ID: 1168820411

View in Genome Browser
Species Human (GRCh38)
Location 20:769085-769107
Sequence TCTGACATTTTGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168820401_1168820411 19 Left 1168820401 20:769043-769065 CCTTGAGACTGAAGCTTTTTGAG No data
Right 1168820411 20:769085-769107 TCTGACATTTTGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168820411 Original CRISPR TCTGACATTTTGAAGGTGGA AGG Intergenic
No off target data available for this crispr