ID: 1168830716

View in Genome Browser
Species Human (GRCh38)
Location 20:844004-844026
Sequence TCTGGACTCCACTGGGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168830708_1168830716 5 Left 1168830708 20:843976-843998 CCAGTTCCATGCAGGAAGCTGAC 0: 1
1: 0
2: 1
3: 14
4: 174
Right 1168830716 20:844004-844026 TCTGGACTCCACTGGGGCGCGGG 0: 1
1: 0
2: 1
3: 17
4: 155
1168830705_1168830716 16 Left 1168830705 20:843965-843987 CCGTGGGCCATCCAGTTCCATGC 0: 1
1: 0
2: 2
3: 18
4: 126
Right 1168830716 20:844004-844026 TCTGGACTCCACTGGGGCGCGGG 0: 1
1: 0
2: 1
3: 17
4: 155
1168830710_1168830716 -1 Left 1168830710 20:843982-844004 CCATGCAGGAAGCTGACGGATGT 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1168830716 20:844004-844026 TCTGGACTCCACTGGGGCGCGGG 0: 1
1: 0
2: 1
3: 17
4: 155
1168830707_1168830716 9 Left 1168830707 20:843972-843994 CCATCCAGTTCCATGCAGGAAGC No data
Right 1168830716 20:844004-844026 TCTGGACTCCACTGGGGCGCGGG 0: 1
1: 0
2: 1
3: 17
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168830716 Original CRISPR TCTGGACTCCACTGGGGCGC GGG Intronic
900386702 1:2413933-2413955 TCAGAACTCCAAAGGGGCGCGGG - Intergenic
900406923 1:2496816-2496838 GCTGGACGCCGCTGTGGCGCCGG - Exonic
900720590 1:4173410-4173432 TCTCGCCTCCACTGGGGCTGAGG - Intergenic
901459700 1:9384269-9384291 TCTGGGCTCCATGGGGGAGCTGG - Intergenic
901926782 1:12571111-12571133 TCTTGGCTCCCCTGGGGCTCTGG - Intronic
902811064 1:18888320-18888342 TCTGCAGTCCACTGGGGCCCAGG - Intronic
904277139 1:29392010-29392032 TCAGGACTCCACTGGAGTGGTGG - Intergenic
906137565 1:43510230-43510252 TATGAACTGCACTGGGGCGCAGG + Intergenic
906202574 1:43969777-43969799 CCTGGCCTCCTCTCGGGCGCTGG - Intergenic
906921423 1:50068513-50068535 TATGAACTCCACAGGGGCACAGG + Intronic
907571308 1:55486565-55486587 TATGGACTCCAGTGGGGCCCAGG - Intergenic
911065740 1:93786292-93786314 TCTGCACTCCACAGGGGCCTTGG - Intronic
913708078 1:121448414-121448436 TCTGGTCTCCTCAGGGGCGGGGG - Intergenic
919057653 1:192591061-192591083 TCTGCCCTCCTCTGGGGCACTGG - Intergenic
919981699 1:202645990-202646012 TCTTCACTCCACTGAGGCACAGG + Intronic
920513778 1:206569214-206569236 TCTGTACCCCACTGGGGCTTGGG - Intronic
922983814 1:229850841-229850863 TCTGGACTCCTCTGAGGCTCTGG - Intergenic
924154670 1:241163721-241163743 TCTGAACCCCACTGGGGAGTTGG + Intronic
1064902839 10:20313272-20313294 TGTGGACTCCATTGGGGCAGAGG - Intergenic
1066192293 10:33067182-33067204 ACTGGAATCCACTGGGCCGAAGG - Intergenic
1070891550 10:79945232-79945254 TCTGGCCTCCAGTGGGGCCCCGG - Intronic
1071506412 10:86234352-86234374 TTTTGGCTCCACTGGGGAGCAGG - Intronic
1073280635 10:102351462-102351484 TTTTGACTCCACTGGGGCTTAGG + Intronic
