ID: 1168816727

View in Genome Browser
Species Human (GRCh38)
Location 20:742887-742909
Sequence GTGTGTGTAAGGCCCTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168816719_1168816727 7 Left 1168816719 20:742857-742879 CCTCTGTAGAGGAGGTATGCATT No data
Right 1168816727 20:742887-742909 GTGTGTGTAAGGCCCTCCTGGGG No data
1168816717_1168816727 11 Left 1168816717 20:742853-742875 CCTCCCTCTGTAGAGGAGGTATG No data
Right 1168816727 20:742887-742909 GTGTGTGTAAGGCCCTCCTGGGG No data
1168816711_1168816727 27 Left 1168816711 20:742837-742859 CCTGTTCCACCTCCTTCCTCCCT No data
Right 1168816727 20:742887-742909 GTGTGTGTAAGGCCCTCCTGGGG No data
1168816712_1168816727 21 Left 1168816712 20:742843-742865 CCACCTCCTTCCTCCCTCTGTAG No data
Right 1168816727 20:742887-742909 GTGTGTGTAAGGCCCTCCTGGGG No data
1168816715_1168816727 15 Left 1168816715 20:742849-742871 CCTTCCTCCCTCTGTAGAGGAGG No data
Right 1168816727 20:742887-742909 GTGTGTGTAAGGCCCTCCTGGGG No data
1168816713_1168816727 18 Left 1168816713 20:742846-742868 CCTCCTTCCTCCCTCTGTAGAGG No data
Right 1168816727 20:742887-742909 GTGTGTGTAAGGCCCTCCTGGGG No data
1168816710_1168816727 28 Left 1168816710 20:742836-742858 CCCTGTTCCACCTCCTTCCTCCC No data
Right 1168816727 20:742887-742909 GTGTGTGTAAGGCCCTCCTGGGG No data
1168816718_1168816727 8 Left 1168816718 20:742856-742878 CCCTCTGTAGAGGAGGTATGCAT No data
Right 1168816727 20:742887-742909 GTGTGTGTAAGGCCCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168816727 Original CRISPR GTGTGTGTAAGGCCCTCCTG GGG Intergenic
No off target data available for this crispr