ID: 1168830891

View in Genome Browser
Species Human (GRCh38)
Location 20:844842-844864
Sequence CAGGCGGCAAGGTAGGGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 219}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168830891_1168830913 21 Left 1168830891 20:844842-844864 CCCCCGCCCTACCTTGCCGCCTG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1168830913 20:844886-844908 CTGCTACGGGGGCCGGCAGATGG 0: 1
1: 0
2: 0
3: 9
4: 93
1168830891_1168830905 7 Left 1168830891 20:844842-844864 CCCCCGCCCTACCTTGCCGCCTG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1168830905 20:844872-844894 GGGTCCCTGGCTACCTGCTACGG 0: 1
1: 0
2: 1
3: 11
4: 140
1168830891_1168830906 8 Left 1168830891 20:844842-844864 CCCCCGCCCTACCTTGCCGCCTG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1168830906 20:844873-844895 GGTCCCTGGCTACCTGCTACGGG 0: 1
1: 0
2: 1
3: 31
4: 187
1168830891_1168830902 -6 Left 1168830891 20:844842-844864 CCCCCGCCCTACCTTGCCGCCTG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1168830902 20:844859-844881 CGCCTGCGGACCAGGGTCCCTGG 0: 1
1: 0
2: 1
3: 12
4: 147
1168830891_1168830908 10 Left 1168830891 20:844842-844864 CCCCCGCCCTACCTTGCCGCCTG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1168830908 20:844875-844897 TCCCTGGCTACCTGCTACGGGGG 0: 1
1: 0
2: 0
3: 5
4: 83
1168830891_1168830914 24 Left 1168830891 20:844842-844864 CCCCCGCCCTACCTTGCCGCCTG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1168830914 20:844889-844911 CTACGGGGGCCGGCAGATGGTGG 0: 1
1: 0
2: 0
3: 6
4: 74
1168830891_1168830907 9 Left 1168830891 20:844842-844864 CCCCCGCCCTACCTTGCCGCCTG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1168830907 20:844874-844896 GTCCCTGGCTACCTGCTACGGGG 0: 1
1: 0
2: 1
3: 7
4: 106
1168830891_1168830911 14 Left 1168830891 20:844842-844864 CCCCCGCCCTACCTTGCCGCCTG 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1168830911 20:844879-844901 TGGCTACCTGCTACGGGGGCCGG 0: 1
1: 0
2: 0
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168830891 Original CRISPR CAGGCGGCAAGGTAGGGCGG GGG (reversed) Exonic
900363672 1:2301772-2301794 GAGGCAGCAAAGTCGGGCGGTGG - Intronic
900566187 1:3333155-3333177 CAGGCAGCAAGGTGGTGGGGAGG + Intronic
901428603 1:9198938-9198960 CAGGCGGGCGGGGAGGGCGGGGG + Intergenic
902802104 1:18836947-18836969 GGGGCTGCCAGGTAGGGCGGAGG + Intergenic
902920859 1:19665362-19665384 CGGGCGGCAAGATAGGGGAGGGG - Exonic
903482071 1:23660976-23660998 CAGGCAGCAAGGTGGGGGGCGGG + Intergenic
903693861 1:25193262-25193284 CTGGGGGCAAGGGAGGGAGGAGG + Intergenic
903712262 1:25334784-25334806 CAGGAGGCAAGGTAGAGCTTGGG - Intronic
