ID: 1168822763

View in Genome Browser
Species Human (GRCh38)
Location 20:786830-786852
Sequence TTCAAACAGCAGAAAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168822763_1168822768 6 Left 1168822763 20:786830-786852 CCATCCTCTTTCTGCTGTTTGAA No data
Right 1168822768 20:786859-786881 TCTCGGTGGTTAGAAGCAACAGG No data
1168822763_1168822767 -8 Left 1168822763 20:786830-786852 CCATCCTCTTTCTGCTGTTTGAA No data
Right 1168822767 20:786845-786867 TGTTTGAACTGTGGTCTCGGTGG No data
1168822763_1168822769 10 Left 1168822763 20:786830-786852 CCATCCTCTTTCTGCTGTTTGAA No data
Right 1168822769 20:786863-786885 GGTGGTTAGAAGCAACAGGTAGG No data
1168822763_1168822770 11 Left 1168822763 20:786830-786852 CCATCCTCTTTCTGCTGTTTGAA No data
Right 1168822770 20:786864-786886 GTGGTTAGAAGCAACAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168822763 Original CRISPR TTCAAACAGCAGAAAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr