ID: 1168831176

View in Genome Browser
Species Human (GRCh38)
Location 20:846001-846023
Sequence CACTGTGAGTGAGGGGCCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168831165_1168831176 15 Left 1168831165 20:845963-845985 CCTCTTGTGGGGCTGCATTTGCG 0: 1
1: 1
2: 1
3: 8
4: 88
Right 1168831176 20:846001-846023 CACTGTGAGTGAGGGGCCAAGGG 0: 1
1: 0
2: 1
3: 22
4: 253
1168831163_1168831176 26 Left 1168831163 20:845952-845974 CCTGCTTAGTTCCTCTTGTGGGG 0: 1
1: 1
2: 0
3: 5
4: 113
Right 1168831176 20:846001-846023 CACTGTGAGTGAGGGGCCAAGGG 0: 1
1: 0
2: 1
3: 22
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168831176 Original CRISPR CACTGTGAGTGAGGGGCCAA GGG Exonic
901044491 1:6387567-6387589 CTCTGAGAGTGAGAGGCCAAGGG + Intronic
905536210 1:38723968-38723990 CACTGTGGGTGAAGGGGCAGAGG - Intergenic
905581464 1:39085727-39085749 CACAGGCAATGAGGGGCCAAAGG - Intronic
905715744 1:40148204-40148226 CAGTGTGACTGATGAGCCAACGG - Intergenic
907246019 1:53109709-53109731 CACTGGCAGTGAGGGACCAGGGG - Intronic
907663740 1:56416366-56416388 CACCATGAGGGAGGGGCCAGCGG + Intergenic
910739662 1:90501213-90501235 CACTGTGAGAGAGCAGACAATGG + Intergenic
914802059 1:150969088-150969110 CATCCTGAGTGAGGGGCAAAGGG + Exonic
915684360 1:157616699-157616721 CACTGAGCGTGAGGTGCCAGTGG + Intergenic
915708430 1:157869730-157869752 CATTGTCAGTGAGGGGCAGATGG + Intronic
915785187 1:158603104-158603126 CTCTGTGAGGGAGTTGCCAAAGG - Intergenic
918691444 1:187485357-187485379 CAATGTGACTGAGGAGTCAAAGG - Intergenic
919746007 1:201009539-201009561 CAGTGTGAGGGAGGGGCCTGTGG - Intronic
921329846 1:214024609-214024631 CAATGTGAGTAAGGAGCCTAGGG - Intronic
923256168 1:232223432-232223454 CACTCTGAGGGAGGGGCAAAGGG - Intergenic
923329144 1:232906605-232906627 CACTGTGAGGAAGGGACAAAGGG - Intergenic
923395836 1:233561456-233561478 CACTGGGGGTTAGGGCCCAAAGG - Intergenic
923638368 1:235724449-235724471 AACTGTGAGTGCAGGGCCAAGGG - Intronic
923831183 1:237559324-237559346 CACTATGATTGAGGGGCCGTTGG - Intronic
924637183 1:245799246-245799268 CACAGAGAGAGAGGGGCCGAGGG + Intronic
1063034236 10:2269373-2269395 CCCTCTTAGTGAAGGGCCAATGG - Intergenic
1063529109 10:6813392-6813414 TAATGTGAGTGAGGGGTCACTGG + Intergenic
1063737677 10:8779069-8779091 CTCTGTGTGTGAAGGGCCATGGG - Intergenic
1064119463 10:12606247-12606269 TGCTGTGTGTGAGGGGCCCATGG - Intronic
1065309269 10:24398474-24398496 CAATTTGACTGAGGGGCCTAAGG + Intronic
1066654730 10:37687085-37687107 CACTGTCAGGGAGGGACAAATGG + Intergenic
1070404833 10:76085562-76085584 CCCTGTGAGGTAGGGGCCAGGGG - Intronic
1071181226 10:82985894-82985916 CACTGGCACTGTGGGGCCAAGGG - Intronic
1071571019 10:86697083-86697105 CTCTGTGAGTGTGGGGACATGGG + Intronic
1073253871 10:102138762-102138784 CTCTGTGAGTGTGGGACCAGGGG + Exonic
1073338661 10:102729159-102729181 CACTGTGAGTGAGGGGGAGAGGG + Intronic
1073841344 10:107502601-107502623 TAGTGTGAGTTAGGGGGCAAGGG - Intergenic
1075346649 10:121687131-121687153 CCCTGAGATTGAGGGGCCAGTGG - Intergenic
1075443122 10:122494834-122494856 CACTGCGGGTGAGGGGCCTGGGG + Intronic
1076873837 10:133206422-133206444 GACTGTGGGTGAGGGGCGCAGGG + Intronic
1076874182 10:133207911-133207933 CAGAGTGGGTGAAGGGCCAAGGG - Intronic
1077176412 11:1193181-1193203 CACTGGGTGTGTGGGGCCGAAGG + Intronic
1077719383 11:4612234-4612256 CACTGTGAGTCATGAGGCAATGG - Intergenic
1079133440 11:17762783-17762805 CACGGTGAGGGAGTGGCCCAGGG - Intronic
1080120762 11:28674523-28674545 CACTATCAGTGAGGGGCTACTGG - Intergenic
1081179063 11:39965558-39965580 CCCTTTGAGAGAGGGGCAAAGGG - Intergenic
1081911320 11:46701531-46701553 CTTGGCGAGTGAGGGGCCAAGGG - Exonic
1083626654 11:64075281-64075303 CACCTGGAGGGAGGGGCCAAGGG - Intronic
1083722638 11:64611053-64611075 CACTGCCAGGGAAGGGCCAACGG + Intronic
1084083979 11:66846304-66846326 AGCTGTGAGTGAGGGGACAAGGG + Exonic
1088194235 11:107257852-107257874 TACTCTGAGGGAGGGGCAAAGGG + Intergenic
1089066544 11:115666303-115666325 AACTGTCAATGAGGGGCCCAGGG - Intergenic
1089214485 11:116827464-116827486 GACTGTTGGTGAGGGGCCACAGG + Intergenic
1089564447 11:119363612-119363634 CACCGAGAGGGAGGGGGCAAGGG + Intronic
1090411980 11:126515616-126515638 CAGTGTGAATGAGGGCCCAGAGG + Intronic
1093709142 12:22309617-22309639 TACTTTGAGAGAGGGGCAAAGGG - Intronic
1096239585 12:49952602-49952624 CACTGGGAGTGAAAGGCCATGGG + Intronic
1096792028 12:54051473-54051495 GACTGTGAGTGAGGGGGCGGAGG - Intronic
1097297763 12:57985422-57985444 GACTGTGTGTGAGGGACCATAGG + Intergenic
1099500530 12:83408313-83408335 CTCTGTAAGTGAGCAGCCAATGG - Intergenic
1101660383 12:106759943-106759965 CTCTGTGAGTGAGAGCCTAAGGG - Intronic
1101968354 12:109295875-109295897 CACTGTAACTGAGGGGCCCTGGG + Intronic
1105600023 13:21878504-21878526 CAGTGTGACTGAGGGGCATAGGG - Intergenic
1105799597 13:23891873-23891895 CACTGGTCCTGAGGGGCCAAGGG - Exonic
1105849450 13:24321162-24321184 CACTGGTCCTGAGGGGCCAAGGG + Exonic
1107597763 13:41980737-41980759 CACAGAGAGAGAGAGGCCAAGGG - Intergenic
1113439257 13:110314970-110314992 CTGTGTTAGTTAGGGGCCAAGGG + Intronic
1113613795 13:111666401-111666423 TACTGGGAGTGAGGGGCCTCTGG - Intronic
1116502736 14:45639849-45639871 CACTTTGAGGGAGGGGCAAACGG - Intergenic
1118003309 14:61543483-61543505 CAGAGTGAGTGAGGGGACCAGGG - Intronic
1118978921 14:70700604-70700626 CACTGGGAGTCAGAAGCCAAAGG + Intergenic
1120000516 14:79297784-79297806 CACTGCGAGGAAGAGGCCAAAGG + Intronic
1120750226 14:88190540-88190562 CACTGTGCGTAAGGGGAAAATGG + Intronic
1121953080 14:98189219-98189241 TACTGTGGGTGAGAGGCCACAGG - Intergenic
1122363643 14:101181981-101182003 AACGGAGAGTGAGGGGCCAGGGG + Intergenic
1122647367 14:103204168-103204190 CACTTCGAGGGAGGGGCAAAGGG - Intergenic
1123480247 15:20624495-20624517 CACTGTGAGTGTGGGGGCAGGGG - Intergenic
1123637759 15:22375868-22375890 CACTGTGAGTGTGGGGGCAGGGG + Intergenic
1125325890 15:38535519-38535541 CTCTGTGAGTCAGTGGCCAGGGG + Intronic
1125502579 15:40248654-40248676 CACTGGGTGTGAGGGGCAGAGGG - Intronic
1128509655 15:68305599-68305621 AACAGTGAGTCAGTGGCCAAAGG - Intronic
1128562567 15:68678322-68678344 CAGTGTGAGGGAGGGGAGAAAGG - Intronic
1128666827 15:69544488-69544510 CACTGTGGGTCAGGAGCCCAGGG - Intergenic
1129878932 15:78994553-78994575 CGCTGTGATGCAGGGGCCAAGGG + Intronic
1130100841 15:80892739-80892761 GACTGTGAGTGAGGTACCCAGGG - Intronic
1130254072 15:82317747-82317769 CTATGTGAGTGTGGGGCCCAGGG + Intergenic
1130276310 15:82477987-82478009 CACAGTGAGTGTGGGGGCAGAGG - Intergenic
1130468672 15:84205380-84205402 CACAGTGAGTGTGGGGGCAGAGG - Intergenic
1130485077 15:84394382-84394404 CACAGTGAGTGTGGGGGCAGAGG + Intergenic
1130495603 15:84468199-84468221 CACAGTGAGTGTGGGGGCAGAGG + Intergenic
1130590965 15:85209979-85210001 CACAGTGAGTGTGGGGGCAGAGG - Intergenic
1130600900 15:85272224-85272246 CTATGTGAGTGTGGGGCCCAGGG - Intergenic
1131188398 15:90294253-90294275 CACAGTGAGTGTGGGGGCAGAGG + Intronic
1132077252 15:98832124-98832146 CAATGTGAGTTTGGGGCAAAAGG - Intronic
1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG + Intergenic
1134089404 16:11383644-11383666 CACTGTGGAGGAGGGGCCAGGGG + Exonic
1134359987 16:13522391-13522413 CACTGAGGGGGAGGGGCCGATGG - Intergenic
1135313354 16:21422426-21422448 CACTGTCAGTGTGGGAGCAATGG + Intronic
1135366278 16:21854704-21854726 CACTGTCAGTGTGGGAGCAATGG + Intronic
1135445537 16:22516460-22516482 CACTGTCAGTGTGGGAGCAATGG - Intronic
1135762908 16:25151871-25151893 CACTTTGAAGGAGGGGCAAAAGG + Intronic
1136323465 16:29502931-29502953 CACTGTCAGTGTGGGAGCAATGG + Intronic
1136438150 16:30242900-30242922 CACTGTCAGTGTGGGAGCAATGG + Intronic
1136577188 16:31131765-31131787 CATGGTGGGTGAGGGGCCAGAGG + Exonic
1136721394 16:32321706-32321728 CACTGTGAGTGAGTGAGCCACGG - Intergenic
1137936182 16:52637641-52637663 CACTGGGACTAAGGGGCCAGAGG - Intergenic
1140126238 16:72121275-72121297 CACTGGGAGTGAGGGGCTACTGG - Intronic
1203005038 16_KI270728v1_random:196064-196086 CACTGTGAGTGAGTGAGCCACGG + Intergenic
1203136588 16_KI270728v1_random:1732183-1732205 CACTGTGAGTGAGTGAGCCACGG + Intergenic
1142648378 17:1329821-1329843 AACTGTGAGGGAGGGGACATAGG - Intergenic
1143026624 17:3945041-3945063 AAGTGTGAGTGCGGGGCCAGGGG - Exonic
1143283242 17:5770659-5770681 GACAGTGATAGAGGGGCCAAGGG + Intergenic
1143750060 17:9021497-9021519 CGCTGGGAGTGAGGGGCGGAGGG - Intergenic
1143772627 17:9178355-9178377 CACTCAGAGTGAGGGTCCCAGGG - Intronic
1146560407 17:33864150-33864172 CACTTTGGGTGGGGGGCCGAAGG - Intronic
1146784739 17:35709491-35709513 CACTGTGATTTAGAGACCAATGG - Intronic
1147723082 17:42550521-42550543 CACTGTCACAGAGGGGCAAAGGG - Exonic
