGACCAAGGCCACAGGG + Intronic
1070772852 10:79092380-79092402 GTGACTGACCCAAGATCACATGG - Intronic
1070779188 10:79127630-79127652 GAGACTTGACCAGGGTCACACGG + Intronic
1070802117 10:79249935-79249957 GTGACTTACTCAAAGTCACCTGG - Intronic
1070978649 10:80626928-80626950 GGGATTCACCCAAAGTCACAGGG - Intronic
1071481476 10:86068169-86068191 GTGACTTGGCCAAGGTCACATGG + Intronic
1071942158 10:90601790-90601812 GAGACTTACTCACTGTCACAAGG - Intergenic
1072009773 10:91292604-91292626 GCTACCTACCCATGGTCACAGGG - Intergenic
1072159301 10:92751524-92751546 GAGACTTACTTAAGGTCACATGG + Intergenic
1072569775 10:96648433-96648455 GTGACTTACCCAACGTCACAAGG + Intronic
1072835896 10:98711544-98711566 ACAACTTACCCAAGGTCACATGG - Intronic
1072847187 10:98844637-98844659 GCGACTTTCCTAAGGCCATATGG - Intronic
1073044923 10:100631470-100631492 GTGACTTACCAAAGGTCACATGG + Intergenic
1073204011 10:101759092-101759114 AAAACTTTCCCAAGGTCACAAGG + Intergenic
1073294596 10:102431493-102431515 GTAACTTGCCCAAGGTCACAAGG + Intronic
1073503085 10:103959871-103959893 GTGACTTGCCCAATGTCACAGGG + Intergenic
1073511131 10:104043225-104043247 ATGACTTGCCCAAGGTCCCACGG - Intronic
1073604638 10:104881821-104881843 GTGGCTTCTCCAAGGTCACATGG - Intronic
1073703377 10:105955477-105955499 GCCACTTGCTCAAGGTCTCATGG + Intergenic
1073710369 10:106030026-106030048 GCGAATTGCACAAAGTCACATGG - Intergenic
1074187848 10:111112698-111112720 GTAACTTGCCCAAGGTTACATGG + Intergenic
1074392193 10:113067718-113067740 AAGACTTGCTCAAGGTCACATGG - Intronic
1074404726 10:113171019-113171041 AGGAATTACCCAAGGACACACGG - Intergenic
1074476339 10:113778136-113778158 GTGAATTTCCTAAGGTCACAGGG - Intronic
1074822012 10:117186699-117186721 GTAACTTGCCCAAGGTCACATGG - Intergenic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1075073641 10:119335842-119335864 GCTACTTGCTCAAAGTCACAGGG - Intronic
1075116184 10:119628902-119628924 GGAACTTACCCAAGGTCACACGG - Intergenic
1075211407 10:120494360-120494382 GCACCTTGCCCAAGGTCACGTGG + Intronic
1075466724 10:122656995-122657017 GAGACTTACCCAAAGTCACAGGG - Intergenic
1075468782 10:122672393-122672415 GAGACTTTCCCAAAGTCACAGGG - Intergenic
1075533480 10:123250362-123250384 GTAACTTACCTAAGGTCACATGG + Intergenic
1075617254 10:123899704-123899726 CCAAGTTTCCCAAGGTCACATGG - Intronic
1075737995 10:124675819-124675841 GGGCCTTGCCCAAAGTCACATGG - Intronic
1075931351 10:126299466-126299488 GCAACTTGCCCAAGGTTACCTGG + Intronic
1076381110 10:130025054-130025076 GCCACTTGCCCAAGGCCACTGGG - Intergenic
1076398602 10:130161275-130161297 GTGACTTGCCCAAGGTCACCTGG + Intronic
1077486877 11:2842934-2842956 GTGACTTGCCCAAGGTCACCCGG + Intronic
1077532808 11:3105154-3105176 GTGACTTGTCCAAGGTCACACGG + Intronic
1077856330 11:6129823-6129845 GAAACTTGCCCAAGGTCACAGGG + Intergenic
1078107347 11:8366545-8366567 GCCACTTGCCCAAGGTCACTTGG - Intergenic
1078157656 11:8812667-8812689 GGGACTTGCCCAATGGCACATGG - Intronic
1078256768 11:9664680-9664702 GGGACTTGCCCAAGGTCGCTGGG + Intronic
1078325388 11:10376382-10376404 GTGATTAACCCAAGGGCACATGG + Intronic
1078362604 11:10680694-10680716 ACAGCTTGCCCAAGGTCACATGG - Intronic
1078374313 11:10780639-10780661 GTAACTTGCCCAAAGTCACATGG - Intergenic
1078430209 11:11282487-11282509 GAGACTTGTCCAGGGTCACATGG + Intronic
1078561104 11:12373517-12373539 GAGATTTACCCAAGATCACCTGG + Intergenic
1078753699 11:14188734-14188756 AGGACTTTCCCAAGGTCACATGG - Intronic
1078798356 11:14616786-14616808 GCAACTGACCCAAAGTCTCATGG + Intronic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1078899055 11:15624353-15624375 AGTACTTGCCCAAGGTCACATGG - Intergenic
1079092718 11:17492287-17492309 GTCACTTGCCCCAGGTCACACGG - Intergenic
1079149664 11:17886083-17886105 GAGATTTACCCAAAGTCACATGG - Intronic
1079238737 11:18707380-18707402 GTAACTTACCCCAGGTCACGAGG - Intronic
1079351857 11:19698474-19698496 GTGGCTTTCCCAAGGTCACCCGG + Intronic
1079587238 11:22141036-22141058 GTGACTTTCCCAAGGTCACATGG - Intergenic
1079996110 11:27296771-27296793 GACACTTATGCAAGGTCACATGG + Intergenic
1080067729 11:28039072-28039094 GTGAGTTGCCCAAGGTCACTTGG - Intronic
1080644792 11:34180689-34180711 GCGCCTTGCTCAAGGTTACACGG + Intronic
1080691120 11:34558878-34558900 GCGCCTTGCCTGAGGTCACATGG - Intergenic
1080694338 11:34588245-34588267 GTAATTTGCCCAAGGTCACATGG - Intergenic
1080888421 11:36387706-36387728 GTGACTTGCCCAAGGCCACAGGG + Intronic
1081361375 11:42183916-42183938 GTCAATTACCCCAGGTCACATGG + Intergenic
1081607155 11:44534560-44534582 GTTACTTGCCCAAGGTCACATGG - Intergenic
1081662265 11:44895413-44895435 GTGACTTTCCCAAGGTCTCCAGG + Intronic
1081742727 11:45452203-45452225 GAGGCTTTCCCAAGGTCACAGGG + Intergenic
1081915846 11:46729636-46729658 GCAACTTGCTCAAAGTCACATGG - Intronic
1081997593 11:47375317-47375339 GAGACTTGCACAAGGTCACACGG - Intronic
1082071080 11:47940159-47940181 GTGACTTGCCCAAGGTCAAGAGG + Intergenic
1082791036 11:57346982-57347004 GTGACTTGGCCAAGGTCACAGGG - Intronic
1082802764 11:57426784-57426806 GGAACTTGCCCAAGGTCACAGGG + Intronic
1083175894 11:60950340-60950362 TCAACTTGCCCAAGGTGACATGG - Intronic
1083260369 11:61519230-61519252 GAGACTTACCCACAGTCACAGGG + Intronic
1083260905 11:61522614-61522636 GCCACTTGCCCAAGGTGATATGG + Intronic
1083445525 11:62705994-62706016 GCGACTTGCCTAAGGTCGCACGG + Intronic
1083488730 11:62999573-62999595 GCACCTTGACCAAGGTCACAGGG + Intronic
1083555950 11:63628183-63628205 GTGACTTATCAGAGGTCACATGG + Exonic
1083609383 11:63997929-63997951 GGGACTTGCCCAGGGTCCCAGGG + Exonic
1083655173 11:64226041-64226063 CAGACTTGCCCAAGGTCACACGG + Exonic
1083715001 11:64570053-64570075 GTGACTTATCCAAAGTCTCATGG + Intronic
1083741819 11:64715291-64715313 GGGACTTGCCCAAGGTCACACGG + Intronic
1083801523 11:65048835-65048857 ATGACTTTCCCAGGGTCACACGG + Intronic
1083949328 11:65945428-65945450 GGGACTTACACCAGGTCACACGG + Exonic
1084148660 11:67278041-67278063 GCAACTTGCCCAAGGACAAAAGG - Intronic
1084443799 11:69191674-69191696 GCAACGTAGCCAATGTCACATGG + Intergenic
1084705989 11:70816281-70816303 GTGACTTGCCCAAGGTCAGCTGG + Intronic
1085104206 11:73827943-73827965 TTGACTTACCCAAAGTCACAAGG - Intronic
1085121119 11:73968283-73968305 GGAACTTGGCCAAGGTCACACGG + Intronic
1085170763 11:74448119-74448141 GTGGGTTGCCCAAGGTCACATGG - Intergenic
1085346967 11:75774498-75774520 GTGTTATACCCAAGGTCACATGG - Intronic
1085393960 11:76196904-76196926 GTGATGTGCCCAAGGTCACATGG - Intronic
1085394151 11:76198174-76198196 GTGACTTGCTCAAGGTCGCAAGG - Intronic
1085408160 11:76276324-76276346 GTGCCTTGCCTAAGGTCACATGG + Intergenic
1085465727 11:76722103-76722125 GTGACTTGCCTGAGGTCACATGG + Intergenic
1085626662 11:78079149-78079171 GCAGCTTGCCCAAGGTCATATGG - Intronic
1085760831 11:79239868-79239890 GTGACTTACCCAAAGTCACGTGG - Intronic
1085781438 11:79412516-79412538 GTGACTTATCCAAGGTCACATGG - Intronic
1085803781 11:79615869-79615891 GTAACTTACCCAAGAACACATGG - Intergenic
1085828873 11:79878088-79878110 GTAATTTACCCAAGGTCAGAAGG - Intergenic
1086076915 11:82864538-82864560 ATGACTTAGCCATGGTCACAAGG + Intronic
1086094129 11:83033588-83033610 GTAACTTGCCCAAGGTCATAAGG + Intronic
1086356537 11:86007016-86007038 GTAACTTCCCCAAAGTCACAGGG + Intronic
1086367064 11:86117978-86118000 TCGACTATTCCAAGGTCACATGG - Intergenic
1086751492 11:90500372-90500394 GTAACTTAGCCAAGGTCATAGGG + Intergenic
1086931150 11:92694640-92694662 GCTCCTTGCCCAGGGTCACATGG - Intronic
1086994819 11:93344227-93344249 GAGACATACACAAGGTCAAATGG - Intronic
1087263394 11:96035865-96035887 GTAACTTGCCCACGGTCACATGG - Intronic
1087662235 11:101001117-101001139 GTAACTTGCCCAAGGTCACATGG - Intergenic
1088367804 11:109057447-109057469 GTGACTTGCCTAAGGTCACCTGG + Intergenic
1088455258 11:110026746-110026768 GAAACTTGCCCAAGGTCACAAGG - Intergenic
1088505227 11:110520975-110520997 AGGACCTGCCCAAGGTCACACGG + Intergenic
1088807721 11:113367291-113367313 GCAACTTGCCCAAAGTCACATGG - Intronic
1089159287 11:116425063-116425085 GTGAATTGCCCAAGGTCACAGGG + Intergenic
1089256850 11:117198743-117198765 GCGTCTTCCTCAAGGCCACATGG - Intergenic
1089306214 11:117527942-117527964 AAAACTTGCCCAAGGTCACAGGG - Intronic
1089503666 11:118948596-118948618 ATGACTTTCCCAAGGTCACAGGG - Intronic
1089586703 11:119514044-119514066 GTGACTTTCCCAGAGTCACACGG - Intergenic
1089665710 11:120017240-120017262 GTCACTTGCCCAAGGTCACCCGG - Intergenic
1089685871 11:120146567-120146589 GTAACCTGCCCAAGGTCACAAGG + Intronic
1089705408 11:120274219-120274241 AGAACTTGCCCAAGGTCACATGG - Intronic
1089974238 11:122718466-122718488 ATAACTTGCCCAAGGTCACACGG - Intronic
1089994612 11:122893897-122893919 AAGACTTGCCCAAGCTCACATGG + Intronic
1090253396 11:125266271-125266293 GTCACTTGCCCAAGGTCACACGG + Intronic
1090405605 11:126474374-126474396 GTGACTGGCTCAAGGTCACATGG + Intronic
1090601106 11:128372376-128372398 GGGATTCACCAAAGGTCACATGG + Intergenic
1090704380 11:129323205-129323227 GTAACTTGCCCAAGGTTACATGG - Intergenic
1091004588 11:131941427-131941449 GTAACTTGCCCAAGGTCACATGG - Intronic
1091452516 12:582071-582093 AGAACTTACCCAAAGTCACACGG + Intronic
1091503862 12:1046779-1046801 GTAAGTTGCCCAAGGTCACATGG + Intronic
1091536236 12:1412669-1412691 GTGACTTTCCCAAGGTCACAGGG - Intronic
1091600906 12:1917155-1917177 GTGACTTCCCCAAGTTCACAAGG - Intronic
1091641824 12:2242951-2242973 GTGACTTACCCACGATCATAGGG + Intronic
1091852574 12:3712199-3712221 GCCAACTTCCCAAGGTCACAGGG - Intronic
1091855997 12:3740796-3740818 GCAACTTGCTCGAGGTCACATGG - Intronic
1091930232 12:4390042-4390064 GTGATTTGCCCAAGGTTACACGG + Intergenic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1092162222 12:6321943-6321965 ATAACTTACCCAAGGTCACATGG - Intronic
1092236808 12:6815544-6815566 GTAACTCACCCAAGGTCACATGG - Intronic
1092262834 12:6961705-6961727 GTCACTTGCCCAAGGTCACAGGG + Intergenic
1092989951 12:13886998-13887020 GTAACTAACCCAAGGTTACATGG + Intronic
1093259488 12:16917790-16917812 TGGACTTACCCAAGGCCAGAGGG - Intergenic
1093851495 12:24045190-24045212 GTAACTTACCAGAGGTCACATGG - Intergenic
1094003058 12:25717151-25717173 ATGAACTACCCAAGGTCACAGGG + Intergenic
1094107588 12:26830970-26830992 GTAACTTTCCCAAGGTCATAAGG + Intronic
1094299647 12:28948424-28948446 GTGATTTGCCCAAGGTCACATGG + Intergenic
1094525997 12:31231700-31231722 GTTACTTTGCCAAGGTCACATGG - Intergenic
1095456470 12:42391050-42391072 TTGATTTGCCCAAGGTCACATGG + Intronic
1095464209 12:42473711-42473733 GAGACTTGTCCAAGGTCATATGG + Intronic
1095752482 12:45728058-45728080 CTGCCTAACCCAAGGTCACAGGG - Intergenic
1095881070 12:47136923-47136945 GGGAGTTACCCAAGGTTACGTGG - Intronic
1095993157 12:48052773-48052795 GGGATTTATGCAAGGTCACATGG - Intronic
1096108490 12:49013656-49013678 GCAACTTGCCCAAGGTCACATGG + Intronic
1096123180 12:49101894-49101916 GTGACTTGCCCAAAGACACAGGG - Intronic