903734903 1:25523874-25523896 CAGGAGGAAAGGGTGGGCGGGGG - Intergenic
904297127 1:29527167-29527189 CAGGCAGCAAGGGAGGACGAAGG + Intergenic
904442421 1:30540439-30540461 CAGGAGGCAAGCTGGGGTGGGGG + Intergenic
905779008 1:40691665-40691687 CAGGCGCCAAGGGAGGGGGAAGG + Intronic
907494730 1:54836265-54836287 CAGGCGGGCAGGTAGGCAGGCGG - Intronic
910441565 1:87258180-87258202 CAGGAGGGAAGGTTGGGTGGTGG - Intergenic
912421919 1:109548460-109548482 CTGGCGGCTGGGTTGGGCGGCGG - Intergenic
913211389 1:116585389-116585411 CAGGTGGCTGGGAAGGGCGGGGG + Intronic
914848130 1:151294006-151294028 CATGCAGCAAGGTGGGGCTGGGG - Exonic
919907152 1:202085854-202085876 CAGGCAGCAGGGTAGGGAGCAGG + Intergenic
919916972 1:202144779-202144801 CCGGCCGCGAGGGAGGGCGGCGG - Intergenic
921039602 1:211416893-211416915 GCGGCGGCAAAGTCGGGCGGCGG - Intergenic
921220663 1:212971446-212971468 CAGCCTGCCAGGTAGGGCTGTGG - Intronic
922025270 1:221743183-221743205 CAGGCGGGAAAGGGGGGCGGCGG - Intergenic
923515952 1:234698254-234698276 CAGGAGGCAAGGCAGGATGGGGG - Intergenic
923674261 1:236065830-236065852 CAGGCGGCAGAGAAGGGAGGTGG + Intergenic
923687007 1:236160478-236160500 CAGGAGGCAGGGAAGGGTGGAGG - Intronic
1062876193 10:944671-944693 CAGACACCAAGGCAGGGCGGGGG - Intergenic
1069744279 10:70705220-70705242 CAGGGGCCAAGGCAGGGCCGCGG - Intronic
1074776303 10:116770559-116770581 GAGGCAGCAAGGTGGGGTGGGGG + Intergenic
1075570544 10:123538678-123538700 CAGGCAGCAGGATGGGGCGGTGG - Intergenic
1075960246 10:126562270-126562292 CAGGGGGTAAGGGAGGGCAGGGG - Intronic
1077061578 11:620005-620027 AAGGGTGGAAGGTAGGGCGGGGG - Intronic
1077500882 11:2909346-2909368 CACGCTGCCAGGTAGGGCCGGGG + Exonic
1080386737 11:31814894-31814916 CAGGAGGCGAGGAAGGGCGAGGG - Intronic
1081534532 11:43987412-43987434 CAGGTGGGAAGGTGTGGCGGGGG + Intergenic
1083412613 11:62504763-62504785 CAGGGGGCAGGGTAGGGGGTGGG - Intronic
1084579911 11:70016736-70016758 CAGGCCCCAAAGTAGGGCTGTGG + Intergenic
1084654722 11:70508397-70508419 CAGTAGGCAAAGTAGGGCAGGGG - Intronic
1084784690 11:71435393-71435415 CAGGCGGTAAGGCACTGCGGCGG + Exonic
1084957522 11:72699195-72699217 CAAGCGCCAAGGCAGTGCGGAGG - Intronic
1085176541 11:74493267-74493289 CAGACGCCAGTGTAGGGCGGGGG + Exonic
1085260737 11:75203250-75203272 GAGGGGGCAGGGTAGGACGGTGG + Intronic
1085277543 11:75309637-75309659 CAGGAGGCTAGGTAGGTGGGAGG + Intronic
1085423238 11:76381175-76381197 AAGGCGGAAAGGAGGGGCGGGGG - Intergenic
1085511010 11:77088164-77088186 CAGGGGACAAGGTGGGGTGGGGG + Intronic
1087586819 11:100131944-100131966 CAAGGAGAAAGGTAGGGCGGGGG + Intronic