1073292794 10:102421588-102421610 TCTGGACCCCCTTGGGCCGCCGG + Intronic
1074121513 10:110497468-110497490 TCCGGACTCCTCTGGGGCCCTGG + Intergenic
1076404005 10:130200659-130200681 GCTGGGCTCCCCAGGGGCGCTGG - Intergenic
1076774181 10:132685197-132685219 TCAGGGCTCCCCTGGGCCGCGGG + Intronic
1077201332 11:1309108-1309130 TCTGGAGACCATTGGGGAGCGGG + Intronic
1077235489 11:1480180-1480202 TCTGGGCCCCACTGGGGACCTGG + Intronic
1077385743 11:2268871-2268893 TCTCGACTGCAGTGGGGCGGGGG - Exonic
1081860693 11:46332105-46332127 TCTGGATTACAGTGGGGCCCTGG - Intergenic
1084165503 11:67373196-67373218 TCTGGCCCCGACTGGTGCGCGGG + Intronic
1084302567 11:68261138-68261160 TGTGGCCTCCTCTGGGGCCCAGG + Intergenic
1086854205 11:91846952-91846974 CCTGGACTCTTCTGGGGCCCTGG - Intergenic
1088884832 11:113998600-113998622 TCTGGTCTCAGCTGGGGCTCTGG - Intergenic
1090065173 11:123497517-123497539 TCTGGACTCATCTGGGGCCTAGG - Intergenic
1090631017 11:128647655-128647677 GCTGGCCTCCACTGAGGCTCTGG - Intergenic
1101998077 12:109539385-109539407 TCTGCACTCAGCTGGGGCTCTGG - Intergenic
1103176197 12:118865587-118865609 TCTCGTCTCCTCTGGGGCTCGGG + Intergenic
1105777986 13:23680552-23680574 TCAGGACTCCAGTGGAGCGTTGG - Intergenic
1108048034 13:46401781-46401803 TCTGTACTCCACTGGGGGTTGGG + Intronic
1112557020 13:100478323-100478345 TCTGGTGTCCACTTGGGCCCAGG - Intronic
1115851174 14:37591760-37591782 TCTGGACCACAGTGGGGCGACGG - Exonic
1119386648 14:74261504-74261526 TCTGGACTCCACTGATGGGTGGG - Exonic
1121359204 14:93240826-93240848 CTTGAACTCCACTGGGACGCTGG - Exonic
1122577004 14:102749120-102749142 TCTGAAGTCCACTGGGGCTCTGG + Intergenic
1202860597 14_GL000225v1_random:79135-79157 CATGGACTCCCCTGGGACGCGGG + Intergenic
1124497389 15:30194726-30194748 TCTTCACTCCACTGAGGCACAGG + Intergenic
1124746184 15:32343921-32343943 TCTTCACTCCACTGAGGCACAGG - Intergenic
1129743491 15:78001798-78001820 GCTGGACTCCAGGGGGGTGCTGG + Intronic
1130624391 15:85498747-85498769 TCTGGACTTCTCTAGGGCGCTGG + Intronic
1132717917 16:1301318-1301340 TCTGCACTCCACCGGGTCCCAGG + Intergenic
1133347632 16:5081135-5081157 TCTGGAGGCCACTGGGGGACGGG + Intronic
1137841887 16:51648678-51648700 TCTGGACTCCTCTGCGGGGTTGG + Intergenic
1138522295 16:57577886-57577908 CCTGGACCCCAGTGGGGCTCAGG - Intronic
1142104043 16:88292460-88292482 CCCGGACCCCACTGGGGCCCTGG - Intergenic
1142288140 16:89179769-89179791 TCTGGACTCCCCTGTGGCCTGGG - Intronic
1142295233 16:89217474-89217496 TCTGGACGCAACTGCGGAGCCGG - Intergenic
1142943358 17:3402401-3402423 TCTGGATTCCTCTGGGATGCAGG - Intergenic
1143565745 17:7719541-7719563 TCTGTACTCCACAGGGGCCTGGG - Intronic
1144152849 17:12467175-12467197 ACTGGAGTCCTCTGGGGCACTGG + Intergenic
1145989679 17:29071412-29071434 CCTGGACTCCTCTGGGGCCAAGG + Intergenic
1146650027 17:34600980-34601002 GCTGGTCTCCACTGGGGAGCAGG + Intronic
1148227756 17:45910806-45910828 TCTGGGCTGAACTGGGGAGCTGG + Intronic
1151454339 17:74217117-74217139 TCTGGTCTCCCCTGAGGGGCTGG - Intronic
1152067795 17:78121157-78121179 TCTGGACTCTGCAGGGGTGCAGG + Exonic
1152459176 17:80432373-80432395 ACAGGACTCCACAGGGGTGCTGG - Intronic
1156313929 18:35950198-35950220 TCTGGATCCCACTGGGACCCGGG + Intergenic
1157187053 18:45549553-45549575 CCTGCACTCCACTGGGGCAGAGG - Intronic
1157709772 18:49842414-49842436 TCTGGAGTCCACTGAGCTGCTGG - Intronic
1158352458 18:56576961-56576983 TCAGGACTCCAAGGGGGAGCAGG + Intergenic
1158720133 18:59917409-59917431 GCTGGACTCCTCTGCTGCGCTGG + Intergenic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1160675595 19:389677-389699 TGTGAACTCGACTGGGCCGCAGG - Intergenic
1160877149 19:1302006-1302028 TCTGGAATCTACTGGGGAGAGGG + Intergenic
1161314162 19:3610159-3610181 CCTGCACTCCCCTGGGGCACTGG - Intergenic
1162666702 19:12219802-12219824 TCTGGACTCACCTGGGGCTTAGG - Intergenic
1163233517 19:16018764-16018786 TCTGGACCCCTCTGGGTCCCAGG + Intergenic
1164558243 19:29269766-29269788 TCTGGGGTCCACTGGGACGGGGG + Intergenic
1165812518 19:38620111-38620133 TCTAAACTCCACTGGAGCCCTGG - Intronic
1166893556 19:46009107-46009129 ACAGGACTCCACTGGGGTGTAGG + Intronic
1168317581 19:55490789-55490811 TCTGGCCCCCACAGGTGCGCCGG + Exonic
926121338 2:10242739-10242761 ACTGGGCTCCACGGGGGGGCGGG + Intergenic
931714700 2:65019852-65019874 TCAGGTCTCCACTGGGCAGCCGG - Intronic
932827316 2:74953508-74953530 TCTGGGCTCCACTGAGGCAGGGG - Intergenic
935531256 2:104234862-104234884 GCTGGACTGCAGTGGGGCGATGG - Intergenic
936284823 2:111173756-111173778 ACTGGACTCCACAGGGACTCAGG + Intergenic
937583282 2:123515049-123515071 TCTGAACTCCACTGGGGCATTGG + Intergenic
937713177 2:125001611-125001633 TCTGCACTCCACTGGGGTGTTGG - Intergenic
940427359 2:153545649-153545671 TCTGGACCCCACTTGGCCACAGG + Intergenic
941916241 2:170815833-170815855 TGTGGGCTCCGCTCGGGCGCTGG + Intronic
942075415 2:172352762-172352784 TCTGGACTCCTGTGGGGCCTCGG - Intergenic
948052279 2:234987718-234987740 TCTGGACTCTACTGTGGCTGTGG - Intronic
948927228 2:241107145-241107167 TCTGGACACCACTGGGGTTCAGG - Intronic
1168830716 20:844004-844026 TCTGGACTCCACTGGGGCGCGGG + Intronic
1171149587 20:22815458-22815480 TCTGGATGCCACTGGGAGGCAGG + Intergenic
1172568179 20:35947498-35947520 GCTGGACTACACTGGGGAACTGG + Exonic
1172656479 20:36541481-36541503 TCTGGACTCCAGGCGGGGGCGGG - Exonic