1096500479 12:52061589-52061611 ATGACTTTCCCAAGGTCACCTGG + Intergenic
1097337868 12:58404755-58404777 GTGATTTGCCTAAGGTCACATGG + Intergenic
1097356826 12:58611631-58611653 GGAACTTGCTCAAGGTCACACGG + Intronic
1097759685 12:63448764-63448786 CTAACTTTCCCAAGGTCACATGG - Intergenic
1098229407 12:68357730-68357752 GCAGCTTACCCAAGATCACATGG - Intergenic
1098860588 12:75705689-75705711 GTGATTTACCCAAGGTCATATGG - Intergenic
1098954099 12:76670653-76670675 GGAACTTGCCCAAGATCACAGGG - Intergenic
1099171598 12:79371176-79371198 GAGACTCGCTCAAGGTCACAAGG + Intronic
1099979878 12:89586200-89586222 GTAACTTACTCTAGGTCACATGG - Intergenic
1100141243 12:91621366-91621388 GCCACTTGTCCTAGGTCACACGG - Intergenic
1100461192 12:94800838-94800860 GCGACTTGCCCGAGATCCCATGG - Intergenic
1100507805 12:95237201-95237223 GGAACTTGCCCAAGGTCACAAGG - Intronic
1100665912 12:96752893-96752915 GCAACTCACCCAAGGTTAGATGG - Intronic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1100819424 12:98417497-98417519 GCAACTTGCTCAAGGTCACATGG - Intergenic
1100953550 12:99880321-99880343 ATAACTTGCCCAAGGTCACACGG + Intronic
1101210461 12:102530412-102530434 GTGACTTGCCTAAGATCACAAGG + Intergenic
1101437175 12:104673762-104673784 GGAACTTGCCCAAGGTCACACGG - Intronic
1101474101 12:105027535-105027557 GTCATTTACCCAAGGTCACCAGG - Intronic
1101604241 12:106235751-106235773 GTGACTTGCCCAAGGCCACATGG + Intergenic
1101613188 12:106310638-106310660 GTGACCTTCCCAAGGTCTCATGG + Intronic
1101676351 12:106920406-106920428 ATGACTTCCCCCAGGTCACATGG + Intergenic
1101735155 12:107457914-107457936 GCAAGCTACCCGAGGTCACACGG - Intronic
1101836069 12:108296222-108296244 CTGACTTGCCCAAGGTCACAGGG - Intronic
1101854421 12:108430193-108430215 ATGACTTGCCCAAGGTCACACGG - Intergenic
1101914045 12:108882688-108882710 GCAACTTGCCCAGGGTTACATGG + Intronic
1101925802 12:108970302-108970324 GCAACTTACCCAGGACCACATGG - Intronic
1101965762 12:109280975-109280997 GTCACTCACCCAAGGTCACCTGG - Intronic
1102007754 12:109599283-109599305 CTGTCTTGCCCAAGGTCACATGG - Intergenic
1102008035 12:109601215-109601237 GTGACTTGCCCAGGGTCACGTGG + Intergenic
1102024072 12:109703568-109703590 GGGACCTGCCCAAGGTCACGTGG + Intergenic
1102068788 12:110000247-110000269 ATGCCTTGCCCAAGGTCACAGGG - Intronic
1102193435 12:111006766-111006788 GTGATTTGCCCAAGATCACATGG - Intergenic
1102212920 12:111139922-111139944 GTGACTTACCCAAGGTCACACGG - Intronic
1102230846 12:111261188-111261210 GCCACTTGCCCAAGGTCACCCGG - Intronic
1102302616 12:111781719-111781741 GTGACTTACCCAAGGTCACTTGG + Intronic
1102389787 12:112540228-112540250 AAGACTTGCCAAAGGTCACACGG + Intergenic
1102511619 12:113419424-113419446 GTGACTTACAAAAGGTCACAGGG + Intronic
1102552439 12:113701434-113701456 CTGACTTGCCTAAGGTCACATGG + Intergenic
1102552747 12:113703475-113703497 GCAACTGGCCCAAGGTCACAAGG - Intergenic
1102555986 12:113726803-113726825 GAGACTCTCCCAAGGCCACACGG - Intergenic
1102576082 12:113856920-113856942 GTCACTTGCCCAAGGTCACACGG + Intronic
1102577327 12:113864109-113864131 GTGACTTGCCCAAGGTTCCATGG + Intronic
1102638401 12:114344791-114344813 GTGACTTGCTCAAGGTCATAGGG - Intergenic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1102861269 12:116338462-116338484 TAAACTTACCCAAGGTCACAGGG - Intergenic
1102970052 12:117159370-117159392 GTGACTTTCCCGGGGTCACAGGG + Intronic
1102972114 12:117177150-117177172 GGGATTTACTCAAGGTCACAGGG + Intronic
1103063474 12:117877668-117877690 GGAACTTGCCTAAGGTCACATGG + Intronic
1103165115 12:118763712-118763734 GAGACTTGCCCAGGGTCACATGG + Intergenic
1103174410 12:118849758-118849780 GTGACTTGCACAAGGTCACACGG + Intergenic
1103187853 12:118976928-118976950 GAGATTTACCCAAGGTAACATGG + Intergenic
1103191510 12:119005907-119005929 GAGCTTTGCCCAAGGTCACACGG - Intronic
1103230217 12:119323897-119323919 GAAATTTACCCAAGGTAACAGGG + Intergenic
1103367125 12:120391372-120391394 GTGACTTGCCCAAGGCCACACGG - Intergenic
1103394424 12:120597131-120597153 GCGACTTTCCCAAAACCACATGG + Intergenic
1103548312 12:121717494-121717516 GTCACTTATCCAAGGTCACATGG + Intronic
1103571726 12:121849439-121849461 GCGACTTGCCCAGGGTGAAATGG + Intronic
1103782796 12:123410429-123410451 GTGACTTGACCAATGTCACACGG - Intergenic
1104124708 12:125835376-125835398 ATGATTGACCCAAGGTCACATGG + Intergenic
1104180070 12:126370971-126370993 GTGAGTTACCCTGGGTCACAGGG + Intergenic
1104227144 12:126846532-126846554 GTAACTTACCTAAGGCCACACGG + Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1104543550 12:129689180-129689202 CTGACTTCTCCAAGGTCACATGG + Intronic
1104707588 12:130958940-130958962 GCGATTTGCTCAAGGTCACAGGG + Intronic
1104878009 12:132050009-132050031 GCAAAGTGCCCAAGGTCACATGG - Intronic
1105422375 13:20264499-20264521 GGAACTTCCCCAAGGCCACATGG + Intergenic
1105531373 13:21223751-21223773 ACATCTTGCCCAAGGTCACATGG - Intergenic
1105842872 13:24270646-24270668 GCCACTAACCCTTGGTCACACGG + Intronic
1107257659 13:38447949-38447971 TTGTCTAACCCAAGGTCACAAGG + Intergenic
1107388036 13:39933666-39933688 GTGACTTGCCCAAGGTTGCACGG - Intergenic
1107411357 13:40161573-40161595 GTAACTTACCCAGGGTCACATGG + Intergenic
1107631975 13:42351567-42351589 CAGATTTACCCAAGATCACAAGG + Intergenic
1107729757 13:43336828-43336850 AAGACTTTCCCAAAGTCACAAGG + Intronic
1108065463 13:46572943-46572965 GGAACTTGCCCAAGGTCACTGGG - Intronic
1108144513 13:47463054-47463076 GTGACTTAAGTAAGGTCACATGG + Intergenic
1108450754 13:50560192-50560214 GTAACTTACACAAGGCCACACGG - Intronic
1108623852 13:52208940-52208962 ATGACTTACCCAAAGTGACAGGG - Intergenic
1108662864 13:52602077-52602099 ATGACTTACCCAAAGTGACAGGG + Intergenic
1109415147 13:62029250-62029272 AACACTTACCAAAGGTCACAGGG + Intergenic
1109697531 13:65979424-65979446 GTGTCTTGCCCAAGGTTACACGG - Intergenic
1110136293 13:72071443-72071465 GTAACTTGCCCAAGCTCACACGG + Intergenic
1110857636 13:80313819-80313841 GACACTCACCCAAAGTCACATGG + Intergenic
1110973897 13:81805055-81805077 GTAACTTGCCCAAGGTCACTGGG - Intergenic
1111732599 13:92095973-92095995 GTGACTTTCCCAAGGTCATGAGG + Intronic
1112038388 13:95519016-95519038 GCAATTTACTCAAGGTCACATGG - Intronic
1112244723 13:97721427-97721449 GCTGCTAACCCAAGTTCACAAGG - Intergenic
1112366177 13:98757298-98757320 GCCACGAACCCCAGGTCACATGG - Intergenic
1112548246 13:100392935-100392957 GTGACTCACCCAAGGTTACTTGG + Intronic
1112672074 13:101652340-101652362 GTAACTTACATAAGGTCACATGG - Intronic
1112985947 13:105450043-105450065 GTGACATACCCCATGTCACAGGG + Intergenic
1113355585 13:109576841-109576863 AGGACTTGCCCAAGGTCTCAAGG - Intergenic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1113637226 13:111927966-111927988 GCAACTTTCCCAAGATCACACGG + Intergenic
1113738412 13:112694157-112694179 GCCACTTGCCCAAGGCCACATGG - Intronic
1113864133 13:113509889-113509911 GTGACTCGCCCAAGGTCACGTGG - Intronic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1114995203 14:28341475-28341497 GTAACTAACCCATGGTCACAGGG - Intergenic
1115667425 14:35567524-35567546 GTGACTTGGCCAAGATCACAAGG + Intronic
1116057305 14:39879665-39879687 AAGACTTGCCCAAGGTCACAGGG + Intergenic
1116799000 14:49423205-49423227 ATAACTTACTCAAGGTCACATGG - Intergenic
1117012846 14:51488443-51488465 GGGATTTATTCAAGGTCACATGG + Intergenic
1117061773 14:51971193-51971215 AGGACTTGCCCAAGGTCGCATGG - Intronic
1117457597 14:55913473-55913495 GTGACTTGCCCAAGATCTCACGG + Intergenic
1117538756 14:56726534-56726556 TTAACTTACCCAAGGGCACATGG + Intronic
1118301293 14:64618810-64618832 GTGACTTGCCCATGGTCATAAGG + Intergenic
1118412561 14:65496932-65496954 GTAACTTGCCCAATGTCACAGGG - Intronic
1118753460 14:68822465-68822487 GTGACTTATCCAAGGTCACCAGG + Intergenic
1118909107 14:70046486-70046508 GTGACCTACCCAGGGCCACACGG - Intronic
1118972244 14:70646642-70646664 GGGGCTTATCCAAGGTCACAAGG - Intronic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1119432402 14:74577010-74577032 GTGGCTTGCCCAAGGTCACAAGG + Intronic
1119481800 14:74962652-74962674 AAGACTTGCCCAAGGTCACACGG - Intergenic
1119566589 14:75634319-75634341 CCTACTAGCCCAAGGTCACAAGG - Intronic
1119732361 14:76958895-76958917 GTGATTTGCCCAAGGCCACACGG - Intergenic
1119748878 14:77063888-77063910 GAGACATTCTCAAGGTCACATGG + Intergenic
1119750172 14:77071775-77071797 GCGACATACAGAAGGTCAAAGGG + Intergenic
1120232944 14:81859394-81859416 GTGAGTTGCCCAAGGTCAAATGG - Intergenic
1120359536 14:83480823-83480845 ATGACTTAACCAAAGTCACAGGG + Intergenic
1120465928 14:84857322-84857344 GTAAATTCCCCAAGGTCACAGGG + Intergenic
1120531793 14:85640928-85640950 GCAACTTGCCCAAGGTCACGGGG - Exonic
1120698059 14:87666432-87666454 GTGATGAACCCAAGGTCACAAGG + Intergenic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1121033148 14:90676392-90676414 GTGACTGGCCCAAGATCACATGG + Intronic
1121042029 14:90757550-90757572 ATGATTTGCCCAAGGTCACATGG + Intronic
1121052334 14:90827749-90827771 ACGCCTTTCACAAGGTCACACGG - Intergenic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121308555 14:92922864-92922886 GTGACTTGCCCAGGGACACAAGG + Intergenic
1121323613 14:93007138-93007160 GCTGCCTGCCCAAGGTCACACGG + Intronic
1121429245 14:93875060-93875082 GTGACCTCCCCAAGGTCACATGG - Intergenic
1121505601 14:94474409-94474431 GAGACTTACCTGAAGTCACATGG - Intronic
1121535376 14:94687111-94687133 GTGACTTCCTCAAGGTCACACGG + Intergenic
1121564020 14:94895231-94895253 GTGCCTCACCCAAGGTCACAGGG - Intergenic
1121570606 14:94944087-94944109 GTGACTTGCCCAAGGGCATATGG + Intergenic
1121611345 14:95282959-95282981 GGGACTCACCTAAGGTCACAGGG + Intronic
1121691139 14:95877598-95877620 ATGACTTAATCAAGGTCACAAGG + Intergenic
1121748062 14:96318368-96318390 GTGACCTTCCCAAAGTCACATGG + Intronic
1121812879 14:96907169-96907191 GTGACTTGCACAAGGTTACAAGG + Intronic
1121838974 14:97117055-97117077 ACAACTTGCCCGAGGTCACATGG - Intergenic
1122089981 14:99331479-99331501 GTGACATGTCCAAGGTCACATGG - Intergenic
1122092837 14:99351474-99351496 ATGACTTGCCCAAGGTCGCAGGG - Intergenic
1122131859 14:99608836-99608858 GTCACTTGCCCAAGGTCACATGG + Intergenic
1122145254 14:99684840-99684862 GTCACCTGCCCAAGGTCACACGG + Intronic
1124848333 15:33311985-33312007 GCGACTTGCTCAAGGTCACTTGG - Intronic
1124873359 15:33566051-33566073 CTAACTTGCCCAAGGTCACACGG + Intronic
1126420474 15:48467048-48467070 GGAACTTGCCCAAGGTTACATGG + Intronic
1126582718 15:50255959-50255981 GGGACTAACTCAAGTTCACATGG + Intronic
1126699680 15:51356661-51356683 GTGACCTGCCGAAGGTCACACGG - Intronic
1126737831 15:51750154-51750176 GTGACTTATTCAAGGTCATAGGG - Intronic
1127304168 15:57685794-57685816 ACGACTCGCCCAAGGTCCCACGG - Intronic
1127580733 15:60337206-60337228 GTGACTTTCCCAGAGTCACATGG - Intergenic
1127960803 15:63888891-63888913 GAGACCTGCCCAAGGTTACATGG + Intergenic