1089844180 11:121445549-121445571 GTGGCGGCAAGGTAGGGTGTGGG - Intergenic
1092937242 12:13375487-13375509 CAAGCAGGAAGGTGGGGCGGAGG - Intronic
1093435489 12:19130230-19130252 GAGGCGGCGAGGCGGGGCGGAGG + Intronic
1094107657 12:26831504-26831526 CAGCCTGAAATGTAGGGCGGGGG + Intronic
1095581618 12:43806413-43806435 CCGGCGGCCAGGAAGGGCGGCGG - Intergenic
1096234685 12:49918085-49918107 CAGTGGGCAAGGTAGGGATGTGG + Intergenic
1096781630 12:53995391-53995413 CAGTCGGGCAGGGAGGGCGGGGG + Intronic
1100444724 12:94650229-94650251 CCGGCGGCAGCGGAGGGCGGCGG + Intronic
1102027640 12:109722656-109722678 CAGGCAGCAGGGTAGGGGAGTGG - Intronic
1103614058 12:122141176-122141198 CAGGCAGCCAGGTGGGGCCGGGG + Intronic
1103649914 12:122423801-122423823 CAGGCTGCAAGGTCAGGTGGTGG + Intergenic
1103712326 12:122922005-122922027 GAGGCGGCTAGGGAGGGAGGAGG + Intronic
1103962336 12:124617029-124617051 GAGGCGGGAGGGGAGGGCGGAGG - Intergenic
1104601966 12:130160951-130160973 CAGGGGGCAAGCGAGGCCGGTGG + Intergenic
1104966992 12:132512772-132512794 CAGGCTGCCAGGGAGGGCTGAGG + Intronic
1106248505 13:27967525-27967547 GAGGTGGCAAGGAAGTGCGGTGG - Intronic
1113011415 13:105771792-105771814 CAGGAGGGAAGGGAGAGCGGGGG + Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115175811 14:30559992-30560014 GAGGCGAAAAGGCAGGGCGGTGG - Intronic
1116366952 14:44078292-44078314 CAGGGGGCAAGTTAGGGGAGAGG - Intergenic
1118269875 14:64332914-64332936 CAGGCTGGAGGGTAGGGCAGTGG + Intronic
1118855401 14:69617840-69617862 CAGCCAGCAAGGTAGGGAGGAGG + Intronic
1119742973 14:77026285-77026307 CTGGCGTCCAGGTAGGGCTGGGG + Exonic
1121465297 14:94111811-94111833 GAGGCGGCTGGGAAGGGCGGGGG + Intronic
1122286303 14:100654831-100654853 CGGGGGGCAGGGTCGGGCGGGGG - Intergenic
1122891201 14:104733084-104733106 CAGGCGCCAAGGCAGGGTGGGGG - Intronic
1123216438 14:106813146-106813168 CAGGCTGCAAGGAGGGGTGGAGG + Intergenic
1123396687 15:19944149-19944171 CGGCCGGCAAGCCAGGGCGGCGG - Intergenic
1123706817 15:22956646-22956668 CAGGTGGCCAGGAAGGGTGGGGG + Intronic
1124612026 15:31215592-31215614 CAGGGGGCAGGGCGGGGCGGCGG + Intergenic
1125816126 15:42586290-42586312 CAGCCTGCAAGGTAGGTAGGAGG + Intronic
1127627944 15:60798673-60798695 CAGGCAGCATGGTAGCGGGGAGG + Intronic
1127885425 15:63195438-63195460 CAGGCAGCAAGTCAGGGAGGAGG + Intronic
1128300850 15:66565589-66565611 CAGGAGCCAAGGTAGGGAGAAGG - Intronic
1128511004 15:68313882-68313904 CAGGCGGCAAGGTCAGGAAGGGG + Intronic
1129251303 15:74310665-74310687 CAGGTGGCAATGAAGGGAGGGGG - Intronic
1130927450 15:88396261-88396283 TAGGAGGCAAGGCAGGGAGGAGG - Intergenic
1131796972 15:96029112-96029134 GAGGAAGCAAGGTAGGGAGGAGG + Intergenic
1132908737 16:2297754-2297776 CAGGCTCCAAGGTGTGGCGGTGG - Exonic
1132920326 16:2386246-2386268 CAGGCTCCAAGGTGCGGCGGTGG + Intergenic
1133257604 16:4526899-4526921 CAGGTGGCAGGGCAGGGTGGTGG - Intronic
1133295251 16:4748800-4748822 CAGGCAGCACAGTAGGGCGCCGG + Exonic
1133671555 16:8026917-8026939 CAGGGGTCAGGGTGGGGCGGGGG - Intergenic
1135136867 16:19891453-19891475 CAGGTGGCTGGGTAGGGCAGTGG - Intergenic
1137636701 16:49993045-49993067 CAGGCCGCAGGGGAGGCCGGAGG + Intergenic
1137787429 16:51150711-51150733 CTGGCAGCAAGGCCGGGCGGCGG + Intronic
1138174968 16:54888823-54888845 CAGGCAGGAAGGTAGGACAGAGG + Intergenic
1138250518 16:55498443-55498465 CTGGAGGTAAGGGAGGGCGGTGG + Exonic
1140495193 16:75380393-75380415 CAGCCGGCAGGGTGGGGTGGGGG + Intronic
1140738752 16:77922991-77923013 CAGGCTGCAAGGTACAGTGGTGG - Intronic
1140818044 16:78638644-78638666 CAGGCTGGAGGGAAGGGCGGGGG + Intronic
1141720210 16:85751497-85751519 CAGACGGCGAGATGGGGCGGGGG - Intergenic
1143015916 17:3891096-3891118 CTGGGGGCAAGGTTGGGGGGGGG + Intronic
1144574979 17:16423680-16423702 CAAGCTGCACGGTAGGGCAGAGG - Exonic
1144788425 17:17844421-17844443 CAGGTGGCATGGTGGGGTGGTGG + Intronic
1146465235 17:33081021-33081043 GAGGCTGCAAGGTAGTGGGGAGG + Intronic
1147110359 17:38257111-38257133 CAGGCGGCGAGCGAGGGAGGGGG + Intergenic
1148211706 17:45812804-45812826 CAGGCGGAGAGGGAGGGAGGTGG - Intronic
1148419151 17:47531320-47531342 CAGGCGGCGAGCGAGGGAGGGGG - Exonic
1148985010 17:51613448-51613470 GAGGGGGCAAGGGAGGGGGGAGG - Intergenic
1149461772 17:56834495-56834517 CCGGCGGCAAGGTGAGGCGGCGG + Intronic
1149865652 17:60149795-60149817 GAGGTGGCCAGGCAGGGCGGGGG + Intergenic
1150830165 17:68512001-68512023 GAGGCGTCAAGGGAGGCCGGAGG + Intronic
1151833856 17:76570736-76570758 CAGGGGGCAAGGTTGGGTGGAGG - Intronic
1152355972 17:79807490-79807512 CAGGGGGCAGGGCAGGGCAGAGG + Intergenic
1152825612 17:82462823-82462845 CTGGTGGCAAGGCAGGGAGGAGG + Intronic
1152965734 18:112090-112112 CAGGCGGCGGGGTGGGGCGGTGG + Intergenic
1155160029 18:23188100-23188122 CAGGGAGCAGGGTAGGGTGGTGG - Intronic
1157041214 18:44041742-44041764 CAGGAGGCGAGGTTGGGCGAGGG - Intergenic
1158298876 18:56030153-56030175 CAGGCAGGAAGGTAGGGGAGAGG - Intergenic
1159152579 18:64538811-64538833 CAGGCAGCAAGGTGGGACTGGGG + Intergenic
1160838788 19:1137092-1137114 CAGGCGGCAAGGGATGGGCGAGG + Intronic
1160856320 19:1219428-1219450 CAGGGGCCAGGGTGGGGCGGGGG + Intronic
1160889061 19:1367535-1367557 CAGTCGGCCAGGGAAGGCGGTGG - Intronic
1161307993 19:3577950-3577972 CAGGCGGGAAGGTCAGGCGAGGG - Intronic