1147724294 17:42556747-42556769 CACTGTCACAGAGGGGCAAAGGG - Intergenic
1148983196 17:51597410-51597432 CACTTTGAGGGAGGGGCAAAGGG + Intergenic
1149100655 17:52902637-52902659 GTCTGTGAGTGTGGTGCCAAAGG + Intergenic
1154018336 18:10639591-10639613 CACTGTGAGTCAGGAGCCATTGG + Intergenic
1154119149 18:11636784-11636806 CACTGTCAGTGTGGGAGCAATGG + Intergenic
1154186537 18:12189999-12190021 CACTGTGAGACAGGAGCCATTGG - Intergenic
1155859508 18:30879324-30879346 CATTGTGAGAGAAGGGGCAATGG + Intergenic
1157276777 18:46316098-46316120 CACTCTCAGTCAGAGGCCAAAGG - Intergenic
1157298222 18:46461203-46461225 AACTGAGACTCAGGGGCCAAGGG - Exonic
1158330442 18:56356621-56356643 CACAGAAAGTGAGGGGACAATGG - Intergenic
1158929645 18:62311023-62311045 CACTTTGAGGGAGGGGTAAAGGG - Intergenic
1161106435 19:2446024-2446046 CCCTGTGATTGAGGGGTGAAAGG - Intronic
1162535306 19:11260148-11260170 AACTGTGAGGGAGTGGCCCAGGG - Intronic
1164561509 19:29295502-29295524 CACTTTCAGGGAGGGGCAAAGGG - Intergenic
1165828182 19:38717492-38717514 TACAGTGAGTGAGGGCCAAAGGG - Intronic
1165993156 19:39827230-39827252 AAGTGTGAGTGAGGGGCCACGGG + Intronic
1166051749 19:40264729-40264751 AACTGTGAGTGAGGGACAATGGG - Intronic
1166288136 19:41845033-41845055 CACTGTGAGAAAGTGGCCAGAGG - Exonic
1166967371 19:46537407-46537429 CACTGTGGGGAAGTGGCCAAGGG + Intronic
926023966 2:9523508-9523530 CACTTTAAGTTTGGGGCCAAAGG - Intronic
926705458 2:15834367-15834389 TACTGAGAGTGAGGGGCCCCGGG + Intergenic
927070941 2:19528965-19528987 GTCTTTGAGTGAGGGGCCAGTGG - Intergenic
927295283 2:21446249-21446271 GGCTGTGAGTATGGGGCCAAAGG - Intergenic
927321511 2:21752171-21752193 CACTGTGAGGGAGGGAGGAAAGG - Intergenic
927636341 2:24819959-24819981 CAGTGTGACAGAGGGGCCATTGG + Exonic
932528604 2:72501331-72501353 CATTGTGAGAGAGGGAGCAAGGG - Intronic
934654537 2:96110312-96110334 CCCTGTGTGTGGGGGGCCACTGG - Intergenic
934761495 2:96859388-96859410 TAGTGGGAATGAGGGGCCAAAGG - Intergenic
935902883 2:107811317-107811339 CATTGTGTTTGAGAGGCCAAGGG - Intergenic
938750024 2:134319558-134319580 CAGTGGGAGTGATGGGACAATGG + Intronic
939332076 2:140777268-140777290 CTCTGTGAGCTAGGGGCAAAGGG - Intronic
941700636 2:168600610-168600632 CAGAGTGAGTGAGATGCCAAGGG - Intronic
942093062 2:172512832-172512854 TACTTTGAGGGAGGGGCAAAGGG - Intergenic
942211057 2:173670803-173670825 GACTGTGAGTGAGGGTTTAAAGG - Intergenic
942643193 2:178082529-178082551 CACTTTGAGGGAAGGGCAAAGGG + Intronic
943581244 2:189685741-189685763 GGCTGTGAGTCAGGGGCCAAAGG + Intronic
943713892 2:191128698-191128720 CTCAGTGAGTGAGGGGGCATGGG - Intronic
945997217 2:216447736-216447758 CTCTGTGAGTGCAGTGCCAATGG + Intronic
947735923 2:232455520-232455542 CACTCTGAGTGTGTAGCCAAAGG - Intergenic
947866341 2:233400411-233400433 CACTGGGTGTGAAGGGCAAAGGG - Intronic
948337724 2:237223743-237223765 CACTGTGAGGGAGGGGGCCTGGG - Intergenic