1128064125 15:64753960-64753982 GTGACTTGTCCAAGGTCACATGG + Intronic
1128084839 15:64878699-64878721 GGGACTTGCCCAAGGCCACCTGG + Intronic
1128099169 15:64984160-64984182 ATGACTTACCCAAGATCACATGG + Intronic
1128130754 15:65225571-65225593 GCCACTTGGCCAAGGTCAGAGGG - Intergenic
1128171569 15:65517865-65517887 GCGACTTGCTGAAAGTCACAGGG + Intergenic
1128554105 15:68618723-68618745 GTAACTTGCCCAAGGTCACATGG + Intronic
1128709464 15:69860920-69860942 GAGACTTGTCCAAGGTCACATGG + Intergenic
1128754033 15:70169313-70169335 GTGACTCACCCAAGGTTACCAGG - Intergenic
1128770605 15:70278861-70278883 GGGACTCGCCCATGGTCACATGG + Intergenic
1129165178 15:73773122-73773144 AGGGCTTGCCCAAGGTCACACGG + Intergenic
1129190224 15:73933251-73933273 CCAACTCACCCAAGGTCTCAGGG + Intronic
1129237351 15:74231669-74231691 TGGACTTGCCCAAGGTCACACGG - Intergenic
1129257679 15:74343376-74343398 GTCACTTGCCCAAGGTCACATGG + Intronic
1129409181 15:75339425-75339447 ACGACTTAACCACGGTCACATGG + Intronic
1129508255 15:76101149-76101171 GTGACTTTCCCAGGATCACATGG + Intronic
1129521873 15:76191395-76191417 GGGACTTGCTCAAGGCCACAGGG + Intronic
1129526047 15:76215150-76215172 GTGACTTGGCCAAGGCCACATGG - Intronic
1129666160 15:77580633-77580655 ATGACTTTCCCAAGGTCACCCGG + Intergenic
1129698320 15:77753313-77753335 GTGACTTATCCAAGGGCCCACGG - Intronic
1129788932 15:78327833-78327855 GTGACTTACCCAAGGTCCCATGG - Intergenic
1129797846 15:78391640-78391662 ATGACTTACCTAAGGTCCCAGGG - Intergenic
1130152701 15:81323755-81323777 GTGACTTGCCCAAGGTCACCTGG - Intronic
1130164616 15:81440623-81440645 GTGACTTTGCCAAGGTCCCAAGG - Intergenic
1130323180 15:82856941-82856963 ACTCCTTGCCCAAGGTCACATGG - Intronic
1130465757 15:84191471-84191493 GCCACCTACCCCAGGCCACATGG - Intergenic
1130486936 15:84403353-84403375 GCCACCTACCCCAGGCCACATGG + Intergenic
1130498508 15:84482065-84482087 GCCACCTACCCCAGGCCACATGG + Intergenic
1130562888 15:84972355-84972377 GTGACTTGCCCATGGTCACAGGG - Intergenic
1130661470 15:85834322-85834344 GTGACTTCTCCAAGGCCACACGG + Intergenic
1130845968 15:87746152-87746174 GCAAATTACCTGAGGTCACATGG - Intergenic
1130872324 15:87981225-87981247 GTGTCTTACCCAAGGTCACATGG - Intronic
1130903153 15:88222355-88222377 ATGGCTTAGCCAAGGTCACACGG + Intronic
1131066445 15:89437672-89437694 ATGACTTGTCCAAGGTCACACGG + Intergenic
1131691540 15:94832383-94832405 ACGACTTATCCAAAATCACAAGG - Intergenic
1133326344 16:4944609-4944631 GCCACCTGCCCAAGGTCACACGG - Intronic
1133384026 16:5354408-5354430 GTGACTTGCCTAAGGTCACATGG - Intergenic
1133654265 16:7844617-7844639 GTGACTTGCTCAATGTCACACGG + Intergenic
1133730856 16:8577441-8577463 GGGACTTACCTAAGGTCACATGG - Intronic
1133763001 16:8814623-8814645 GGGATTTGCCGAAGGTCACACGG + Intronic
1133864169 16:9626332-9626354 TTGTCTTACCCAAGGTCACATGG + Intergenic
1134110576 16:11513047-11513069 ATGACTTGTCCAAGGTCACACGG - Intronic
1134118954 16:11570339-11570361 GTGACTTTCCCACAGTCACACGG + Intronic
1134129606 16:11640334-11640356 GTGACTTCACCGAGGTCACACGG + Intergenic
1134455161 16:14390073-14390095 GTCACTCACCCAAGGTCACAGGG + Intergenic
1134518650 16:14907397-14907419 GCGGCTCTCCCAGGGTCACACGG - Intronic
1134555279 16:15158819-15158841 GCGGCTCTCCCAGGGTCACACGG + Intergenic
1134567921 16:15266847-15266869 ACGCCCTACCCAAGGTCGCATGG - Intergenic
1134637313 16:15802366-15802388 GCAACTTGCCCAAGGTCACTAGG + Intronic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1134681281 16:16127568-16127590 GTTACTTGCCCAAGATCACATGG + Intronic
1134706321 16:16306050-16306072 GCGGCTCTCCCAGGGTCACACGG - Intergenic
1134734514 16:16489506-16489528 ACGCCCTACCCAAGGTCGCATGG + Intergenic
1134825899 16:17284071-17284093 GTAACTTGCCCAAGGTCACGTGG - Intronic
1134830058 16:17315744-17315766 GCAACTTGCCCAAGGTCACCTGG + Intronic
1134932952 16:18222400-18222422 ACGCCCTACCCAAGGTCGCATGG - Intergenic
1134961219 16:18406060-18406082 GCGGCTCTCCCAGGGTCACACGG + Intergenic
1134965521 16:18488663-18488685 GCGGCTCTCCCAGGGTCACACGG + Intronic
1135001907 16:18783830-18783852 GTGACTTGCCCAAGATCTCATGG + Intronic
1135051636 16:19197839-19197861 GTGACTTGTCCAATGTCACATGG + Intronic
1135159958 16:20085331-20085353 GCGACTTGGTCAAGGTCACGCGG - Intergenic
1135165859 16:20138656-20138678 GAGATTTCTCCAAGGTCACATGG - Intergenic
1135166528 16:20144013-20144035 GTGATTTGCCCAAGGTCACGTGG + Intergenic
1135377869 16:21965044-21965066 ATGACTTGTCCAAGGTCACATGG + Intronic
1135660323 16:24291041-24291063 GTGACATGCCCAAGGTCACCTGG - Intronic
1135875089 16:26191325-26191347 GTGACTTATCTAAGGTCGCAGGG - Intergenic
1135924312 16:26679096-26679118 ATGACTTGCTCAAGGTCACAAGG - Intergenic
1135951293 16:26916811-26916833 GCCACTTGCCTGAGGTCACAGGG + Intergenic
1135968640 16:27055964-27055986 GTCACTTGCCCAAGATCACATGG + Intergenic
1135984108 16:27171126-27171148 GCTACTTTCCCAAAGTCTCATGG + Intergenic
1136065646 16:27756464-27756486 GTCACCTACCTAAGGTCACACGG + Intronic
1136179317 16:28539896-28539918 GGGACTCGCCCAAGGTCACACGG - Intergenic
1136470553 16:30477025-30477047 GAGACTTGACCAAGGTCACATGG + Intronic
1137406639 16:48194184-48194206 GTACCTTATCCAAGGTCACACGG - Intronic
1137571144 16:49567140-49567162 GAGACTTGCCAAAGATCACAAGG + Intronic
1137576135 16:49601558-49601580 GTGACTTGTTCAAGGTCACAAGG + Intronic
1137686895 16:50392579-50392601 AGGATTTAACCAAGGTCACAGGG + Intergenic
1137790023 16:51167066-51167088 ATGACCTGCCCAAGGTCACATGG - Intergenic
1137816929 16:51407118-51407140 ATGACCTGCCCAAGGTCACATGG + Intergenic
1137829729 16:51532984-51533006 GTGACTTGCCTAAGATCACAGGG + Intergenic
1137933697 16:52612832-52612854 GTCACTTGCCCAAGGTCACTTGG - Intergenic
1137983825 16:53091295-53091317 GCAGCTTGCCCAAGGTCACCCGG - Intronic
1138044409 16:53706005-53706027 GTGACTTGCCCAAGGCCACTTGG + Intronic
1138114493 16:54349724-54349746 GCCATCTACCCAAGGTCACAGGG - Intergenic
1138297571 16:55900038-55900060 GGGGATTTCCCAAGGTCACAGGG + Intronic
1138440695 16:57033350-57033372 GTGATTTGCCCAAGGCCACATGG + Intronic
1138480267 16:57298126-57298148 GTGATCTACCCAAGGTCACACGG + Intergenic
1138503439 16:57463224-57463246 GCCACTGAGCCAAGGGCACAGGG - Intronic
1138526230 16:57608972-57608994 GAGACTTGCCCAAGGTCACCCGG + Intergenic
1139236431 16:65344215-65344237 GCTACTTATTCAAGGTCATATGG + Intergenic
1139268613 16:65661925-65661947 GTGGCTTGCCGAAGGTCACATGG - Intergenic
1139461363 16:67125213-67125235 GAGAGTTACCTAAGGTCACCAGG + Intronic
1139704898 16:68734571-68734593 CTGACTTCCCCAAGGTCACAGGG + Intergenic
1139990122 16:70933547-70933569 GTGATGCACCCAAGGTCACATGG - Intronic
1140028411 16:71312920-71312942 GTGATTCACCCAAGGTCACAGGG + Intergenic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140641676 16:76980972-76980994 GGGACTTGCCCAAGGTCATATGG - Intergenic
1140836539 16:78799593-78799615 GGGACTTGGCCAAGGTCACATGG + Intronic
1140897988 16:79342143-79342165 GGGACTTGCCCAAAGTCACCCGG + Intergenic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141201843 16:81904294-81904316 ATGACTCAGCCAAGGTCACATGG + Intronic
1141272130 16:82550800-82550822 GCCACTTACACAATGTCAAACGG + Intergenic
1141470223 16:84233234-84233256 GTGACTTTCCCAAGATCACTGGG + Intronic
1141545617 16:84766250-84766272 GTGACTTGTTCAAGGTCACATGG - Intronic
1141566518 16:84906084-84906106 GAGATTTACCCAGGGTCCCATGG - Intronic
1141617356 16:85217530-85217552 GTGACTTTCCCAAAGCCACATGG + Intergenic
1141818081 16:86426397-86426419 GCCATTTGCCCGAGGTCACATGG + Intergenic
1141889713 16:86918445-86918467 ACGACTTGCCCGAGGTCACTCGG + Intergenic
1141984461 16:87570926-87570948 GGGACTTGCCCAAGGTCACTCGG - Intergenic
1141992938 16:87620748-87620770 GCAAATTTCCCAAGGCCACACGG + Intronic
1142152063 16:88517013-88517035 GCGACCTGCCCCAGGTCACACGG - Intronic
1142616833 17:1141406-1141428 GTAGCTTGCCCAAGGTCACATGG - Intronic
1142673519 17:1498950-1498972 GCACCTTTCCCAAAGTCACAAGG + Intronic
1142950273 17:3472449-3472471 GTAACTTGCCCAAGGTCACAGGG - Intronic
1143100677 17:4503139-4503161 GACACTTACCCAAGGTCACACGG + Intronic
1143289413 17:5817695-5817717 GCAACTTGCTCAAGGCCACAGGG + Intronic
1143352048 17:6295929-6295951 GAGACTTGCCTGAGGTCACAAGG - Intergenic
1143509145 17:7385925-7385947 GTGACTTGCCTAAAGTCACATGG + Intronic
1143610971 17:8017161-8017183 GACACTTTCCCAAGGTCACATGG - Intronic
1143982120 17:10879192-10879214 GTGACTTCCTCAAGGTCGCATGG - Intergenic
1144224762 17:13134240-13134262 GTGACTTGTGCAAGGTCACATGG + Intergenic
1144284109 17:13756014-13756036 GCGACTTACCCAAGACCAAGTGG - Intergenic
1145755396 17:27386341-27386363 GCGAGTCACCCAAGATCACCTGG - Intergenic
1145770918 17:27492499-27492521 GCAGCTTGTCCAAGGTCACATGG - Intronic
1145816305 17:27797456-27797478 GGGACTTGCCAAAGGTTACAGGG + Intronic
1145906703 17:28520352-28520374 GTGACTTTCCTAAGGCCACACGG - Intronic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146076850 17:29738486-29738508 GAGACTTTCTCAAGGTCTCAAGG - Intronic
1146275272 17:31512344-31512366 GTCACTTGTCCAAGGTCACATGG + Intronic
1146455164 17:33004090-33004112 GTGACTTTCCCAAGGTCAGGTGG - Intergenic
1146473161 17:33140426-33140448 GCAATTTACCCAAAGTCACATGG - Intronic
1146478628 17:33184155-33184177 GCGACTTGCCCAAATTCACCTGG + Intronic
1146491807 17:33288831-33288853 GTCACTTGCCCAAGGGCACATGG + Intronic
1146520031 17:33519186-33519208 GTAGCTTACCCAAGGTCACACGG + Intronic
1146665651 17:34701101-34701123 CCAACTTACCCAAAGTCCCATGG - Intergenic
1146674681 17:34765130-34765152 GTGACTGGCCCAGGGTCACATGG + Intergenic
1146894105 17:36528661-36528683 GTAACTTACCCAGGCTCACAGGG - Intronic
1146931519 17:36781363-36781385 GCAACTTGCCCAAAGTCACACGG - Intergenic
1146959097 17:36957208-36957230 GTAACTTGCCCAAGGTCACATGG - Intronic
1147358039 17:39912722-39912744 GTGACTTACCCAAGGTCATGTGG - Intronic
1147386781 17:40087663-40087685 GTAACTTACCCCAGGTCACATGG - Intronic
1147595288 17:41712719-41712741 GTGACTTGCCCAAAGTCACAGGG + Intronic
1147664319 17:42136514-42136536 GTGACTTGGCCAAGGTCACACGG - Intronic
1147789540 17:43004948-43004970 GAAACTTGCCCAAGGTCACAGGG - Intergenic
1147950492 17:44105013-44105035 GAGACTTGTCCAAGGTCACCTGG + Intronic
1148126354 17:45239190-45239212 GAGGCCTATCCAAGGTCACACGG - Intronic
1148196129 17:45714674-45714696 GTAACTTGCCCAAGGTCACACGG + Intergenic
1148330888 17:46813325-46813347 GGGACTCATCCTAGGTCACAGGG + Intronic
1148536127 17:48440549-48440571 ATGACTTGCCCTAGGTCACAAGG - Intergenic
1148546456 17:48522788-48522810 GTGACTTACCCAAGGACACAAGG + Intergenic
1148546614 17:48524172-48524194 GCAACTTGCCCAAGGCCACAGGG + Intergenic
1148732309 17:49844958-49844980 GTGACTTGTCCAAGGTCACACGG + Intronic
1148751954 17:49950502-49950524 GTGACTTGCCCAGGGCCACATGG + Intergenic
1149477931 17:56978823-56978845 ACAACTTGCCTAAGGTCACAAGG - Intronic
1149559859 17:57600935-57600957 GCAGTTTGCCCAAGGTCACATGG + Intronic
1149995975 17:61406060-61406082 GGGACTTGCCAAAGGTCACACGG - Intronic
1150142872 17:62744704-62744726 GTGATTTTCCCAAGCTCACATGG - Intronic
1150645181 17:66973463-66973485 GTGACTTACGCAAGGTGGCATGG + Intronic
1150845936 17:68657991-68658013 GTAACTTGCCCAAGGTCAAATGG + Intergenic
1151414075 17:73950110-73950132 TTGACTTGGCCAAGGTCACATGG - Intergenic
1151880017 17:76889211-76889233 GTGGCTTTCCCAAGGTCACACGG - Intronic
1152020557 17:77778265-77778287 GAGATTTCCCCGAGGTCACACGG + Intergenic
1152025922 17:77809215-77809237 GGGCCTGACCCAAGGTCACAAGG + Intergenic
1152070923 17:78133241-78133263 GCAACGTGCCCACGGTCACAGGG - Intronic
1152689825 17:81712803-81712825 GTGACTCCCCCAAGGTCACCAGG - Intronic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1152997993 18:426055-426077 GTGACTTGTCCAAGATCACATGG + Intronic
1153147381 18:2049076-2049098 GTGACTTGCCCAAGGCCAAATGG - Intergenic
1154111436 18:11571899-11571921 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1155140343 18:23038992-23039014 GCCACTTGCCCATGGTCACATGG - Intergenic
1155245113 18:23900847-23900869 AGGACTGACCCAAGGTTACATGG - Intronic
1155674363 18:28411540-28411562 GTAACTTGCCCAAGGTCACGTGG + Intergenic
1156197209 18:34788501-34788523 GTGACTTGCCCAAGGTCATAGGG + Intronic
1156596378 18:38552410-38552432 GAGGCTTATTCAAGGTCACATGG - Intergenic
1156956125 18:42966004-42966026 GTGGCTTATCCAAGGTCACGTGG - Intronic
1157306427 18:46520884-46520906 ATGACTTGCCCAAGGTCACACGG + Intronic
1157309300 18:46540166-46540188 GTAACTTGCCCAAAGTCACATGG + Intronic
1157511123 18:48275536-48275558 GCGACTTGCCCTAAATCACAGGG + Intronic
1157740958 18:50092384-50092406 GGGACAGGCCCAAGGTCACATGG + Intronic
1158205015 18:54983611-54983633 GTGACTCACCCAAAGTCACTGGG + Intergenic
1158427060 18:57349805-57349827 GTAACTTACCCAAGGTCACCTGG + Intergenic
1158545745 18:58395002-58395024 GTAACTTGCCCAAGGTCACACGG - Intronic
1158833509 18:61305225-61305247 GTGACTTGCCCAAGGTCGCCTGG - Intergenic
1159093832 18:63879432-63879454 GCGACCTACCTAAGATTACATGG + Intronic
1160018518 18:75162723-75162745 GCAACACACCCAAGGTGACATGG - Intergenic
1160233222 18:77064991-77065013 GTGACTTGCCCAAGACCACAGGG - Intronic
1160785016 19:896345-896367 GCTCCTCACCCAAGGTCACACGG + Intergenic
1160874553 19:1291066-1291088 GTGACTCACCCAAGGCCACCCGG + Intronic
1161113433 19:2482699-2482721 GTGACTTGTCCAAAGTCACAAGG + Intergenic
1161672862 19:5623749-5623771 GGGACTCGGCCAAGGTCACACGG + Intronic
1161682102 19:5685211-5685233 GCGACTTGCCCAAGGTCACACGG - Intronic
1161814317 19:6490227-6490249 GTCACTTGCCCATGGTCACATGG - Intergenic
1162068625 19:8140692-8140714 GTCACTTGCCCAAGGCCACAGGG + Intronic
1162135170 19:8550833-8550855 GGCACTTACCCAAGGTCACGCGG - Intronic
1162556208 19:11387560-11387582 GTAACTTACTCAAGGTCCCATGG - Intronic
1163126132 19:15245204-15245226 GGGACTTGTCCAGGGTCACATGG + Intronic
1163129459 19:15263586-15263608 GCCACTTCTCCATGGTCACATGG - Intronic
1163174622 19:15555803-15555825 GTGACTTACCCAAGATCATTCGG + Intergenic
1163174897 19:15557391-15557413 ATCACTTGCCCAAGGTCACACGG + Intergenic
1163372435 19:16908899-16908921 GGGAGTTACCCCAGGTCACGCGG + Intronic
1163432302 19:17275673-17275695 GTGACTTGGCCAGGGTCACATGG + Intronic
1164435453 19:28224644-28224666 GTCACTCACCCGAGGTCACATGG - Intergenic
1164764504 19:30753712-30753734 AGGACTTTGCCAAGGTCACAGGG - Intergenic
1164836747 19:31359957-31359979 GTGACTTGCCCACGGGCACACGG - Intergenic
1164952355 19:32347325-32347347 GTGACTTACCCAAGGTTACATGG - Intronic
1165463502 19:35958645-35958667 GTGACTTGCCCAAGTTCACTTGG + Intergenic
1165717195 19:38053998-38054020 GGGACCTGTCCAAGGTCACACGG + Intronic
1166092301 19:40517838-40517860 ATGATTTGCCCAAGGTCACATGG + Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166656262 19:44614215-44614237 GTCACCTACCCAAGATCACAGGG + Intronic
1166772495 19:45292356-45292378 GTTACTTGCCCAAGGTCACACGG - Intronic
1166773491 19:45298407-45298429 GTGACTTGCTCAAGGTCACTTGG - Intronic
1166830708 19:45638197-45638219 ACGACTTTTCCAGGGTCACACGG + Intronic
1166831585 19:45642583-45642605 GGGACTTCCCCAAGGTCACACGG - Exonic
1166887483 19:45971062-45971084 ACCGCTTGCCCAAGGTCACACGG - Intronic
1166889370 19:45981116-45981138 ATGACTTGCCCAAAGTCACAGGG - Intergenic
1166942343 19:46374471-46374493 GTCACTTGCCCAAAGTCACATGG + Intronic
1166995517 19:46717860-46717882 GCCACTCACCCAAAGTCACATGG - Intergenic
1167020674 19:46873047-46873069 GGGACTTGCCCAAGGCCACATGG + Intergenic
1167036389 19:46997563-46997585 GTCACTTGCCCAAGGTGACACGG + Intronic
1167126957 19:47556072-47556094 GTGACTTGCCCAAAGCCACATGG - Intergenic
1167368612 19:49067537-49067559 AGGTGTTACCCAAGGTCACAAGG - Exonic
1167691972 19:50991067-50991089 GTCACTTACCCGAAGTCACAGGG - Intergenic
1168148479 19:54432447-54432469 GGGACCTTCCCAAGGTCACACGG + Intronic
925309012 2:2868771-2868793 GTAACTTGTCCAAGGTCACACGG + Intergenic
926063581 2:9820158-9820180 AGGACTTGCCCAAGGTCACGCGG + Intergenic
926216860 2:10911404-10911426 GGGACTTGCCCAAGGTCACGCGG - Intergenic
926294912 2:11562178-11562200 ATGACTCACCCAAGGTCACACGG - Intronic
926420437 2:12691369-12691391 AAGACTCACCCAAAGTCACATGG - Intergenic
926694898 2:15764337-15764359 GGGACTTCCCCAAGGTCACATGG + Intergenic
926729267 2:16023010-16023032 GCAACTTGCCCAAGTTCACATGG - Intergenic
926777255 2:16434855-16434877 GCTGCTTAGCCCAGGTCACAGGG + Intergenic
926806775 2:16718396-16718418 GGGGCTTGCCCAAGGACACACGG - Intergenic
926863156 2:17330249-17330271 GAGACTTGCCCAAAGTCACGAGG + Intergenic
927187815 2:20494821-20494843 GCAGCTTGTCCAAGGTCACAGGG + Intergenic
927197904 2:20560678-20560700 GGGACTCACCCAAGGTCACATGG + Intronic
927684336 2:25160444-25160466 GAGACTTGCCTAAGGTCCCATGG + Intergenic
927836144 2:26400935-26400957 GTGACTTGCCCAAGGTGGCAGGG + Intergenic
927915656 2:26934447-26934469 GGGACCTGCCCAAGCTCACAGGG - Intronic
927942724 2:27115407-27115429 TTAATTTACCCAAGGTCACAGGG - Intronic
927970882 2:27305918-27305940 GTGACTTGCCCAAGGTCGTAGGG - Intronic
929490048 2:42388020-42388042 GTGGCTTGCCCAATGTCACATGG - Intronic
929598612 2:43191373-43191395 GTGACCTGCCCAAGGTCACTGGG + Intergenic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930240508 2:48931526-48931548 GAGATTTACCCAGGGACACATGG + Intergenic
930537558 2:52663344-52663366 TTGCCTTATCCAAGGTCACAAGG - Intergenic
930688691 2:54336454-54336476 GTGACTTGCCCAAAGTCACATGG - Intronic
930897088 2:56458990-56459012 GCGATTTATCCAGGGACACATGG - Intergenic
931185038 2:59941660-59941682 GTGATTAGCCCAAGGTCACATGG + Intergenic
931709486 2:64976149-64976171 GTAACTTTCCCAAGATCACAAGG + Intergenic
931988328 2:67762900-67762922 GTAACTTGCCCAAGGTTACATGG + Intergenic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
932046023 2:68350793-68350815 GTAACTTGCCCAAGGTCACATGG + Intergenic
932476860 2:72011722-72011744 GTAACTTACCCAAGTTCACATGG - Intergenic
933808231 2:86015574-86015596 GCCACTTGCTGAAGGTCACAGGG + Intergenic
934603898 2:95679840-95679862 GGGACCTGCCCAAAGTCACAGGG - Intergenic
935375176 2:102388343-102388365 GAAACTTGCCCAGGGTCACACGG + Intronic
936233739 2:110725762-110725784 CTGACTTGCCCAAGGGCACATGG - Intergenic
936373041 2:111919055-111919077 GTGACTTACACAAGGTCACCTGG + Intronic
936487317 2:112937351-112937373 GCAAATTGCCCAAGGTCCCATGG + Intergenic
936537282 2:113322069-113322091 GGGACCTGCCCAAAGTCACAGGG - Intergenic
937022680 2:118672775-118672797 ATGACTCAGCCAAGGTCACATGG + Intergenic
937034588 2:118770207-118770229 GCAACTTGCCCAAGGTCGCATGG - Intergenic
937198396 2:120180462-120180484 GGAACTTGCCCTAGGTCACATGG + Intergenic
937720190 2:125086019-125086041 ACAATTTACCCAAAGTCACATGG + Intergenic
937788004 2:125924779-125924801 GTAACTTTCCCCAGGTCACATGG - Intergenic
938233223 2:129679753-129679775 GTAACTTGCCCAAGGTCACATGG + Intergenic
938571320 2:132564307-132564329 GCCACTCATCCAAGGCCACAGGG - Intronic
939272369 2:139956638-139956660 CTGACTTGCCCAAAGTCACACGG + Intergenic
940006787 2:149015747-149015769 GTAACTTGCCCAATGTCACATGG - Intronic
940188578 2:151014352-151014374 CCCACTTACCTAAGGTCACATGG + Intronic
940259846 2:151768136-151768158 GCAGCTTTCCCAGGGTCACATGG - Intergenic
940383463 2:153043355-153043377 GCGAATTATCCAAATTCACATGG - Intergenic
940907732 2:159184089-159184111 GCGACTTATGCAAGACCACATGG - Intronic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
941329794 2:164165670-164165692 GCCACCGACTCAAGGTCACAGGG + Intergenic
941579619 2:167278601-167278623 GTGACTTACCCAAAGTTGCACGG + Intergenic
941928426 2:170917856-170917878 GCCCCTTACCCAAAGTCAGATGG + Intergenic
944014026 2:195010524-195010546 GTGAAATACTCAAGGTCACAGGG - Intergenic
944554724 2:200876421-200876443 ATAACTTTCCCAAGGTCACAGGG + Intronic
945603789 2:211901211-211901233 GTGACTTATTCAAGGTTACAGGG - Intronic
945622492 2:212158179-212158201 GCAACTTGCCCAAAGTCACATGG + Intronic
945975798 2:216269769-216269791 GCCAGTTCCTCAAGGTCACAAGG + Intronic
945978202 2:216286988-216287010 ATGACTCACTCAAGGTCACACGG + Intronic
946046759 2:216827763-216827785 GGAACTTGCCCAAGGTCATATGG + Intergenic
946395240 2:219440740-219440762 GTTACTTGCCCAAGGTCACATGG - Intronic
946458119 2:219845639-219845661 ATGACCTGCCCAAGGTCACATGG - Intergenic
946565407 2:220959017-220959039 GTGATTTACCCAAAGTCACATGG - Intergenic
946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG + Intronic
947747421 2:232516023-232516045 GAGATTCACCCAAAGTCACATGG + Intergenic
947990372 2:234482914-234482936 GAAAATTACCCAGGGTCACATGG + Intergenic
948378877 2:237539775-237539797 GTGACCTGCCGAAGGTCACATGG + Intronic
948549520 2:238760599-238760621 ACGCCTTACCCAGAGTCACATGG - Intergenic
1168796481 20:613145-613167 GTGACTTGCCCGAGGTCACACGG + Intergenic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1168833478 20:860521-860543 GTGATTTGCCCAAGGTCACATGG - Intergenic
1168858724 20:1029375-1029397 GTCACCTACACAAGGTCACATGG - Intergenic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1168939466 20:1696428-1696450 GGGCCTTGCCCAAGGTCACAGGG - Intergenic
1169733295 20:8810269-8810291 GCGACGTGTCCAAGGTTACATGG + Intronic
1169777949 20:9276590-9276612 GGGATTTGTCCAAGGTCACATGG + Intronic
1169856182 20:10105878-10105900 GTGAATTGTCCAAGGTCACATGG + Intergenic
1170799144 20:19576034-19576056 GGAACTTACCCAAGTACACATGG - Intronic
1170855154 20:20045767-20045789 GTGACTTATCCAAGATCACATGG - Intronic
1171086480 20:22242688-22242710 GTGACTTGTCCAAAGTCACATGG - Intergenic
1171205140 20:23273231-23273253 CTAACTTGCCCAAGGTCACATGG + Intergenic
1171388399 20:24785809-24785831 CCCACTCACCCAAGGGCACAGGG + Intergenic
1171429685 20:25074262-25074284 GAAACTCATCCAAGGTCACATGG + Intronic
1171454305 20:25258860-25258882 GTAACTTGCCCAAGGGCACATGG + Intronic
1172030776 20:31980545-31980567 ATGACTTGCCCAAGGTCACATGG - Intronic