1161338268 19:3726223-3726245 CAGGAGGGAAGGGAGGGTGGAGG + Intronic
1161667850 19:5587856-5587878 CAGGTGGCAAGGTACGGGGCTGG - Exonic
1161983375 19:7641941-7641963 CAGGGGCCAGGGTAGGGCCGGGG - Intronic
1162298247 19:9828096-9828118 CAGGCGGCGAGAAGGGGCGGAGG + Intronic
1163390201 19:17026300-17026322 AAGGGGGCGAGGTGGGGCGGGGG + Intronic
1163608810 19:18290693-18290715 CAGACAGCCAGGGAGGGCGGCGG - Intergenic
1163939548 19:20479308-20479330 CAGGCCTCAAGAGAGGGCGGTGG + Intergenic
1166343273 19:42151050-42151072 CAGGGGGCCAGGTAGGGGGGAGG - Intronic
1167925867 19:52820692-52820714 CAGACAGCAAGGTAGGGAGAGGG - Intronic
1167937863 19:52922471-52922493 CAGACAGCAAGGTAGGGAGAGGG - Intergenic
1168686743 19:58353493-58353515 GAGGCCCCAAGGGAGGGCGGTGG + Exonic
926075852 2:9942178-9942200 GAGGGCGCAAGGCAGGGCGGGGG - Intergenic
926801792 2:16665787-16665809 CGGGCGGCAGAGCAGGGCGGCGG - Exonic
929777405 2:44937846-44937868 CGGGCGGCCAGGGAGGGCGCAGG - Intergenic
930637183 2:53819620-53819642 CATAAGGCAAGGTATGGCGGGGG + Intergenic
932779859 2:74553399-74553421 CAGGCCTCAAGGCTGGGCGGGGG + Intronic
934517330 2:94996911-94996933 CATGCGGCAAGGTATGGGGAAGG - Intergenic
935189432 2:100764614-100764636 CTGTCTGCAAGCTAGGGCGGAGG + Intergenic
936523249 2:113225785-113225807 CAGGCGGCAGGGGAAGGTGGAGG + Intronic
936713682 2:115161657-115161679 CAAGCGGCAAGTTAGTGCAGCGG - Exonic
937123100 2:119454233-119454255 CAGGCGGCAGAGTGGGGCTGGGG + Intronic
941818801 2:169825050-169825072 CAGGCGGCGAGGACTGGCGGTGG - Intergenic
943932045 2:193867613-193867635 CAGGAGGCAAGGTACTGCTGCGG + Intergenic
946966573 2:225042757-225042779 CAGGCTGCGGGGGAGGGCGGGGG + Intergenic
1168830891 20:844842-844864 CAGGCGGCAAGGTAGGGCGGGGG - Exonic
1170501807 20:16982419-16982441 CAGGAGGGAAGGGAGGGAGGAGG - Intergenic
1171389806 20:24794291-24794313 GAGGGGGCAGGGTAGGGGGGAGG - Intergenic
1172915140 20:38437982-38438004 CAGGCTCATAGGTAGGGCGGCGG - Intergenic
1173871625 20:46345636-46345658 AAGGCGGCAGGTTAGGGCAGAGG - Intergenic
1175139777 20:56852420-56852442 CAGGTGGCAAGGTGAGGTGGGGG - Intergenic
1175914946 20:62421986-62422008 CAGGAGGCCAGGCAGGGAGGAGG - Intronic
1176024119 20:62977262-62977284 TGGGGGGCAAGGCAGGGCGGGGG - Intergenic
1176143702 20:63556108-63556130 CAGTCGGCCAGGAAGGGCCGTGG - Exonic
1176159897 20:63642577-63642599 GTGGCGGCAGGGTATGGCGGGGG - Intronic
1176954921 21:15091193-15091215 CAGGGGGGAAGGTAGGAAGGTGG + Intergenic
1180996895 22:19970332-19970354 CAGGCAGCTAGGCAGGGAGGGGG - Exonic
1181044469 22:20207961-20207983 CAGCAGGCAAGGTAGGGGGACGG - Intergenic
1181162169 22:20965465-20965487 CGGGCTGCAAGGTCTGGCGGGGG + Intronic