948507815 2:238441843-238441865 CAGTGTGATTGATGGGTCAAAGG + Intronic
948842153 2:240657114-240657136 CACTGAACATGAGGGGCCAAGGG + Intergenic
1168831176 20:846001-846023 CACTGTGAGTGAGGGGCCAAGGG + Exonic
1169212537 20:3775418-3775440 CAGTGTGTGTGAAGGGCTAACGG - Intergenic
1170382343 20:15775078-15775100 CACTTTGAGGGAGGGGCAAAGGG + Intronic
1170430126 20:16267911-16267933 CAGAGTGAGAGAGGGGCCATGGG + Intergenic
1172460604 20:35115594-35115616 CACTGTTAGTTCGGGGCCATGGG - Exonic
1175673863 20:60930684-60930706 CACTGCGAGTCAGAGGACAAAGG + Intergenic
1175940590 20:62535899-62535921 CACTCTGAGTGACGGGACAGGGG - Intergenic
1179421815 21:41242271-41242293 GACTGTGGGTAGGGGGCCAAAGG + Intronic
1179531987 21:42026032-42026054 CACTGTGACTGAAGGGTCACTGG - Intergenic
1180080882 21:45487056-45487078 CTCTGTGAGTGAGATGCCAGGGG - Intronic
1182419779 22:30243346-30243368 CAAAGTGAGCAAGGGGCCAAAGG + Exonic
1182754295 22:32666414-32666436 CAGAGTGAGAGAGGGGACAAAGG - Intronic
1183122392 22:35740045-35740067 CACTAGGAGTGAGGAGCCCAGGG - Intronic
1183456664 22:37926708-37926730 CACTGTGAGAGGGGGTCCCATGG - Intronic
1183667701 22:39254907-39254929 CATTGTTTGTGAGGGGCCAGAGG - Intergenic
1184706011 22:46214181-46214203 CACTGTCAGTGCGGGGGCATGGG + Intronic
1184956577 22:47890937-47890959 AACTGTGAGTGGGAGGCAAACGG - Intergenic
949128442 3:473168-473190 CACTTTGAGGCAGGGGCAAAAGG + Intergenic
949281470 3:2352466-2352488 CACTCTGAGTGTGGGGCCCGTGG - Intronic
949495374 3:4626682-4626704 CACTGAGAGTGAGGGGACAAGGG + Intronic
950577574 3:13842011-13842033 CAGTGTGTGTGAGGAGCCACAGG + Intronic
952150016 3:30579000-30579022 CACTTTGAGGGAGGGGTAAAGGG - Intergenic
952162010 3:30703379-30703401 CACTCTGGGTGAAGGGCCACAGG - Intergenic
952348321 3:32509620-32509642 CACTGAGATTGAGGTGCCAGAGG + Intergenic
953419076 3:42740717-42740739 CACAGTGAGTGAAGGGGCAGAGG + Intronic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
953669281 3:44948912-44948934 CACTGAGGATGAGGAGCCAAAGG + Intronic
954414894 3:50388494-50388516 CTGAGTGAGTGAGGGGCCACTGG - Intronic
957669427 3:83281261-83281283 CACTGTGAGTGTGCAGCCTAAGG - Intergenic
958900473 3:99880133-99880155 AACTGTGAATGTGGAGCCAAAGG + Intronic
962363063 3:134757684-134757706 CACTGGGAGTGAGGGGCTAGGGG + Intronic
966246093 3:177809184-177809206 CACTCTGAGTGTGGGGCCCGCGG + Intergenic
966881782 3:184354734-184354756 GAGGGTGAGGGAGGGGCCAACGG + Intronic
967100319 3:186210616-186210638 CCCTGTGAGTGAGGAGCACAGGG + Intronic
968882104 4:3306408-3306430 GAGTGTGAGTGTGGGGGCAAAGG + Intronic
968963097 4:3755370-3755392 CATTTTGAGGGAGGGGCAAAGGG - Intergenic
969471168 4:7390058-7390080 CACTGTGAGGGGGAGGCCCACGG + Intronic
971443395 4:26715365-26715387 CACTGTGACGGCAGGGCCAACGG - Intronic
971615212 4:28780570-28780592 CAATGGGTGAGAGGGGCCAAAGG + Intergenic
975139004 4:70901958-70901980 CACCGTGAGTGTCCGGCCAAGGG - Intergenic
978223355 4:106304099-106304121 TACTTTGAGGGAGGGGCAAAGGG - Intronic
978392678 4:108243438-108243460 CAGAGTGAGTGAGGGGTAAATGG + Intergenic
978854822 4:113382324-113382346 CACTCTGAGGGAGGGGAGAAGGG + Exonic
979949527 4:126874724-126874746 CACTCCGAGTGCAGGGCCAACGG + Intergenic
983266187 4:165510698-165510720 CACTGAGAGTGAGGTGCCAGAGG + Intergenic
984330882 4:178316349-178316371 CACTGTGTGTGAGGAGACACAGG - Intergenic
987376428 5:17239542-17239564 CAGGGTGAGTGTGGGGTCAACGG - Intronic
987675796 5:21071045-21071067 CACTATGAGGGAGGAGCAAAGGG - Intergenic
989067437 5:37478547-37478569 CCCTGTGAGAGAGGGTACAAGGG + Intronic
989544027 5:42651422-42651444 CACTGTGAGTGGGGTTTCAAAGG + Intronic
990891197 5:60652054-60652076 CACTTTGAGGGAGGGGTAAAGGG + Intronic
992115409 5:73534342-73534364 CACTTTGAGGGAGGGGCAAAGGG + Intergenic
992190905 5:74290829-74290851 GACAGTGAGTGAGGGACTAAGGG + Intergenic
993353281 5:86876156-86876178 CACTTTGAGGGAGGGGCAAAAGG + Intergenic
995064424 5:107844007-107844029 CCCTGTGAGTTAGAGGCAAAGGG + Intergenic
995759773 5:115551010-115551032 CACTTTGAGTGAGGGGAGTAGGG - Intergenic
997725520 5:136117067-136117089 TACTGTGAGTTAGGGGCAACAGG + Intergenic
998456986 5:142281069-142281091 CAGTGTGCCAGAGGGGCCAACGG + Intergenic
999805586 5:155078069-155078091 GTCTGTGAGTGTGTGGCCAAAGG - Intergenic
1000314492 5:160075470-160075492 CACATTGAGTGAGAGGTCAAGGG - Intronic
1000832043 5:166114685-166114707 CACTATTAATGAGGGACCAATGG - Intergenic
1001342526 5:170861472-170861494 CCCTGGGAGTCAGGGGTCAAGGG + Intergenic
1001429047 5:171645253-171645275 CACAGGGAGGGAGGGGCCTATGG - Intergenic
1001631697 5:173180092-173180114 AACGGGGACTGAGGGGCCAATGG + Intergenic
1001680993 5:173556791-173556813 CACTGTGAGATAGTGGCCATTGG + Intergenic
1001961012 5:175880429-175880451 CACTGAGGGTTAGAGGCCAAAGG - Exonic
1004431961 6:15553271-15553293 CACTTTGAGGGAGGGGCAGAGGG + Intronic
1004432096 6:15554595-15554617 CACTTTGAGGGAGGGGCAGAGGG + Intronic
1004700711 6:18076965-18076987 CACGGTGAGAGAGGGAGCAAGGG + Intergenic
1005827327 6:29641882-29641904 CACTGTTAGTGAAGGGCAGAAGG - Intergenic
1007077422 6:39076748-39076770 AACACTGAGGGAGGGGCCAACGG + Intronic
1007092061 6:39190761-39190783 AACTGGGAGTGGGGGGCCAGGGG - Exonic
1007420581 6:41716850-41716872 GACTCTGAGTGATGGGCCAGGGG - Intronic
1007465696 6:42049602-42049624 CCCTGGGAGTGAGGCGGCAAGGG + Intronic
1007711455 6:43826737-43826759 CAGAGTGAGTGAGGTGGCAAAGG + Intergenic
1008588495 6:52970326-52970348 CACTGAGAGTGAAGGCCCAAGGG - Intergenic
1008669979 6:53757684-53757706 CACTGTGAGTGAGGCTTCACTGG + Intergenic
1009918884 6:70031452-70031474 AAGGGTGAGTGAGGGGGCAAGGG - Intronic
1012658833 6:101860317-101860339 TACTTTGAGGGAGGGGCAAAAGG + Intronic
1015186149 6:130418716-130418738 CACTGTGACTGTGTGACCAAAGG - Intronic
1016455201 6:144223430-144223452 CACTTTGAGGAAGGGGCAAAGGG - Intergenic