1172109658 20:32537515-32537537 GCGATTTGCCCACAGTCACAAGG + Intronic
1172131755 20:32660611-32660633 GTGACTTGTCCAAAGTCACATGG + Intergenic
1172187810 20:33042157-33042179 GGGACTTTCCTAAGCTCACACGG - Intronic
1172217369 20:33245669-33245691 ATGACTTGCCCAAGGCCACAGGG + Intergenic
1172239217 20:33401227-33401249 GTGACCTGTCCAAGGTCACACGG + Intronic
1172277034 20:33685570-33685592 GTGACTTGCCCCTGGTCACACGG - Intronic
1172331629 20:34079741-34079763 GAGACTTGCCCAAGGTTACATGG + Intronic
1172405399 20:34684895-34684917 GTAACTTGCCTAAGGTCACATGG + Intergenic
1172412206 20:34733481-34733503 ATAATTTACCCAAGGTCACATGG - Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172636570 20:36414140-36414162 GTGACTTGCCTGAGGTCACAAGG + Intronic
1172647170 20:36477858-36477880 GGGACTTGCCCAAGGTCATACGG + Intronic
1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG + Intergenic
1172731822 20:37095300-37095322 GCTACAGGCCCAAGGTCACACGG - Intronic
1172772110 20:37387951-37387973 ATAACTTACCCAAGGTCACATGG + Intronic
1172801180 20:37577297-37577319 GTGACTTGCGCAGGGTCACAAGG - Intergenic
1172810668 20:37645608-37645630 GTGAGTTACTCAAGGTCGCATGG - Intergenic
1172816467 20:37691174-37691196 GTAACTTACCCAAGGACCCATGG + Intergenic
1172852017 20:37973230-37973252 GAGACTTTCCCAAGGCCACATGG + Intergenic
1172852968 20:37979891-37979913 ATGACTTGCCCAAGGTCACACGG + Intergenic
1172855791 20:38001315-38001337 TTAACTTACTCAAGGTCACATGG + Intronic
1172906995 20:38377813-38377835 GTGACCTTCCCAAGGCCACATGG - Intergenic
1172915015 20:38436871-38436893 GTCACTTAGCCAAAGTCACATGG - Intergenic
1173070048 20:39755237-39755259 ATGACTTGCCCAAGGTCTCATGG - Intergenic
1173085239 20:39909650-39909672 CCCACATACCCAAGGTCAAATGG - Intergenic
1173113393 20:40217534-40217556 GTAGCTTACCCAAGGTCACAGGG + Intergenic
1173375204 20:42476836-42476858 GTAACTTACCCAGGGCCACATGG + Intronic
1173421856 20:42908201-42908223 GTGACTTGTCCAAGGTCACATGG - Intronic
1173430442 20:42982954-42982976 ACGATCTTCCCAAGGTCACACGG + Intronic
1173523490 20:43715797-43715819 GTGACTTGTCCAGGGTCACAGGG + Intronic
1173525367 20:43728366-43728388 ACACCTTCCCCAAGGTCACATGG - Intergenic
1173655555 20:44698194-44698216 GTAACTTCCCCAAGGCCACATGG + Intergenic
1173731202 20:45329939-45329961 GCTTCTCAGCCAAGGTCACAAGG + Intronic
1173913450 20:46688416-46688438 GTAACTTGCCCAAGGTTACACGG - Intronic
1173954336 20:47019043-47019065 GTCACTTACCCAAGGTCACACGG + Intronic
1174140443 20:48409565-48409587 GTGACTCACCCAAGGTCACCTGG - Intergenic
1174191408 20:48743178-48743200 AGGACTTGCCCAAGGTCACTGGG + Intronic
1174269138 20:49354338-49354360 GTGCCTTGCCCAAGGTCACATGG + Intergenic
1174367713 20:50066551-50066573 GCCACTGGCTCAAGGTCACAGGG + Intergenic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174392453 20:50226389-50226411 GTGACTTGCCCCAGGTCACACGG - Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1174415941 20:50367140-50367162 ACGACTTTTCCAAGGTCACAAGG - Intergenic
1174426611 20:50436094-50436116 GTAACTTACCCAGGGTCACCCGG - Intergenic
1174458215 20:50664586-50664608 GTGATTTGCCCAATGTCACACGG - Intronic
1174657093 20:52180812-52180834 GTAACCTGCCCAAGGTCACATGG + Intronic
1174723199 20:52835607-52835629 TCAACTAACCCAAAGTCACATGG + Intergenic
1174994544 20:55551170-55551192 GTGACTTACCCAAGGTCACGTGG - Intergenic
1175045131 20:56097778-56097800 GTGACTTACCCAAGGTCACACGG + Intergenic
1175189289 20:57200270-57200292 GTGACTCACCCTAGGTCACAAGG + Intronic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175805394 20:61825636-61825658 GTGACTTGCCCAAGATTACAAGG + Intronic
1175910067 20:62401019-62401041 GCAACTTGCCCAAGATGACATGG + Intronic
1175914204 20:62418263-62418285 GTCACTTGTCCAAGGTCACACGG - Intronic
1176372969 21:6073660-6073682 GGGACTCACTCAAGGTCACAGGG - Intergenic
1177406144 21:20670992-20671014 GTGAATTATCCAAGATCACAGGG - Intergenic
1178235053 21:30832230-30832252 GAGAATTACTGAAGGTCACATGG + Intergenic
1178592292 21:33921565-33921587 GGTACTTGCCCAAGGCCACAGGG + Intergenic
1178681149 21:34672763-34672785 GTAACTTGCCCAAGGTCACACGG - Intronic
1179131103 21:38638174-38638196 GTGACTTGCTCAAGGTCCCATGG - Intronic
1179326623 21:40352742-40352764 GTGAATTACCCAAGATCACATGG - Intronic
1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG + Intronic
1179567267 21:42257143-42257165 GGAACTTGCCCAAGGTCACACGG + Intronic
1179710655 21:43211268-43211290 GTGACTTATCCAAGGTCACAGGG - Intergenic
1179750508 21:43464583-43464605 GGGACTCACTCAAGGTCACAGGG + Intergenic
1180604956 22:17051140-17051162 GTGCCTTACACAAGATCACAAGG - Intergenic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181489798 22:23254482-23254504 GTGGCTTCCCCAAGGTCTCATGG + Intronic
1181601127 22:23952430-23952452 GGGACTTGCACAAGGCCACAGGG + Intergenic
1181609638 22:24003974-24003996 GCGTCTCACCCCAGGTCACAGGG + Intergenic
1181748752 22:24974246-24974268 GAGACCTGCCCAATGTCACAAGG - Intronic
1181762813 22:25069593-25069615 GGGACTTGGCCAAGGTCACGCGG - Intronic
1181773920 22:25146219-25146241 TCGAGTTGCCCAAAGTCACACGG + Intronic
1181936912 22:26445601-26445623 GGGACTTGCCCAAGGTCCCGAGG - Intronic
1181940187 22:26469956-26469978 GCAACTTGCCCAAGGCCGCATGG + Intronic
1181993530 22:26856981-26857003 GTGACTAGCCCAAGGTCACACGG + Intergenic
1182020234 22:27075514-27075536 TTGACTTATCCAAGGTCACAAGG - Intergenic
1182038449 22:27217545-27217567 AAGACTTGCCCAAGGTCACACGG - Intergenic
1182081998 22:27536217-27536239 GTGACTTGGCCAAGGTCACTTGG - Intergenic
1182094846 22:27619200-27619222 GTAACTTGCCCAAAGTCACAAGG - Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182145728 22:27995736-27995758 GTGACTTGCCCAAAGCCACATGG + Intronic
1182270078 22:29147851-29147873 GTTACTCACCCCAGGTCACATGG - Intronic
1182310149 22:29398580-29398602 GTGACTTGCTCAGGGTCACACGG - Intronic
1182475193 22:30573349-30573371 ATGACTTGTCCAAGGTCACATGG - Intronic
1182511036 22:30820580-30820602 GTGACTTGCCCAGGGTCACCAGG - Intronic
1182520594 22:30882439-30882461 GGGACTCGCCCAAGGCCACAAGG - Intronic
1182735288 22:32528865-32528887 GGGTCTTACCCAAGGTCTGAGGG + Exonic
1182740588 22:32564461-32564483 GTAACTTTCCCAAGGTCACACGG + Intronic
1182747844 22:32619225-32619247 GCGACTTAGCCACGATCATATGG - Intronic
1182763630 22:32742993-32743015 GTAACTTACCCAAAGTAACATGG + Intronic
1182766673 22:32762575-32762597 GTGACCTCCCCAAGGTCTCATGG - Intronic
1182778618 22:32849824-32849846 GTGACTTGACCAAGGTCTCATGG - Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183003152 22:34878374-34878396 GTCATTTGCCCAAGGTCACATGG - Intergenic
1183016927 22:34996468-34996490 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1183106032 22:35615725-35615747 GAGACTTGTCCAAGGTCACATGG + Intronic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183183889 22:36280646-36280668 GTGACTTGCCCAGGGTGACAGGG + Intergenic
1183250552 22:36727141-36727163 TTGGCTTTCCCAAGGTCACATGG + Intergenic
1183304302 22:37074127-37074149 GTGACTTGTCCAAGGTCACTTGG + Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183516373 22:38269092-38269114 GCATCTTGCCCAAGGCCACAGGG + Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183567135 22:38623535-38623557 GTGACTCACCCAAGGCCACAAGG - Intronic
1183596129 22:38813051-38813073 GAGACTTCCCCAAGATCACATGG - Intergenic
1183730072 22:39613557-39613579 GTGACTTGCCCAAAGTCACATGG + Intronic
1184060022 22:42075706-42075728 GGAACTTGCCCAAGGTTACATGG - Intronic
1184101965 22:42345464-42345486 GTGACCTTGCCAAGGTCACAAGG + Intergenic
1184108523 22:42382400-42382422 GTGACTTGCCCAAGTCCACAAGG + Exonic
1184271494 22:43387073-43387095 GTGACCTGCCCAAGGGCACAAGG + Intergenic
1184445199 22:44542990-44543012 GTGACTTGCCCAAGGCCACGTGG - Intergenic
1184449986 22:44577056-44577078 GGGACTTGCTCAGGGTCACACGG - Intergenic
1184470765 22:44694643-44694665 GTGACTTATCCTAGGTCACATGG - Intronic
1184499198 22:44861702-44861724 GAGACTTGCCCAAGGTCATGTGG - Intronic
1184508398 22:44917801-44917823 GTGACCTGCCCAAGGCCACAGGG - Intronic
949135585 3:561088-561110 GTAAGTTGCCCAAGGTCACACGG - Intergenic
949142989 3:657855-657877 GTGACATTCCAAAGGTCACATGG - Intergenic
949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG + Intronic
949517706 3:4822075-4822097 GTGACTTGCCCAGGGTCACACGG - Intronic
949731186 3:7115124-7115146 GCCACTTATCTAAGGTCAGATGG + Intronic
949856431 3:8466103-8466125 GTGATCTACCCAAGGTCACACGG + Intergenic
949903866 3:8842368-8842390 GCAACTTGCCTAAGGCCACATGG - Intronic
949916167 3:8966285-8966307 ACAACTTACCCAAGTTAACATGG - Intergenic
949941891 3:9161482-9161504 ACAACTTGCCCAAGGTCACGTGG + Intronic
949953200 3:9246533-9246555 ATGACTTGCCCAAGGTCACAAGG - Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950155854 3:10721138-10721160 ACCACTTGCCCAAGTTCACACGG - Intergenic
950197562 3:11019905-11019927 GTCTCTTGCCCAAGGTCACATGG + Intronic
950243233 3:11390924-11390946 GATACTTGCTCAAGGTCACATGG - Intronic
950440768 3:13008960-13008982 GTGACTTGCACAAGGCCACATGG + Intronic
950473115 3:13198688-13198710 GTGCCTTGCCCATGGTCACATGG - Intergenic
950549387 3:13656935-13656957 GGGACTTGCCCAAAGCCACATGG + Intergenic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
950567889 3:13781972-13781994 AGGACTTGCTCAAGGTCACACGG + Intergenic
950585632 3:13890410-13890432 GTCACTTGCACAAGGTCACAGGG - Intergenic
950661030 3:14467128-14467150 TCCACCTCCCCAAGGTCACAAGG - Intronic
950670219 3:14521518-14521540 GTGACTGGCCCAAGGTCATAAGG + Intronic
950716518 3:14851346-14851368 GCAACTTACCCAAGGTCATTGGG + Intronic
950839869 3:15957618-15957640 GTAGCTTTCCCAAGGTCACATGG + Intergenic
950997229 3:17515548-17515570 GTGACTTATGTAAGGTCACAGGG + Intronic
951460585 3:22947140-22947162 GTGACTTGCCCAAGGTCATCTGG - Intergenic
951993612 3:28702872-28702894 GAAACTTGCCCAAAGTCACATGG - Intergenic
952124370 3:30282156-30282178 GTAACTTTCCCGAGGTCACATGG + Intergenic
952307967 3:32162095-32162117 GTGACTTGCCCAAGGCCACAGGG - Intronic
952323757 3:32301854-32301876 GTGATTTACCCAATGTCACATGG - Intronic
952491639 3:33879640-33879662 GCAACTTGTCCAAGGCCACATGG + Intergenic
952507664 3:34022136-34022158 GCAACTTGCCCAAGGTTTCAAGG + Intergenic
952744015 3:36761364-36761386 GTGACTTGCCCCAGGTCACCAGG + Intergenic
952744339 3:36763658-36763680 GTGCCTTGCCCAGGGTCACACGG - Intergenic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
954372131 3:50174453-50174475 GTCACTCACCCAAGGTCAAAAGG - Intronic
954416340 3:50395305-50395327 GCAGCCTGCCCAAGGTCACATGG + Intronic
954423057 3:50428745-50428767 GGGACTTGCCCAAGGTCACTAGG + Intronic
954811045 3:53248220-53248242 GTGACTTGCCTAAAGTCACACGG + Intronic
954892335 3:53942532-53942554 GCAAGTTGCCCAAGGTTACAAGG + Intergenic
955150181 3:56359566-56359588 GTGACTTGCCCAAGGCCACATGG + Intronic
955155344 3:56411730-56411752 GTGACTTTTCCAAAGTCACAGGG + Intronic