1181814931 22:25430469-25430491 CAGGGGACAAGGGAGGGAGGGGG + Intergenic
1183028519 22:35084510-35084532 GAGGCCTCAAGGTAGGGTGGAGG + Intronic
1183201109 22:36386724-36386746 CAGCCGGCAAGCTAGTGCTGGGG + Intronic
1184160901 22:42696808-42696830 CAGGCGGCCAGGTGTGGCTGGGG - Intronic
1184985924 22:48134083-48134105 CAGGCACCAAGGCAGGGCTGGGG - Intergenic
952621062 3:35343120-35343142 CAGGAGGCATGGTAAGGAGGAGG - Intergenic
954686991 3:52376503-52376525 CAGGAGGGAAGGCAGGGCGCAGG - Intronic
954931006 3:54281239-54281261 CAAGTGGCAAGGGAGGGCAGGGG - Intronic
957230582 3:77509228-77509250 CAGGTGGGAAGGTAGGAAGGAGG + Intronic
958466818 3:94469979-94470001 CAGGCTTCAGGGTGGGGCGGTGG + Intergenic
961612739 3:128153500-128153522 GCGGCGGCATGGCAGGGCGGCGG + Exonic
962845836 3:139273198-139273220 CAGCAGGCAAGGTGGGGCTGTGG + Intronic
963814780 3:149817316-149817338 CAGGAGGTAAGGTAGTGGGGAGG + Intronic
965972233 3:174573674-174573696 CAGGGGGCAAGGTGAGGGGGAGG + Intronic
968693418 4:2008463-2008485 CAGGGGGCGAGGAGGGGCGGGGG + Intronic
969333111 4:6491383-6491405 CAGGGGGCCATGTAGGGTGGTGG + Intronic
969430059 4:7148735-7148757 CTTGCGGCCAGGTAGGGCTGTGG - Intergenic
969520721 4:7676301-7676323 CAGGCGGGAGGGGAGGGGGGAGG - Intronic
969580286 4:8060810-8060832 GAGCCGGCAGGGCAGGGCGGTGG - Intronic
969671539 4:8592821-8592843 GGGGCGGCATGGTGGGGCGGCGG - Exonic
985606181 5:859240-859262 CAGGTGGGAAGGCAGGGAGGGGG - Intronic
986455558 5:7914644-7914666 CAGGGGGCAAAGTTGGGTGGAGG + Intergenic
990456714 5:55995353-55995375 CTGGCGAGAAGGGAGGGCGGGGG - Intergenic
990954575 5:61330527-61330549 CAGGCTGCAAGGCAGGCGGGTGG + Intergenic
992104187 5:73436756-73436778 CGGGCGGGAAGGTAGGGCCGCGG + Intergenic
997264347 5:132486439-132486461 CAGGCTGCAGGGTTGGTCGGAGG - Intronic
999239426 5:150118894-150118916 CAGGGGACAAGGCAGGGCTGGGG + Intronic
1000205914 5:159058449-159058471 CTGGTTGCAAGGTAGGGCTGGGG - Intronic
1002873741 6:1191249-1191271 CAGGCTGCCATGTAGGGCCGGGG + Intergenic
1005189988 6:23210448-23210470 CAGGGGGAAAGGTAGGTGGGAGG - Intergenic
1006984373 6:38167305-38167327 CAGGCGGCATGGGGGGGTGGTGG + Intergenic
1007100005 6:39239652-39239674 CAGGCGGCAAGGGAGGTCAGGGG - Intergenic
1007633578 6:43285486-43285508 CAGGCGGAAAGCTGGGGCCGCGG - Exonic
1011557603 6:88586796-88586818 CAGGCAGCTGGGAAGGGCGGGGG - Intergenic
1012314333 6:97767201-97767223 CAGGGGGCAGGGTGGGGAGGGGG - Intergenic
1019005064 6:168789945-168789967 CAGGCTGCAAGCAAGGGCAGTGG - Intergenic
1019278831 7:190284-190306 CAGGCGGAAGGGTCTGGCGGAGG + Intergenic
1019427403 7:984112-984134 CAGGCGGCAAGGTCGGGGGCTGG - Intronic
1019704396 7:2490569-2490591 CAGGAGTGAAGGTGGGGCGGGGG + Intergenic
