ID: 1168816729

View in Genome Browser
Species Human (GRCh38)
Location 20:742899-742921
Sequence CCCTCCTGGGGTACCCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168816719_1168816729 19 Left 1168816719 20:742857-742879 CCTCTGTAGAGGAGGTATGCATT No data
Right 1168816729 20:742899-742921 CCCTCCTGGGGTACCCCTCCAGG No data
1168816717_1168816729 23 Left 1168816717 20:742853-742875 CCTCCCTCTGTAGAGGAGGTATG No data
Right 1168816729 20:742899-742921 CCCTCCTGGGGTACCCCTCCAGG No data
1168816715_1168816729 27 Left 1168816715 20:742849-742871 CCTTCCTCCCTCTGTAGAGGAGG No data
Right 1168816729 20:742899-742921 CCCTCCTGGGGTACCCCTCCAGG No data
1168816713_1168816729 30 Left 1168816713 20:742846-742868 CCTCCTTCCTCCCTCTGTAGAGG No data
Right 1168816729 20:742899-742921 CCCTCCTGGGGTACCCCTCCAGG No data
1168816718_1168816729 20 Left 1168816718 20:742856-742878 CCCTCTGTAGAGGAGGTATGCAT No data
Right 1168816729 20:742899-742921 CCCTCCTGGGGTACCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168816729 Original CRISPR CCCTCCTGGGGTACCCCTCC AGG Intergenic
No off target data available for this crispr