955412438 3:58664640-58664662 GCAACTTGCCTAAGGTCACATGG + Intronic
955523026 3:59793470-59793492 CAGCCTTGCCCAAGGTCACATGG + Intronic
955741762 3:62098600-62098622 GTAACTTGCCCAAGGTCACATGG + Intronic
955891918 3:63659465-63659487 GAGACTTTTCTAAGGTCACATGG + Intronic
956100201 3:65760344-65760366 GAAACTTGCCCAAGGTCACACGG + Intronic
956760016 3:72433508-72433530 GTAACATACCCAAGGTCACAAGG + Intronic
956860416 3:73318092-73318114 GCGACTTCTGCAAGATCACAGGG - Intergenic
957347495 3:78981113-78981135 TCGACTTTCCCAAGCTCACATGG + Intronic
957359819 3:79140395-79140417 GTAACTTGCCCAAAGTCACAGGG - Intronic
957814239 3:85272109-85272131 GCTAATGATCCAAGGTCACAGGG + Intronic
958268072 3:91463472-91463494 CTGACTTAACCAAAGTCACATGG + Intergenic
958482955 3:94667469-94667491 GAAACTAACCCAAGGTCACATGG + Intergenic
959943090 3:112099953-112099975 GTGACTTGCTCAAGGTCACCTGG + Intronic
960085431 3:113585400-113585422 GCAACATCTCCAAGGTCACAAGG - Intronic
960165818 3:114400182-114400204 GTGACTTGGCCATGGTCACACGG - Intronic
960325556 3:116291404-116291426 GCGTCTTGCCCAAGGTTAAATGG - Intronic
960356539 3:116660584-116660606 GTAACTTACTCAAGGTCACTTGG + Intronic
960536237 3:118817416-118817438 GTGGCTTGCCCATGGTCACACGG + Intergenic
960645404 3:119875579-119875601 GTGACTTACCCAAGATTACATGG - Intronic
960915488 3:122690250-122690272 GAGACATGCCCAAGGTCACATGG + Intronic
961032759 3:123620826-123620848 GTGACTTGCCCAAGGTCAACAGG - Intronic
961071325 3:123930626-123930648 CTGACTTACCCAAGATCATATGG + Intronic
961260769 3:125599948-125599970 GTAACTTGCCTAAGGTCACAGGG - Intergenic
961379875 3:126490056-126490078 GTGACCTGCCCAAGGTCTCATGG - Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961637895 3:128344525-128344547 GTGACCTGCCCAAGGTCACAGGG + Intronic
961647956 3:128402542-128402564 GTACCTTGCCCAAGGTCACACGG - Intronic
961658783 3:128457472-128457494 GAGACGTGCTCAAGGTCACAGGG - Intergenic
961661037 3:128468908-128468930 TTGACTTCCCCAAGGACACATGG - Intergenic
961669748 3:128520338-128520360 GTGACTCACCCAAAGTCACATGG - Intergenic
961708267 3:128806755-128806777 GGGACTTAACCCAGGTCACCTGG - Intronic
963219746 3:142796152-142796174 GTAACTTGCGCAAGGTCACATGG + Intronic
963897098 3:150698654-150698676 GCAACTTGCCCAACATCACAAGG + Intronic
963972020 3:151440566-151440588 GCAACTTGCCTTAGGTCACAGGG + Intronic
964519107 3:157543907-157543929 GTGACTTGCCCAAGATCATAAGG - Intronic
964650165 3:159002745-159002767 GTGACTTGCCCAAGGTCATTGGG + Intronic
964935815 3:162085327-162085349 GTAACTTACCTAAAGTCACAAGG + Intergenic
965501774 3:169465252-169465274 GTAACTTGCCCAAGGGCACACGG - Intronic
965831458 3:172794164-172794186 TTGTCTAACCCAAGGTCACAAGG + Intronic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
966483261 3:180436311-180436333 TCACCTAACCCAAGGTCACAAGG - Intergenic
966770615 3:183500505-183500527 GTTACTTCTCCAAGGTCACATGG - Intronic
966929450 3:184666316-184666338 GTGACTTACCCAAGTTCACAAGG - Intronic
967101894 3:186222443-186222465 ATGATTTGCCCAAGGTCACATGG - Intronic
967683605 3:192394628-192394650 ATGACTTCCCCAAGGTCACCAGG + Intronic
967745694 3:193052504-193052526 GAGATTTTCCTAAGGTCACATGG - Intergenic
967827225 3:193886936-193886958 ATAATTTACCCAAGGTCACATGG - Intergenic
967828039 3:193894582-193894604 GCAATTTGCCCAAGGTCACGCGG + Intergenic
967864042 3:194175730-194175752 GAGACTCAGCCAAGGTCACAGGG + Intergenic
967954553 3:194868413-194868435 ATCACTTACCCAAGGTCACACGG - Intergenic
967970332 3:194994629-194994651 GTGACTTGCTCAAAGTCACACGG - Intergenic
967976830 3:195040224-195040246 GTGACTTGCCCAAGGTCACGCGG + Intergenic
968044479 3:195616370-195616392 GAGACTTGGCCAGGGTCACAGGG + Intergenic
968045279 3:195620481-195620503 GGGACTTGCCCAAGGTCACTCGG - Intergenic
968060268 3:195722421-195722443 GAGACTTGGCCAGGGTCACAGGG + Intronic
968061134 3:195726824-195726846 GGGACTTGCCCAAGGTCACTCGG - Intronic
969053835 4:4389505-4389527 GGGACATACCCAAGGTCACTGGG + Intronic
969134314 4:5017903-5017925 GGCACTTGCCCATGGTCACACGG - Intronic
969233535 4:5849073-5849095 GTTCCTTGCCCAAGGTCACATGG + Intronic
969262430 4:6042671-6042693 GTAACTTGTCCAAGGTCACACGG + Intronic
969292800 4:6251594-6251616 GTGACTTGCCCAAGGTCACCTGG - Intergenic
969414931 4:7052009-7052031 CTTGCTTACCCAAGGTCACAAGG - Intronic
969485285 4:7468912-7468934 GTGACTTGTCCAAGGTCACACGG - Intronic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
970273318 4:14369602-14369624 GTGACTTACCCAAGGGCAGGTGG - Intergenic
970372342 4:15420677-15420699 GCAATTTGCCCAAGGTCACATGG + Intronic
970559025 4:17264837-17264859 GTGACATATCCAAGGTCACAGGG + Intergenic
970620386 4:17811342-17811364 GGGACTTACCCGAGGTCGCCTGG + Intronic
970828588 4:20307818-20307840 GTAACTTGCCCAAGCTCACATGG + Intronic
970905029 4:21205726-21205748 GCAACTTGCCTGAGGTCACACGG + Intronic
970913992 4:21311047-21311069 GCAATTTGCCCAAAGTCACAAGG - Intronic
971066469 4:23038498-23038520 GTGACTTGCCCAAGGTGACATGG + Intergenic
971361683 4:25943875-25943897 GGGACTTACCCAAGATCCCATGG - Intergenic
971953424 4:33383619-33383641 GCCACTTATGCAAGGTGACAAGG + Intergenic
972234714 4:37117847-37117869 GCAACTTGCTCAAGGTCACATGG - Intergenic
972354618 4:38268818-38268840 GTGACTTATCCAAGGTCATTTGG + Intergenic
972425624 4:38929900-38929922 GTGACTTATTCAAGGTTACAAGG - Intronic
972640087 4:40917345-40917367 GTGACTTGCCCAAGGTCTCCCGG + Intronic
973185440 4:47322557-47322579 ATGACTTACCCAGAGTCACAGGG + Intronic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
974353555 4:60782501-60782523 GTGACTTTCCCAAGGTCACATGG - Intergenic
975101804 4:70522150-70522172 GTAACTTGCCCAAGGTGACATGG - Intronic
975493758 4:75015739-75015761 GTGCCTCACCCAAGATCACATGG + Intronic
975566912 4:75766781-75766803 GCTACTTGCCCAAAGTAACATGG + Intronic
975676890 4:76836262-76836284 ATTACTTACCCAATGTCACATGG + Intergenic
976001980 4:80385589-80385611 GTGACTTGCCCGAGGTCACAAGG + Intronic
976221141 4:82757668-82757690 GTGATTTGACCAAGGTCACATGG - Intronic
976644983 4:87377970-87377992 GTTTCATACCCAAGGTCACATGG + Intronic
976657550 4:87505107-87505129 GTGACTTTCCCAAGGTCTCCTGG - Intronic
976987144 4:91315828-91315850 ATAACTTGCCCAAGGTCACATGG - Intronic
977491590 4:97720193-97720215 GAGAATTAATCAAGGTCACATGG - Intronic
977640013 4:99346893-99346915 AGGACTTGCACAAGGTCACAGGG - Intronic
978459464 4:108935039-108935061 GTGACTTGCCCAAGGTCAGACGG + Intronic
978486037 4:109254363-109254385 ATCACTTACCCCAGGTCACAAGG + Intronic
978656272 4:111069174-111069196 GTAACTTGTCCAAGGTCACATGG - Intergenic
978884928 4:113757545-113757567 GAAACTTGCCCAAAGTCACAAGG + Intronic
979163838 4:117499564-117499586 GCAACATACACAAGTTCACATGG - Intergenic
979324156 4:119360035-119360057 GCAACTTAGGCAAGGTCACATGG - Intergenic
979458963 4:120958518-120958540 GTAACTTACGCAAGGTAACATGG - Intergenic
979459691 4:120967875-120967897 GTGACTTGACCAAGGTCACATGG + Intergenic
981013964 4:139954126-139954148 GCAACTTATCCAAGGTGGCAGGG - Intronic
981347398 4:143692247-143692269 GTCACTTACTCAAGGTCACACGG + Intronic
981820111 4:148877141-148877163 TTGCCTAACCCAAGGTCACAAGG + Intergenic
982821949 4:159952356-159952378 GCCACTTGCCGAAGGTCCCATGG + Intergenic
983241993 4:165244736-165244758 GCAACTTAGGCAAGGTCACATGG - Intronic
983514020 4:168638252-168638274 GCATCTTGCCCAAGATCACATGG + Intronic
984868541 4:184306858-184306880 ATAATTTACCCAAGGTCACATGG - Intergenic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
984990865 4:185379737-185379759 GTAACTTGCCCAAGGCCACAGGG + Intronic
985572652 5:657933-657955 GTGACTTCCCCTAAGTCACAGGG + Intronic
985717545 5:1471135-1471157 GTGACTTCCCAAAGTTCACAAGG + Intronic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
988797010 5:34660551-34660573 GTGAGTAATCCAAGGTCACACGG - Intronic
988992670 5:36686827-36686849 GGGACTTGCTCAAGGCCACATGG - Exonic
989187960 5:38643079-38643101 GCTACTTGCCCAAGGACCCAGGG - Intergenic
989532136 5:42520336-42520358 GGGATTTACACAAGATCACAAGG - Intronic
990481344 5:56214318-56214340 ATGACTCACCTAAGGTCACATGG - Intronic
990692904 5:58383693-58383715 GTGACTTGCCTAAGTTCACATGG + Intergenic
992117608 5:73555920-73555942 GTGTCTTGCCCAGGGTCACATGG - Intronic
992663251 5:78982579-78982601 GAAACTTGCCCAAGGTTACAGGG - Intronic
992853406 5:80834937-80834959 GCCACTTCCTCAAGGTGACAGGG - Intronic
992923445 5:81553100-81553122 GTGACTCACCCAAGGCCTCATGG - Intronic
993109224 5:83634997-83635019 ATGACTTGCCCAAGCTCACATGG - Intergenic
993570950 5:89538312-89538334 GCAACTTGACCAAGATCACAAGG + Intergenic
994068462 5:95570489-95570511 GTAACTTGCCCAAGGTTACAAGG - Intronic
995226443 5:109706503-109706525 GTTACTTCCCCAAGATCACATGG + Intronic
996133931 5:119815816-119815838 GTGATTTTCACAAGGTCACATGG + Intergenic
996763085 5:127005469-127005491 GGGACTTACCCAGGATCACGTGG - Intronic
996786155 5:127238578-127238600 GTAACTTGCCCAAAGTCACACGG + Intergenic
996979644 5:129475155-129475177 GTGTCTAACCCAAAGTCACAAGG + Intronic
997414119 5:133711980-133712002 ATAACTGACCCAAGGTCACACGG + Intergenic
997512907 5:134465638-134465660 GTGACTTGCACAAGGTCACACGG - Intergenic
997607194 5:135183599-135183621 GCAACTTACCCCAGATCACACGG - Intronic
997650277 5:135512258-135512280 GTGGCTCACCCAAGGTCACAAGG - Intergenic
997815121 5:137009769-137009791 TAGACCTGCCCAAGGTCACAGGG - Intronic
998094216 5:139388246-139388268 GCCCCTGGCCCAAGGTCACAAGG + Intronic
998135467 5:139671928-139671950 GCCACCTGCCTAAGGTCACAAGG - Intronic
998151493 5:139759961-139759983 AGGCCTTGCCCAAGGTCACATGG + Intergenic
998369158 5:141650189-141650211 GTAACTTGTCCAAGGTCACATGG + Intronic
998393759 5:141805017-141805039 GAGCTTTGCCCAAGGTCACAGGG - Intergenic
998526292 5:142846259-142846281 GAGACCTTTCCAAGGTCACATGG + Intronic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
998850045 5:146343511-146343533 ATGACTTGTCCAAGGTCACACGG - Intergenic
998861621 5:146449455-146449477 GTGACTTACACAAGGTCACTGGG + Intronic
999096788 5:148986148-148986170 GTAACATACCCAAGTTCACACGG - Intronic
999201988 5:149823180-149823202 GCTACTCATCCAAGGACACATGG - Intronic
999255887 5:150209898-150209920 GGGACTTGCCCCAGGTCGCATGG + Exonic
999379297 5:151109101-151109123 GTGACTTGCCTGAGGTCACATGG + Intronic
999437239 5:151572401-151572423 GAGACTTGCCCAAAGTCACAGGG + Intergenic
999515144 5:152294492-152294514 GGGACTCACCCAGGGTCACATGG + Intergenic
999543172 5:152597048-152597070 CTGACTTACCCAAGGTCCCATGG + Intergenic
999643559 5:153696149-153696171 GTAACTTTCCCAAGGCCACAGGG - Intronic
999652413 5:153780348-153780370 GCTACTTTCTCAAGATCACATGG - Intronic
999681817 5:154067772-154067794 GGGGCTTGTCCAAGGTCACATGG - Intronic
999699866 5:154218410-154218432 GCGACTGGTACAAGGTCACAGGG - Intronic
999729438 5:154465334-154465356 GTGGCTTGCCCAAGGTCACCAGG + Intergenic
1000119171 5:158180162-158180184 GCAACTTGCCCAAGGCCACACGG - Intergenic
1000247809 5:159463441-159463463 GTGACTTGCACAAGGTCATATGG + Intergenic
1000274779 5:159724433-159724455 GCGACTTACCTAAGGTCACATGG + Intergenic
1000302215 5:159966429-159966451 GAAACTGGCCCAAGGTCACATGG + Intronic
1000339796 5:160268341-160268363 GTGACTTACCCCAGACCACATGG - Intronic
1000899643 5:166897013-166897035 GTGACCCGCCCAAGGTCACAAGG + Intergenic
1001041605 5:168339542-168339564 GTAACTCACCCAAGGTGACAGGG - Intronic
1001119593 5:168968844-168968866 GTAACTTACTCAAGGTCACACGG - Intronic
1001157582 5:169286591-169286613 ATGACTTGTCCAAGGTCACATGG + Intronic
1001323002 5:170698276-170698298 GTGACTTACCCAAGGCCACCAGG + Intronic
1001405769 5:171476238-171476260 CAGGCTTGCCCAAGGTCACATGG + Intergenic
1001542628 5:172550240-172550262 GTGACTGGTCCAAGGTCACATGG + Intergenic
1001692465 5:173643295-173643317 TCAACTTGCCCAGGGTCACAAGG + Intergenic
1001837892 5:174847420-174847442 GGCACTTACTCAAGGTCACGGGG + Intergenic
1001936415 5:175708961-175708983 GAGACGTGCCCAAGGTCATACGG - Intergenic
1002135249 5:177103770-177103792 GTGACTGGCCCAGGGTCACAGGG + Intergenic
1002181756 5:177434340-177434362 GCTCCTGGCCCAAGGTCACACGG - Intronic
1002248189 5:177903567-177903589 GAGACTTGTTCAAGGTCACACGG + Intergenic
1002329086 5:178429212-178429234 GGGACTCATCCAAGGTCACAGGG + Intronic
1002372495 5:178766643-178766665 GGAGCTTGCCCAAGGTCACATGG - Intergenic
1002839080 6:890350-890372 GGAACTGACCCAGGGTCACATGG - Intergenic
1003050708 6:2778532-2778554 GTGGCTTACCCAGGGTCTCATGG + Intronic
1004146349 6:13070493-13070515 GTAACTTGCCCAGGGTCACAGGG + Intronic
1004199912 6:13538537-13538559 GTGACTTGCCCAAGGTCATATGG - Intergenic
1004596082 6:17101245-17101267 GTGACTTTCCCAAGGTCAACGGG - Intergenic
1005308398 6:24535323-24535345 GCCACATTCCCAAGGTCCCAAGG + Intronic
1005498436 6:26409436-26409458 GCTGCTCACCCCAGGTCACAGGG - Intronic
1005899311 6:30204197-30204219 GCAACTTGCCCAAGAGCACATGG + Intronic
1006376161 6:33672771-33672793 GGTGCTTTCCCAAGGTCACAGGG + Intronic
1006431775 6:34001735-34001757 GTGACTTGCTCAAGGTCTCATGG + Intergenic
1006710168 6:36061754-36061776 GTGACTTGTCCAAGGTCATATGG - Intronic
1006738173 6:36289900-36289922 GTGATTTACCCAAAGTCACATGG - Intronic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1006928849 6:37675241-37675263 ACAACTTTCCCAAGGTCACTTGG - Intronic
1007072591 6:39048383-39048405 GGGACTTGTCCAAGGTCACACGG - Intergenic
1007243843 6:40445804-40445826 GCAACTTGCCCAAGACCACAGGG - Intronic
1007498450 6:42278020-42278042 ATGACTTGCCCAGGGTCACATGG - Intronic
1007758749 6:44119068-44119090 ATAACTTGCCCAAGGTCACATGG + Intronic
1007990509 6:46250594-46250616 AGGACTTACCCATGGGCACATGG + Intronic
1008003091 6:46381296-46381318 GTGACTTGCCCAAGGTTGCATGG - Intronic
1008088513 6:47269088-47269110 GTGACTTGCCCAAAGTCACATGG - Intronic
1008210190 6:48712684-48712706 GTGACTTGCCCAAAGTCACAAGG + Intergenic
1008506362 6:52234678-52234700 GCGACTTGCTCAAGGTCACTTGG - Intergenic
1008895531 6:56549925-56549947 GTGACTTGTCCAAGGTCACACGG - Intronic
1008987131 6:57558092-57558114 CTGACTTAACCAAAGTCACATGG - Intronic
1009175089 6:60450660-60450682 CTGACTTAACCAAAGTCACATGG - Intergenic
1009551528 6:65100670-65100692 ATGACTTGCCCAAGGTCATATGG + Intronic
1010050245 6:71495671-71495693 GGAACTTACCCAAGGTCATCTGG + Intergenic
1010057194 6:71580187-71580209 GTAACTTGCCCAAGGTCACACGG + Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1011701609 6:89960308-89960330 GGGATTTACCCAAAGTCACAGGG + Intronic
1012265483 6:97136980-97137002 GTGACTTTCTCAGGGTCACACGG - Intronic
1012423822 6:99093217-99093239 GTGACTTTCCCTAAGTCACATGG + Intergenic
1013310378 6:108888385-108888407 AAAACTTACCCGAGGTCACACGG + Intronic
1013591126 6:111620365-111620387 GCAACTTACCCAAGGCCACAAGG + Intergenic
1013652360 6:112208506-112208528 GCAAATTGCCCGAGGTCACACGG + Intronic
1014153321 6:118084096-118084118 GTGACTTGCCCAGGGTCACATGG + Intronic
1014588797 6:123235341-123235363 GTCAGTTTCCCAAGGTCACAGGG - Intronic
1014829808 6:126089510-126089532 GAAACTTACCCCGGGTCACATGG + Intergenic
1015022236 6:128490627-128490649 GCGACTGCCCCAAGGTCACATGG - Intronic
1015272680 6:131353509-131353531 GTGACTTGCCCAAAGCCACATGG - Intergenic
1016276281 6:142356735-142356757 GTGACTACCTCAAGGTCACATGG + Intronic
1016277271 6:142369461-142369483 GTAACATACCCAGGGTCACATGG + Intronic
1016616185 6:146051141-146051163 GTGACTCACCTAAAGTCACACGG - Intronic
1017223538 6:151993780-151993802 GTGTCTTGCCCAAGGCCACACGG + Intronic
1017780401 6:157711205-157711227 GTGACTTACCCAAGGTCACGTGG - Intronic
1017804460 6:157931775-157931797 CTGACTTGCCCAAGGTCACATGG - Intronic
1018002619 6:159593102-159593124 GAGACTTGCCCAAGGACACATGG - Intergenic
1018364471 6:163103873-163103895 ATGACTTGCCCAAGGTCACAGGG + Intronic
1018623524 6:165754693-165754715 GTGACTTTCCCAAATTCACACGG - Intronic
1019320958 7:415080-415102 GCGGCTCACCCTGGGTCACACGG + Intergenic
1020035866 7:4962797-4962819 GGGACCTTCCCAAGGTCACAGGG + Intergenic
1020841087 7:13218834-13218856 GTGACTTACTCAAGGTTACAAGG + Intergenic
1021137502 7:16983540-16983562 GAAAATTACCCAAAGTCACAGGG - Intergenic
1021157392 7:17227899-17227921 GTAACTTGCCCAATGTCACATGG + Intergenic
1021475097 7:21051651-21051673 GTGACCCACCCAAGGTCACGTGG - Intergenic
1021640104 7:22728233-22728255 GGAATTTACCCAAGATCACAAGG - Intronic
1022171454 7:27836028-27836050 GTGACTTGGCCAAGATCACATGG + Intronic
1022327045 7:29341901-29341923 GTCACTTTCCCAAGGCCACATGG - Intronic
1022355215 7:29608463-29608485 GTCAGTTACCCAAGGCCACAAGG + Intergenic
1022734043 7:33059676-33059698 GTAATTTGCCCAAGGTCACATGG + Intronic
1023132506 7:37016812-37016834 GTGACTTCTCCAAGGTCACATGG + Intronic
1024370839 7:48582150-48582172 GCCACTTGCCCATGTTCACATGG + Intronic
1024803980 7:53114550-53114572 TGAACTTACCCAAGGTCAGATGG + Intergenic
1025254651 7:57375602-57375624 ATGACTTTTCCAAGGTCACAAGG + Intergenic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1026403318 7:70038718-70038740 GCCACTTTCCCAAACTCACATGG - Intronic
1027217830 7:76195486-76195508 GAGACTTTCCCAAGTCCACATGG + Intergenic
1027435163 7:78156637-78156659 GTAACTTCCTCAAGGTCACATGG + Intronic
1027593539 7:80143630-80143652 GTAACTTGCCCAAGGTCTCATGG - Intronic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1028133329 7:87202608-87202630 CTGACTTGCCAAAGGTCACACGG + Intronic
1028234607 7:88345838-88345860 GCATCTTGCCCAAGGACACACGG - Intergenic
1028655289 7:93198388-93198410 GAGTCTTGCCCAAGGTCACTTGG + Intronic
1028834976 7:95365011-95365033 ATGACTTTCCCAAGGTCACTCGG + Intronic
1029118497 7:98251041-98251063 GCAACTTACACAGGGTCACTGGG + Intronic
1029141921 7:98417449-98417471 GTGACTTACTCCAAGTCACAGGG - Intergenic
1029587671 7:101485814-101485836 GGGACAATCCCAAGGTCACATGG - Intronic
1030138396 7:106281489-106281511 ATAACATACCCAAGGTCACAGGG + Intronic
1031927654 7:127653085-127653107 GTGACTTGCTTAAGGTCACATGG + Intronic
1031958820 7:127970337-127970359 ATGACTTACACAAGGTCACATGG - Intronic
1032251736 7:130263320-130263342 GCGACTTACACAAAGCCCCAGGG - Intergenic
1032668124 7:134057882-134057904 GGTATTTGCCCAAGGTCACATGG + Intronic
1032684318 7:134216061-134216083 GTAACTTGCCCAAGGTCACATGG - Intronic
1033438268 7:141353935-141353957 GAGACTTTCTCAAGGTCAAATGG - Intronic
1033806334 7:144958565-144958587 GAGACTTGCTCAAGGTCAGATGG - Intergenic
1034210773 7:149360110-149360132 GAGCCTTACCAAAGCTCACATGG - Intergenic
1034550887 7:151819960-151819982 GTGACGTGCCCAAGGTCACATGG + Intronic
1034563495 7:151896163-151896185 GTGACTCATTCAAGGTCACAGGG + Intergenic
1035042822 7:155942931-155942953 GCAACTTTTCCAAGGCCACACGG + Intergenic
1035274451 7:157739152-157739174 GGGACTCACCCAAGGTCACACGG + Intronic
1035304100 7:157919011-157919033 GCAACTTACCTAAAGTCACAGGG + Intronic
1035520241 8:270493-270515 GGGACTTACCCAGACTCACAGGG + Intergenic
1035687487 8:1536221-1536243 GTGACTTTCCCAAGTTCAGATGG - Intronic
1035696943 8:1605171-1605193 GTGACTTACCCAGGTTCATACGG + Intronic
1036492918 8:9244415-9244437 GTGATTTGCCCAAGATCACACGG - Intergenic
1037438281 8:18887983-18888005 GTGACTTGTCCAAGATCACACGG + Intronic
1037611487 8:20480013-20480035 CCAACTTGTCCAAGGTCACACGG - Intergenic
1037758848 8:21728718-21728740 GGGACTTGCCCAAGGTCACATGG - Intronic
1038830284 8:31050025-31050047 GTGACTTGTCCAGGGTCACATGG + Intronic
1039417300 8:37406821-37406843 GTGATTTTCCCAAGGTCACATGG + Intergenic
1039822142 8:41143855-41143877 TCAACATACCCAAGGTCACCTGG - Intergenic
1040745592 8:50637495-50637517 ATGGCTTACCCAAGGTCATAAGG + Intronic
1041283268 8:56233131-56233153 GTGACTTGCTCAAGTTCACATGG + Intergenic
1041485161 8:58368463-58368485 GTGACTTTCTTAAGGTCACACGG - Intergenic
1042060677 8:64813821-64813843 GCGAGTAAACCCAGGTCACATGG - Intergenic
1042846435 8:73173728-73173750 GTTACTTGCCCAAAGTCACAGGG - Intergenic
1042970587 8:74404532-74404554 GTCACTCACCTAAGGTCACATGG + Intronic
1043130813 8:76458780-76458802 ATGACTTGCCCTAGGTCACACGG - Intergenic
1043619595 8:82173057-82173079 TAAACTTACCCAAGGTCACTAGG - Intergenic
1043912393 8:85878016-85878038 GAAACTTAACCAAGGTCACCAGG - Intergenic
1044241258 8:89891511-89891533 GTAACTTAACCAAGATCACATGG + Intergenic
1044759710 8:95505316-95505338 GCAACTTGGCCAAGGTCACATGG + Intergenic
1044808424 8:96032503-96032525 GTGACAAGCCCAAGGTCACATGG + Intergenic
1045009505 8:97945356-97945378 ACGATTTACCCAAGCTCACATGG + Intronic
1045333953 8:101181569-101181591 GTGACTTTTCCAAGGTCACTTGG + Intronic
1045664732 8:104471954-104471976 GTGATTTGCCCAAGATCACATGG + Intergenic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1045766476 8:105677361-105677383 GTAAATTGCCCAAGGTCACAAGG + Intronic
1046530899 8:115443614-115443636 TCAACCTGCCCAAGGTCACATGG - Intronic
1046540585 8:115576533-115576555 GTGACTCACCCAGGGTCACACGG + Intronic
1047051805 8:121121013-121121035 GCAACTCACCCAAAGTCACAGGG - Intergenic
1047199521 8:122753487-122753509 GTAACTTACCCAATGTCACACGG + Intergenic
1047301890 8:123620589-123620611 GCAATTTACCCAGGGACACATGG - Intergenic
1047325144 8:123828810-123828832 GCACTTTGCCCAAGGTCACATGG - Intergenic
1047494448 8:125399554-125399576 GGGACCTGCCCAGGGTCACACGG - Intergenic
1047631363 8:126712188-126712210 AAGACTTTCCCAAGTTCACATGG + Intergenic
1047776101 8:128071902-128071924 GTGACTTTCCTAAGGCCACATGG - Intergenic
1047904968 8:129463152-129463174 GTAACTTGCCCAAAGTCACAGGG + Intergenic
1047976382 8:130134578-130134600 GTGACTTACACAAGGTCACACGG + Intronic
1048009049 8:130442299-130442321 CTGACTTGCCCAAGATCACATGG - Intronic
1048174612 8:132140562-132140584 GTGACTTCTCCAAGGTCACCAGG - Intronic
1048334075 8:133490235-133490257 GTGGCTTACTCCAGGTCACATGG + Intronic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1048422442 8:134290821-134290843 GCGTTTTATCCAAGGTCACATGG - Intergenic
1048458418 8:134599491-134599513 GTGACTTGCCCAAGGCCACAGGG + Intronic
1048543058 8:135360605-135360627 GTTACTTGCCCAAGGTCACACGG - Intergenic
1048871334 8:138801900-138801922 GAAACCTGCCCAAGGTCACACGG + Intronic
1049034908 8:140067658-140067680 GTGACTTGATCAAGGTCACAGGG + Intronic
1049190941 8:141287032-141287054 GCGACTTCCTCAAGGTCACACGG - Intronic
1049195620 8:141314127-141314149 GGGTCATACCCCAGGTCACATGG + Intergenic
1049239594 8:141530470-141530492 GTGACTTGCCCAGGGTCCCACGG + Intergenic
1049376865 8:142293524-142293546 GAGACCTGCCCAGGGTCACATGG + Intronic
1050277475 9:4014818-4014840 ATGGCTTACCCAATGTCACAGGG + Intronic
1050302293 9:4271901-4271923 GTAACTTAGCCACGGTCACATGG - Intronic
1051341918 9:16120004-16120026 AAGACTTCCCCGAGGTCACAGGG + Intergenic
1051680409 9:19601769-19601791 GTAACTTGCCCAAGGTCTCATGG - Intronic
1051689313 9:19692937-19692959 GTGACTTGCCTAAGGTCAAATGG - Intronic
1051854881 9:21552667-21552689 GCAACTCACCCAAAGCCACATGG + Intergenic
1052338383 9:27341772-27341794 GTGACTTGCCCAAGGTTACATGG + Intronic
1052691162 9:31818515-31818537 GCAACTTGCCAAAGGTCACATGG - Intergenic
1052960419 9:34291390-34291412 GGGACTTGCCTAAGGTCATATGG - Intronic
1053050370 9:34956979-34957001 ACAACTCGCCCAAGGTCACATGG - Intergenic
1053236226 9:36456936-36456958 GTGACTCATCCAAGGTCACTGGG + Intronic
1053293083 9:36894926-36894948 GTCACCTGCCCAAGGTCACACGG - Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1053620294 9:39808236-39808258 GTATCTTAACCAAGGTCACACGG + Intergenic
1053626404 9:39875698-39875720 GTATCTTAACCAAGGTCACACGG - Intergenic
1053878467 9:42567534-42567556 GTATCTTAACCAAGGTCACACGG + Intergenic
1053894197 9:42726843-42726865 GTATCTTAACCAAGGTCACACGG - Intergenic
1054217484 9:62375003-62375025 GTATCTTAACCAAGGTCACACGG + Intergenic
1054233225 9:62534161-62534183 GTATCTTAACCAAGGTCACACGG - Intergenic
1054263861 9:62899207-62899229 GTATCTTAACCAAGGTCACACGG - Intergenic
1054924478 9:70575739-70575761 GTAACTTGCCCAAGGTCGCAGGG + Intronic
1054970753 9:71083360-71083382 GCAACTTGCCCAAGGTTACAAGG + Intronic
1055058052 9:72041566-72041588 GGTCCTTGCCCAAGGTCACATGG + Intergenic
1055602239 9:77931736-77931758 GTAATTTACCCAAGGCCACAGGG - Intronic
1055657378 9:78464866-78464888 GTGACTTGACCAAGGTCACAGGG + Intergenic
1056068948 9:82965930-82965952 GTTATTTACTCAAGGTCACATGG - Intergenic
1056070535 9:82982213-82982235 GTGACATGTCCAAGGTCACAAGG + Exonic
1056125424 9:83532196-83532218 GTGACTTCCCCAAAGTCACCTGG + Intronic
1056438826 9:86599551-86599573 GTAACTTACCCAGGGTCACATGG + Intergenic
1057186542 9:93060280-93060302 GCGACTCACCCCAGGTCACAGGG - Intronic
1057228695 9:93305883-93305905 CAGACTTCCCCAAGGTCACTCGG - Intronic
1057293949 9:93824669-93824691 GTGACTTGCCCTGGGTCACAGGG - Intergenic
1057342010 9:94211360-94211382 GTTACTTGCCCAAGGCCACATGG + Intergenic
1057690994 9:97285397-97285419 TTGTCTAACCCAAGGTCACAGGG + Intergenic
1057746686 9:97758092-97758114 GTGACTTCTCCAACGTCACACGG + Intergenic
1057802600 9:98199259-98199281 GGGACATGTCCAAGGTCACATGG + Exonic
1058038688 9:100281234-100281256 GTGACTTACCCAAGGCTGCATGG - Intronic
1058054411 9:100435188-100435210 TTGACTTGCCCAAAGTCACACGG + Intronic
1058419276 9:104819215-104819237 GTGACTTTCCCAATGTCTCAGGG + Intronic
1058431101 9:104920136-104920158 ATGACTTGTCCAAGGTCACATGG + Intronic
1058533880 9:105934435-105934457 GTGACTTGCTCAAGGTCATATGG + Intergenic
1058872294 9:109213036-109213058 ATGACTTTCTCAAGGTCACACGG - Intronic
1058897272 9:109411283-109411305 GTAACTTGCCCAGGGTCACATGG + Intronic
1059303914 9:113339303-113339325 GTGACTTGCTGAAGGTCACAGGG + Intronic
1059332822 9:113546903-113546925 GCAATTTGCTCAAGGTCACACGG - Intronic
1059362396 9:113755088-113755110 GTAAATTGCCCAAGGTCACATGG + Intergenic
1059368549 9:113806531-113806553 GTAATTTGCCCAAGGTCACAGGG + Intergenic
1059372578 9:113854672-113854694 AGGACTTACTCAAGGTCATATGG - Intergenic
1059428761 9:114237466-114237488 GTGACTTGCCCAGGGTCCCATGG + Intronic
1059459210 9:114419186-114419208 GCAACTTGCCCAAGGTTGCATGG - Intronic
1059544144 9:115159442-115159464 GCAACTTACACAAGTTCACATGG - Intronic
1059614157 9:115930792-115930814 GGGACTTGCTCTAGGTCACAGGG - Intergenic
1059659389 9:116386547-116386569 GGGACTTGCCCAAGTTCACTTGG + Intronic
1059776759 9:117483913-117483935 GTGACTTCTCCAAAGTCACATGG + Intergenic
1059781244 9:117530357-117530379 GTGACTTGCCCAAGGGCACACGG + Intergenic
1059911134 9:119045538-119045560 GTGACTTTCCCAAAGTCACACGG + Intergenic
1060017689 9:120100902-120100924 GTACCTTTCCCAAGGTCACATGG - Intergenic
1060025424 9:120166668-120166690 GTGACTTGGCCAAGGTCACAGGG - Intergenic
1060152322 9:121296606-121296628 GTGACTTGCCCAAGGTCACCAGG + Intronic
1060199745 9:121645522-121645544 GCGACTCACCCAAGGTCACATGG - Intronic
1060401020 9:123349715-123349737 GTGACTCACCCAAGGTCGCATGG - Intergenic
1060451773 9:123749472-123749494 GTGACTTGCCCAAGATCTCAAGG - Intronic
1060815928 9:126635144-126635166 GCCACTTACCCAGGGCCACACGG + Intronic
1060903484 9:127282507-127282529 GTGATTTTCCCAAGGTCACATGG + Intronic
1060979567 9:127784823-127784845 GTCATTTGCCCAAGGTCACACGG - Intergenic
1061006293 9:127930161-127930183 GTGACTTACCTAAGGTCACAAGG - Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061234849 9:129336440-129336462 GGGACTAACCCAAGATCACTGGG - Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061289978 9:129645180-129645202 CTGACTTACCCAAGGGCGCATGG + Intergenic
1061498594 9:130989839-130989861 GGGACTTACCGAGGGTCCCAGGG - Intergenic
1061513148 9:131072908-131072930 GAGTCATACCCAAGGTCACCAGG - Intronic
1061563520 9:131422006-131422028 GTAACGCACCCAAGGTCACAAGG - Intronic
1061663284 9:132145162-132145184 ATGACTCACCCAAGGTCACATGG + Intergenic
1061710949 9:132487245-132487267 GGGACTTACCCAAGGTCACACGG + Intronic
1062067739 9:134537797-134537819 GCAACCTCACCAAGGTCACACGG + Intergenic
1062121800 9:134837866-134837888 GCGACTCGCCCAAGGTCTCCAGG + Intronic
1186592942 X:10950569-10950591 GTGATTTGTCCAAGGTCACACGG - Intergenic
1186968740 X:14816864-14816886 GAAACTTGCCCAAAGTCACAGGG - Intergenic
1187104711 X:16229399-16229421 GTGACTTCCTCAAGGTCACATGG - Intergenic
1187260540 X:17681623-17681645 ACGACTTGCACAATGTCACATGG + Intronic
1187479692 X:19643898-19643920 ATGACTTGCCCAAGTTCACATGG + Intronic
1187609697 X:20928863-20928885 GTAACTTACCCAAGGTAACCTGG + Intergenic
1188028410 X:25235696-25235718 GTGACTTGCACAAGGTCACATGG - Intergenic
1188072712 X:25736770-25736792 GTGATTCACCCAAGGTCACAGGG - Intergenic
1188379405 X:29472696-29472718 GTGACTTCTCCAAGTTCACACGG - Intronic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189196426 X:39157525-39157547 ATGACTTGTCCAAGGTCACAGGG - Intergenic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1189257498 X:39651925-39651947 GGGACTTATTCAAGTTCACAAGG + Intergenic
1189367796 X:40402546-40402568 GTGACTTATCTAAGGTCACAGGG - Intergenic
1189588805 X:42489931-42489953 GAAACTTGCCCAAAGTCACACGG - Intergenic
1190116726 X:47630170-47630192 GTGACTCACCCAAGGTCACACGG - Exonic
1190261570 X:48801039-48801061 GCAACTTGCCCAAAGTCACATGG + Intergenic
1190275190 X:48894812-48894834 GCCACTAGCCCAAGGTCACATGG + Intronic
1190475726 X:50825473-50825495 GTGACTTCCCCAAGGGCAAATGG - Intergenic
1190969216 X:55332675-55332697 GTAACTTACTCAAGGTCCCATGG + Intergenic
1191678414 X:63815839-63815861 CTGACTTGCCCAAGGTCACTGGG + Intergenic
1191678468 X:63816282-63816304 CTGACTTGCCCAAGGTCACACGG - Intergenic
1191975914 X:66870729-66870751 GTGACTTGCCCAAGGTCATAAGG + Intergenic
1191979596 X:66911339-66911361 GTGACTTGCTCAAGTTCACATGG - Intergenic
1192049964 X:67715673-67715695 CTGACTTACCCAAGGTCATATGG - Intronic
1192154498 X:68733735-68733757 GAGACGTGCCCAAGGTCACTAGG + Intergenic
1192266600 X:69543064-69543086 AGAACTTGCCCAAGGTCACACGG + Intergenic
1192281150 X:69687633-69687655 TTGCCTAACCCAAGGTCACAAGG + Intronic
1192306184 X:69962297-69962319 GTGACTTCTCCAAGTTCACATGG - Intronic
1192497813 X:71627952-71627974 GTCACTTGCCCAAGGTCAAACGG + Intergenic
1192558512 X:72109345-72109367 TTGACTTGCCCAAGGTCACAGGG + Intergenic
1192709439 X:73564201-73564223 GCAACCTGACCAAGGTCACAGGG - Intronic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1194655967 X:96573777-96573799 GTGACTTTCTCAAGGCCACAAGG - Intergenic
1195085080 X:101406235-101406257 GTAATTTACCCAATGTCACAGGG + Intronic
1195460662 X:105120024-105120046 GTGACTTATCCAAGGTCACATGG + Intronic
1195702057 X:107712983-107713005 GTGACTTGCCCAAAGTCACATGG - Intergenic
1195707444 X:107748211-107748233 AAGTCTTGCCCAAGGTCACACGG - Intronic
1195862421 X:109396138-109396160 GTAACTTACCCGAGGTCACATGG + Intronic
1195981798 X:110586485-110586507 GTAACTTACTCGAGGTCACATGG - Intergenic
1196020670 X:110987532-110987554 GCAACTTACTCCAGGTCTCACGG - Intronic
1196022254 X:111002717-111002739 GACACGTGCCCAAGGTCACACGG + Intronic
1196481538 X:116156072-116156094 GTACCTTATCCAAGGTCACACGG + Intergenic
1196607513 X:117672808-117672830 ATGACTTATCCAAGGTCACATGG - Intergenic
1197006211 X:121502157-121502179 TTGCCTTACCCAAGGTCATAAGG + Intergenic
1197251365 X:124219174-124219196 GTAGGTTACCCAAGGTCACACGG + Intronic
1197266187 X:124374718-124374740 CTGACTTACCTAAGGTCACGTGG - Intronic
1197332593 X:125172367-125172389 TTGACTTGCCCAAGGTCCCACGG + Intergenic
1197656938 X:129126886-129126908 GCAATTTGACCAAGGTCACAAGG - Intergenic
1197703713 X:129618636-129618658 ATGACTTGCCCAAGGCCACATGG - Intergenic
1197714050 X:129693529-129693551 GTGACCTGCCTAAGGTCACACGG - Intergenic
1197843636 X:130777150-130777172 GGGATTTATCTAAGGTCACATGG - Intronic
1197848418 X:130830018-130830040 GCAACTTGCCTAAGGTCACATGG + Intronic
1197971721 X:132121305-132121327 TTGACTTACCCAAAGTCATATGG - Intronic
1198007256 X:132508097-132508119 GTCACTTGTCCAAGGTCACATGG + Intergenic
1198523119 X:137472783-137472805 GGGACATGCTCAAGGTCACACGG - Intergenic
1198577041 X:138021917-138021939 GTGACTTGCCCAAAGTCATATGG - Intergenic
1198653821 X:138892241-138892263 GTAACTTTCCCAAGGACACATGG - Intronic
1198732604 X:139748550-139748572 ATGACTTACCTAAGGACACAGGG - Intronic
1199088037 X:143651694-143651716 GTGATTTGCTCAAGGTCACATGG + Intergenic
1199492607 X:148417553-148417575 GTGACTGATCCAAGGTCATACGG + Intergenic
1199504239 X:148543509-148543531 GTGACTTGCCCAAGGCCACAGGG + Intronic
1199622893 X:149715025-149715047 GCTCCTTACCCGAGGACACATGG + Intronic
1199713698 X:150490967-150490989 GGGACTTTCTCAAGTTCACACGG + Intronic
1199716051 X:150508046-150508068 ATGACTTGCCCAAGGTGACACGG - Intronic
1199802966 X:151269584-151269606 GTGACTCACCCAAGGCCACAGGG - Intergenic
1199811445 X:151353774-151353796 GTAACTTACCCAAGGTCACACGG - Intergenic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic
1202369475 Y:24187244-24187266 GCCACCTACCCCAGGCCACATGG + Intergenic
1202501310 Y:25482873-25482895 GCCACCTACCCCAGGCCACATGG - Intergenic