1024533878 7:50413838-50413860 GAGGCTGCAAGGGAGGGAGGGGG + Intergenic
1029124797 7:98288372-98288394 CAGTCGGCAGGGCTGGGCGGAGG + Intronic
1030139908 7:106293738-106293760 CAGTGGGCAGGGTGGGGCGGGGG - Intergenic
1030322368 7:108182595-108182617 CAGGTTGCAAGGGAGGGAGGTGG - Intronic
1031886589 7:127251671-127251693 CGGGCGGCCAGGTGCGGCGGGGG - Intronic
1032084666 7:128877615-128877637 CAGGCGGCAAAGAAGGGCTCCGG + Exonic
1032369001 7:131327795-131327817 CGGGCGGCCGGGGAGGGCGGCGG + Intronic
1036765667 8:11547969-11547991 CAAGCGGGAAGGTGGGGCTGGGG - Intronic
1036960223 8:13237607-13237629 CAGGTGGGGAGGTAGGGAGGGGG - Intronic
1037557859 8:20042969-20042991 GAGGAGGCAAGGGAGGGAGGAGG - Intergenic
1038296191 8:26292159-26292181 CGGGGGGCAAGGTGGGGAGGTGG - Intronic
1039527732 8:38231649-38231671 CAGGCGAAAAGGTGAGGCGGCGG - Exonic
1041190397 8:55348001-55348023 CTGGGGGCTAGGTAGGGTGGAGG - Intronic
1047738629 8:127788961-127788983 GAGGCTGCCAGGTAGGGCTGGGG + Intergenic
1049209466 8:141378873-141378895 CAGGCTTCAGGGTGGGGCGGGGG - Intergenic
1056827028 9:89883605-89883627 CAGGAGGCAGGGCAGGGAGGTGG - Intergenic
1057881487 9:98796121-98796143 CAGGCGGCCAGGTGAGGCGGCGG - Exonic
1061289261 9:129641618-129641640 CAGGCGACAGGGTGGGGCTGAGG + Intronic
1061537380 9:131258469-131258491 CAGGGGGCAAGGTGGGCTGGGGG + Exonic
1061673454 9:132202238-132202260 CAGGCAGCAATGTAGGCAGGAGG + Intronic
1061817419 9:133205441-133205463 GAGGCTGCAGGGTAGGGCAGAGG + Exonic
1062061930 9:134501585-134501607 CAGGCGGCCAGGCAGGGCATGGG + Intergenic
1062173493 9:135148255-135148277 CAGGGGACAAGGGAGGGAGGTGG + Intergenic
1062242984 9:135549785-135549807 GAGGCTGCAGGGTAGGGCAGAGG - Exonic
1062426110 9:136507014-136507036 CACGCGGCACGGCAGGGCCGGGG - Intronic
1186437693 X:9557204-9557226 CAGCCAGCAAAGTAGGGCGTTGG - Intronic
1187428794 X:19203192-19203214 GAGGCAGCCAGGTAGGGCTGGGG - Intergenic
1190302048 X:49062626-49062648 CAGGCGGGGAGGTTGGGAGGAGG + Intronic
1190414271 X:50166102-50166124 CAGGCAGAAAGGTAGGGCAGCGG - Intergenic
1192169332 X:68844592-68844614 CAGGAGGCCAGGTAGGCAGGTGG - Intergenic
1192625398 X:72722032-72722054 CAGGGGGCAGGGGAGGGGGGTGG - Intergenic
1195063829 X:101221076-101221098 CAGGTGGCAAGGCTGGGCTGGGG + Intronic
1200068063 X:153514414-153514436 GAGGCGGCCAGGTGGGGCGGTGG + Intergenic
1200208161 X:154332693-154332715 CAGGCGTCCAGGGAGGGCGGTGG - Intergenic
1200247805 X:154535135-154535157 CAGGCGGGAAGGGAGGGCAACGG + Intronic
1202336599 Y:23818252-23818274 CTGGAGGAAAGGTAGGGCTGGGG + Intergenic
1202534167 Y:25851819-25851841 CTGGAGGAAAGGTAGGGCTGGGG - Intergenic