ID: 1168814402

View in Genome Browser
Species Human (GRCh38)
Location 20:727046-727068
Sequence CTCTACCCACAGATGAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168814399_1168814402 6 Left 1168814399 20:727017-727039 CCATTCACACAAGGACTCAAGGA No data
Right 1168814402 20:727046-727068 CTCTACCCACAGATGAACTTGGG No data
1168814392_1168814402 15 Left 1168814392 20:727008-727030 CCACCCCACCCATTCACACAAGG No data
Right 1168814402 20:727046-727068 CTCTACCCACAGATGAACTTGGG No data
1168814395_1168814402 11 Left 1168814395 20:727012-727034 CCCACCCATTCACACAAGGACTC No data
Right 1168814402 20:727046-727068 CTCTACCCACAGATGAACTTGGG No data
1168814396_1168814402 10 Left 1168814396 20:727013-727035 CCACCCATTCACACAAGGACTCA No data
Right 1168814402 20:727046-727068 CTCTACCCACAGATGAACTTGGG No data
1168814390_1168814402 17 Left 1168814390 20:727006-727028 CCCCACCCCACCCATTCACACAA No data
Right 1168814402 20:727046-727068 CTCTACCCACAGATGAACTTGGG No data
1168814394_1168814402 12 Left 1168814394 20:727011-727033 CCCCACCCATTCACACAAGGACT No data
Right 1168814402 20:727046-727068 CTCTACCCACAGATGAACTTGGG No data
1168814397_1168814402 7 Left 1168814397 20:727016-727038 CCCATTCACACAAGGACTCAAGG No data
Right 1168814402 20:727046-727068 CTCTACCCACAGATGAACTTGGG No data
1168814391_1168814402 16 Left 1168814391 20:727007-727029 CCCACCCCACCCATTCACACAAG No data
Right 1168814402 20:727046-727068 CTCTACCCACAGATGAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168814402 Original CRISPR CTCTACCCACAGATGAACTT GGG Intergenic
No off target data available for this crispr