1017070446 6:150571315-150571337 CACTGACAGTGAGGGTCCACTGG - Intergenic
1017640898 6:156492808-156492830 CATTGTGAATGAGGACCCAATGG + Intergenic
1017950828 6:159133271-159133293 CACTGTGAATGACGAGCGAAGGG - Intergenic
1019017508 6:168890643-168890665 CACTCTGAGAGACGGGCCTAAGG - Intergenic
1022034792 7:26523512-26523534 CACAGTGAGTAAGGGGACTATGG + Intergenic
1022950082 7:35330300-35330322 CACTGGGAGAGAGGGGGAAATGG - Intergenic
1024945191 7:54800908-54800930 CACAGTGAGTGTGGGGACTATGG - Intergenic
1028526841 7:91795964-91795986 CACTGTGAGAGAAAAGCCAAAGG + Intronic
1031008295 7:116499159-116499181 CACTGTGTGTTACGGGCCATGGG + Intronic
1032655811 7:133928618-133928640 GACTGTGAGTGAGGGGAGGAGGG - Intronic
1035788046 8:2278119-2278141 CGCTGTGAGTGCCGGGCCCAGGG + Intergenic
1035804761 8:2443594-2443616 CGCTGTGAGTGCCGGGCCCAGGG - Intergenic
1037506668 8:19537531-19537553 CACTTTGAGTGAGGGGTAAAGGG - Intronic
1037779549 8:21858368-21858390 CACTATGGGGGAGGGGCCCAGGG - Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1040493556 8:47946857-47946879 GACTGTGAGTGAGGGACTGAGGG - Intronic
1042002848 8:64145720-64145742 CACTTTGAAGGAGGGGCAAATGG + Intergenic
1044487438 8:92769232-92769254 CACTGTGAGTAAGCTGCAAACGG - Intergenic
1044963897 8:97556989-97557011 CGCTGTGAGTGTGGGGCCTGCGG - Intergenic
1045004960 8:97909650-97909672 CCGAGTGAGTGAGGGGCCCACGG + Intronic
1047290127 8:123522662-123522684 GATTGTGGGTCAGGGGCCAATGG - Intronic
1048534775 8:135283120-135283142 TACTGTGAGTAAGGGGAAAATGG + Intergenic
1048795566 8:138146226-138146248 CTCTGAGTGTGGGGGGCCAAGGG - Intronic
1048911058 8:139135532-139135554 CTGTGTGGGTGAGAGGCCAAAGG + Intergenic
1049391518 8:142373948-142373970 CACTGTGTGTGTGGAGCAAAGGG + Intronic
1056387683 9:86112562-86112584 CACAGTGAATCAGGGGCCAAGGG + Intergenic
1056684976 9:88752023-88752045 CACTGGGAGGGAGGGCCCAGAGG + Intergenic
1059357339 9:113710267-113710289 CAGTGGTAGTGAGGGGACAAAGG - Intergenic
1061290434 9:129647672-129647694 GTCAGTGAGTGAGGGGCCCAGGG + Intergenic
1061388235 9:130302994-130303016 CACTTTCAGTGAGTGGCCCACGG + Intronic
1185829522 X:3286859-3286881 CACTGTGATTCATGGGCCATGGG - Intergenic
1186178125 X:6946378-6946400 CACTTCGAGGGAGGGGCAAAGGG - Intergenic
1187952048 X:24480651-24480673 GTCTGTGAGTGAGATGCCAAAGG + Intronic
1189675639 X:43457933-43457955 AACTGTGAGTCAGGGTGCAATGG - Intergenic
1190244751 X:48683850-48683872 CACCATGAGTGGGGGCCCAATGG + Exonic
1190957876 X:55213927-55213949 CACTGTGAATGAGGAGCCTCTGG + Intronic
1191715796 X:64192700-64192722 CAAAGTGAGCCAGGGGCCAAGGG - Exonic
1192153315 X:68725191-68725213 CAGTGTCAGTGCGTGGCCAAAGG - Exonic
1194761150 X:97797567-97797589 CACTTTGAGAGAGGGGCAAAGGG - Intergenic
1195087336 X:101424714-101424736 CAGTGAGAGTGAGCGGTCAAGGG + Intronic
1201561555 Y:15322585-15322607 CAATGGGAGTCAGGGGACAAAGG - Intergenic