ID: 1168816715

View in Genome Browser
Species Human (GRCh38)
Location 20:742849-742871
Sequence CCTCCTCTACAGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168816715_1168816723 -7 Left 1168816715 20:742849-742871 CCTTCCTCCCTCTGTAGAGGAGG No data
Right 1168816723 20:742865-742887 GAGGAGGTATGCATTGGGGCAGG No data
1168816715_1168816729 27 Left 1168816715 20:742849-742871 CCTTCCTCCCTCTGTAGAGGAGG No data
Right 1168816729 20:742899-742921 CCCTCCTGGGGTACCCCTCCAGG No data
1168816715_1168816727 15 Left 1168816715 20:742849-742871 CCTTCCTCCCTCTGTAGAGGAGG No data
Right 1168816727 20:742887-742909 GTGTGTGTAAGGCCCTCCTGGGG No data
1168816715_1168816725 13 Left 1168816715 20:742849-742871 CCTTCCTCCCTCTGTAGAGGAGG No data
Right 1168816725 20:742885-742907 AGGTGTGTGTAAGGCCCTCCTGG No data
1168816715_1168816731 28 Left 1168816715 20:742849-742871 CCTTCCTCCCTCTGTAGAGGAGG No data
Right 1168816731 20:742900-742922 CCTCCTGGGGTACCCCTCCAGGG No data
1168816715_1168816724 4 Left 1168816715 20:742849-742871 CCTTCCTCCCTCTGTAGAGGAGG No data
Right 1168816724 20:742876-742898 CATTGGGGCAGGTGTGTGTAAGG No data
1168816715_1168816726 14 Left 1168816715 20:742849-742871 CCTTCCTCCCTCTGTAGAGGAGG No data
Right 1168816726 20:742886-742908 GGTGTGTGTAAGGCCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168816715 Original CRISPR CCTCCTCTACAGAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr