ID: 1168816723

View in Genome Browser
Species Human (GRCh38)
Location 20:742865-742887
Sequence GAGGAGGTATGCATTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168816711_1168816723 5 Left 1168816711 20:742837-742859 CCTGTTCCACCTCCTTCCTCCCT No data
Right 1168816723 20:742865-742887 GAGGAGGTATGCATTGGGGCAGG No data
1168816715_1168816723 -7 Left 1168816715 20:742849-742871 CCTTCCTCCCTCTGTAGAGGAGG No data
Right 1168816723 20:742865-742887 GAGGAGGTATGCATTGGGGCAGG No data
1168816708_1168816723 27 Left 1168816708 20:742815-742837 CCCAGTGTGAGGTAGAGGGTTCC No data
Right 1168816723 20:742865-742887 GAGGAGGTATGCATTGGGGCAGG No data
1168816712_1168816723 -1 Left 1168816712 20:742843-742865 CCACCTCCTTCCTCCCTCTGTAG No data
Right 1168816723 20:742865-742887 GAGGAGGTATGCATTGGGGCAGG No data
1168816710_1168816723 6 Left 1168816710 20:742836-742858 CCCTGTTCCACCTCCTTCCTCCC No data
Right 1168816723 20:742865-742887 GAGGAGGTATGCATTGGGGCAGG No data
1168816709_1168816723 26 Left 1168816709 20:742816-742838 CCAGTGTGAGGTAGAGGGTTCCC No data
Right 1168816723 20:742865-742887 GAGGAGGTATGCATTGGGGCAGG No data
1168816713_1168816723 -4 Left 1168816713 20:742846-742868 CCTCCTTCCTCCCTCTGTAGAGG No data
Right 1168816723 20:742865-742887 GAGGAGGTATGCATTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168816723 Original CRISPR GAGGAGGTATGCATTGGGGC AGG Intergenic
No off target data available for this crispr