1174445794 20:50590355-50590377 GCTGGACTCCACTGCGGGCCGGG - Intronic
1175788118 20:61724462-61724484 TCTGGGCTCCACGGGAGTGCAGG - Intronic
1177239952 21:18443608-18443630 TGTGGCCTCCACTGGGGCTATGG - Intronic
1180058746 21:45374167-45374189 GCTGGACTCCCCTGGGACGCAGG + Intergenic
1180094038 21:45546442-45546464 TCTGAGCCCCACTGGGGCCCCGG + Intergenic
1182679662 22:32068781-32068803 TCTGTCCTCCACTGTGGTGCAGG + Intronic
1183068380 22:35379448-35379470 TCTGTACTCCACTGGGTTACAGG + Intergenic
1185068157 22:48642242-48642264 TCTGGGGTCCCCTGGGGCTCTGG - Intronic
1185183507 22:49378247-49378269 TCTGGACTCTGCTGGGAGGCAGG + Intergenic
1185325230 22:50222223-50222245 GCTGGGCTCCAGTGGGACGCTGG + Intronic
950212973 3:11137417-11137439 CCTAGACTCCGCTGGGGCGTGGG + Intronic
951773771 3:26286109-26286131 TCTGTACTCCACTGGGGCTTAGG + Intergenic
954297712 3:49683437-49683459 TCTGGACTCCACGGATGCGTGGG + Exonic
954797772 3:53170228-53170250 TCTGGCCTCCAATGGGGTGAGGG - Intronic
954877448 3:53811430-53811452 TCTGGCCTCAGGTGGGGCGCAGG + Exonic
958786374 3:98600856-98600878 TTTGAACTCCATTGGGGAGCTGG + Intergenic
959270070 3:104195822-104195844 CCTGGACTTCACTGGGGTGGAGG + Intergenic
962843825 3:139258415-139258437 ACTGGAAGCCACTGGGGGGCAGG + Intronic
964398367 3:156272306-156272328 TCTGGACCCACCTGGGGCCCAGG - Intronic
964961122 3:162427879-162427901 TCTGGACTCACCTGGGGCCTGGG + Intergenic
965016686 3:163167626-163167648 TCTGGACCCCTCTGGGGCCTAGG - Intergenic
968124309 3:196147135-196147157 TCTGAACCCCACTGGGGCGCAGG - Intergenic
968994822 4:3938748-3938770 TCTGGAGGCCACTTGGGCACGGG + Intergenic
969725248 4:8914712-8914734 TCTGGAGCCCACTGGGGGTCCGG - Intergenic
969819140 4:9707526-9707548 TCTGGAGGCCACTTGGGCACGGG - Intergenic
969861080 4:10035689-10035711 TCTGCCCTCCAGTGGGGGGCAGG + Intronic
971834717 4:31748380-31748402 TCTTTGCTCCACTGGGGAGCAGG + Intergenic
976254122 4:83083086-83083108 TCTGGACTCACCTGGGGCCTGGG - Intergenic
985767524 5:1787690-1787712 TCTGGCCAGGACTGGGGCGCTGG + Intergenic
986061234 5:4193162-4193184 CCGGGACTCCACTGAGGCTCAGG + Intergenic
986098988 5:4587745-4587767 TATGGACATAACTGGGGCGCTGG + Intergenic
986337440 5:6766159-6766181 GATGGACTCCCCTGGGGAGCAGG - Intergenic
988681735 5:33490167-33490189 TCTGCACCCCACTGGGGAGTTGG - Intergenic
990694065 5:58395606-58395628 TCTTGACTCCACTGAGAAGCTGG - Intergenic
994428664 5:99627849-99627871 TCTGGACTCATCTGGGGCTTGGG - Intergenic
1000878789 5:166672265-166672287 TCTGGAATCCACTTGGTCACTGG + Intergenic
1005027762 6:21480063-21480085 TCTGGACTTCACTGTGAGGCTGG + Intergenic
1005570232 6:27138352-27138374 TCTGTACCCCACTGGGGGGTTGG - Intergenic
1006137018 6:31901624-31901646 TCTGGACTCCAAGGTGGCCCCGG + Intronic
1006253193 6:32807823-32807845 TCTGGCCTCTCCTGGGGCCCTGG - Intergenic
1009847285 6:69150204-69150226 TCTGGACTCAACTGGGACCTGGG - Intronic
1022355594 7:29611470-29611492 GATGGACTTCACTGGGGCTCTGG + Intergenic
1022452339 7:30526325-30526347 TCTGCATTCTACTGGGGCCCTGG - Intronic
1023664940 7:42513203-42513225 ACTGGACTTCACCGGGGAGCAGG + Intergenic
1032091676 7:128914601-128914623 CTGGGACTCCACTGGGGCCCTGG - Intergenic
1033474195 7:141674919-141674941 CCTGCGCTCCACTGGGGGGCAGG - Intronic
1034268573 7:149792619-149792641 TCTGGCTTCCACAGGGGCCCAGG - Intergenic
1035314325 7:157988760-157988782 TCTGCACCCCACTGGGGGCCAGG - Intronic
1035685886 8:1523263-1523285 TCTGGCTTCTGCTGGGGCGCAGG + Intronic
1040860029 8:51989512-51989534 TCTGAACTCCAGTGTGGCCCGGG + Intergenic
1042905012 8:73763587-73763609 TCTGGACTCCATTGAGGCTTAGG - Intronic
1043389783 8:79781313-79781335 TTTGGAATCTACTGGGGAGCTGG + Intergenic
1044068182 8:87723537-87723559 TCTGGACTCCACTCAGCCTCGGG - Intergenic
1045036699 8:98181629-98181651 GCTGGACTCCAGTGGAGTGCAGG + Intergenic
1047270419 8:123352281-123352303 TCTGGACTCAACCTGGGAGCTGG + Intronic
1048252409 8:132877598-132877620 TCTGGTCTCCACTGGGCATCTGG - Intronic
1048672819 8:136742165-136742187 TCTGGACTTCACTGAGCCACTGG + Intergenic
1050163715 9:2743375-2743397 TCTGTACCCCACTGGGGCATGGG - Intronic
1055558212 9:77497151-77497173 CCAGGACTCCACTGGAGTGCAGG + Intronic
1058736559 9:107899496-107899518 TCTGAGCTCCACTGGAGCGCAGG + Intergenic
1061001894 9:127907363-127907385 TCAGGGCTCCTCTGGGGGGCTGG - Intergenic
1061216975 9:129227280-129227302 TTTGGACTCCAGTGTGGTGCGGG + Intergenic
1061480248 9:130894381-130894403 TGTGGACACCACTGGGGCCTGGG + Intergenic
1061684611 9:132264818-132264840 TCTGGACCCCTCTGGGGCTATGG + Exonic
1062005427 9:134236399-134236421 CCTGCCCTCCACTGGGACGCTGG - Intergenic
1062250517 9:135591622-135591644 TCTGGGCAGCACTGGGGCTCAGG - Intergenic
1203785523 EBV:125443-125465 TCTGGACTCCAAGGGGGCCAGGG - Intergenic
1203441692 Un_GL000219v1:15612-15634 GCTGGACTCCGCTGGGGGCCGGG + Intergenic
1203512502 Un_KI270741v1:134521-134543 GCTGGACTCCGCTGGGGGCCGGG + Intergenic
1186795555 X:13044116-13044138 TCCCGACTCCACTGGGTCGCTGG - Intronic
1187419249 X:19121272-19121294 TCTGTACCCCATTGGGGGGCTGG + Intronic
1192380876 X:70614556-70614578 TCTGGACTCACCTGGGGCCTGGG + Intronic
1193260855 X:79404559-79404581 TCTGGACCCAACTGGGGCCTGGG + Intergenic
1196028534 X:111069792-111069814 TCTGGAGTCCACTTGGGGGAGGG - Intronic
1197987070 X:132278232-132278254 TCTGGACTCACCTGGGGCTCGGG - Intergenic
1201547277 Y:15179405-15179427 TCTGCACCTCACTGGGGAGCTGG + Intergenic