ID: 1168822698

View in Genome Browser
Species Human (GRCh38)
Location 20:786342-786364
Sequence GGTACTCTGGGGAGCAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168822688_1168822698 13 Left 1168822688 20:786306-786328 CCTTCCCTGAGACTTCTGCTCCT No data
Right 1168822698 20:786342-786364 GGTACTCTGGGGAGCAGAGGTGG No data
1168822689_1168822698 9 Left 1168822689 20:786310-786332 CCCTGAGACTTCTGCTCCTATAC No data
Right 1168822698 20:786342-786364 GGTACTCTGGGGAGCAGAGGTGG No data
1168822687_1168822698 23 Left 1168822687 20:786296-786318 CCTCTGGGGTCCTTCCCTGAGAC No data
Right 1168822698 20:786342-786364 GGTACTCTGGGGAGCAGAGGTGG No data
1168822692_1168822698 -7 Left 1168822692 20:786326-786348 CCTATACCATAGAAACGGTACTC No data
Right 1168822698 20:786342-786364 GGTACTCTGGGGAGCAGAGGTGG No data
1168822690_1168822698 8 Left 1168822690 20:786311-786333 CCTGAGACTTCTGCTCCTATACC No data
Right 1168822698 20:786342-786364 GGTACTCTGGGGAGCAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168822698 Original CRISPR GGTACTCTGGGGAGCAGAGG TGG Intergenic
No off target data available for this crispr