ID: 1168831261

View in Genome Browser
Species Human (GRCh38)
Location 20:846427-846449
Sequence GTGGGTTCTCATAACTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168831254_1168831261 1 Left 1168831254 20:846403-846425 CCTGGCTGGAGACATGTCCCCGT 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1168831261 20:846427-846449 GTGGGTTCTCATAACTCTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168831261 Original CRISPR GTGGGTTCTCATAACTCTCC TGG Intronic
900808146 1:4781341-4781363 GTGGGTTTTCAGAGCTCCCCAGG - Intronic
901102006 1:6726273-6726295 CTGGCTCCTCATAACTCTCAGGG + Intergenic
906635077 1:47404098-47404120 GTTGGGTTCCATAACTCTCCAGG + Intergenic
908535998 1:65077955-65077977 TTGGGTACTGATAACTTTCCAGG + Intergenic
908536006 1:65078023-65078045 TTGGGTACTGATAACTTTCCAGG + Intergenic
910380597 1:86622831-86622853 GTGGGTTCTCTCAACTTTTCTGG - Intergenic
911561969 1:99417671-99417693 GTGGATTCTCTTAGCTTTCCTGG - Intergenic
919196016 1:194287274-194287296 CTGGGTTCAATTAACTCTCCTGG + Intergenic
919606427 1:199689861-199689883 CCGGGTTTTCACAACTCTCCTGG - Intergenic
920371065 1:205479632-205479654 GAGAGTTCTGAGAACTCTCCAGG + Intergenic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1064557266 10:16559749-16559771 GTGGATTCTCTTAGCTTTCCTGG + Intergenic
1075508447 10:123047941-123047963 GTGGCTTCTCAGAGCTCACCAGG + Intronic
1075810093 10:125218896-125218918 CTGGGTTCTCACTACTCACCTGG + Intergenic
1087567162 11:99875967-99875989 GAGAGTTCTTCTAACTCTCCAGG - Intronic
1087689071 11:101298181-101298203 GTGGGTTCTCTCAGCTTTCCTGG + Intergenic
1087850844 11:103027595-103027617 GGGGGTACTCATCACTCTCCTGG + Intergenic
1091176612 11:133563982-133564004 GTGTGTTCTCTTAATTCCCCCGG - Intergenic
1092234369 12:6797040-6797062 CTGGGTTTTCACAAATCTCCAGG - Intronic
1092813532 12:12293012-12293034 CTGGGTTCACGTCACTCTCCTGG - Intergenic
1093271299 12:17065601-17065623 GTGGGTTCTCAGAACACTTAAGG - Intergenic
1096091055 12:48901533-48901555 ATCGGTTCTCCTAAATCTCCAGG + Intergenic
1096196531 12:49652194-49652216 TTGTGTTCTCATATGTCTCCTGG + Exonic
1098035379 12:66296313-66296335 TGTGGTTCACATAACTCTCCAGG + Intergenic
1101912470 12:108870525-108870547 CTGGGTTCTAGTAAATCTCCTGG - Intronic
1103121207 12:118381131-118381153 GTGGCTTCTCTGAGCTCTCCAGG - Intronic
1103678500 12:122675584-122675606 GTGGGTTCTCATTTCTCTGTGGG + Intergenic
1105990550 13:25615939-25615961 GTGGATTCTCTCGACTCTCCTGG + Intronic
1108831608 13:54486662-54486684 GTGGATTCTCTTAACTTTCTTGG - Intergenic
1108917106 13:55628298-55628320 GTGGGTTCTGATTAATCTTCTGG + Intergenic
1109484527 13:63001683-63001705 GTGGATTCTCTTGACTTTCCTGG - Intergenic
1111744866 13:92254780-92254802 GTGGGTTCTCATAGATCTGATGG - Intronic
1111845133 13:93498166-93498188 GTGGCTTCTAAGAACTCACCAGG - Intronic
1120400389 14:84023331-84023353 GTGGATTCTCTCAACTTTCCTGG + Intergenic
1124439712 15:29677129-29677151 GGGGGTTTCCATAAATCTCCCGG - Intergenic
1126408823 15:48350876-48350898 CTGGGTTCACATGATTCTCCTGG + Intergenic
1126764942 15:52002411-52002433 GTGCTTTCTCAGACCTCTCCTGG + Intronic
1128610777 15:69071408-69071430 TGGTGTTCTCATCACTCTCCAGG + Intergenic
1134038060 16:11047159-11047181 GTGAGTTCTCGTAAATCACCAGG - Intronic
1138652354 16:58467968-58467990 TTGGGTTCTCACAACAGTCCAGG + Intronic
1142481804 17:223665-223687 GTGGATTTTCATAACTGACCAGG - Intronic
1144542965 17:16163216-16163238 GTGGGTTCTTTTCACTTTCCTGG - Intronic
1150051850 17:61971838-61971860 CTGGGTTCACACAATTCTCCTGG - Intronic
1156682735 18:39610540-39610562 ATGGGTTCACATAACAGTCCAGG + Intergenic
1157574739 18:48736060-48736082 GCAGGTTTTCATAACACTCCGGG - Intronic
1158733555 18:60053921-60053943 GTTTGTCCTCATAACTCTCTAGG + Intergenic
1159961505 18:74558953-74558975 GTGGGTTCTCAGCTTTCTCCAGG - Intronic
1161579283 19:5071841-5071863 GTGTCTTTTCATGACTCTCCAGG - Intronic
1163090061 19:15013185-15013207 GTGGGGTCTCATCTCTCCCCCGG - Intronic
1163388452 19:17014915-17014937 GTGGGTGCACATAGCTCCCCAGG - Intronic
1167669938 19:50844979-50845001 GTGGGTTCTCTTGGCTTTCCTGG + Intergenic
1167678655 19:50906182-50906204 CTGGTTTCTCTTAACTATCCAGG + Intergenic
1167753282 19:51394003-51394025 CTGGGTTCTCATCAGTCTCCAGG - Intergenic
925510031 2:4615226-4615248 CTGGGTTCCCATTACTCTACAGG + Intergenic
925795725 2:7540031-7540053 GTGGGTTCTCTCAGCTTTCCTGG + Intergenic
928443371 2:31311950-31311972 GTGGGTTCTCTTGGCTTTCCTGG + Intergenic
935919460 2:107995839-107995861 GTGGATTTTCATAACTTTGCAGG + Intronic
936700995 2:115011761-115011783 GTGGATTCTCTTAGCTTTCCTGG - Intronic
936850683 2:116894760-116894782 GTGGATTCTCTTAGCTTTCCTGG - Intergenic
937699497 2:124847627-124847649 GTGGGTTCTCTTAGCTTTCCTGG + Intronic
941333118 2:164205478-164205500 GTGGTTTCCCATAATTCTACTGG + Intergenic
945536779 2:211026883-211026905 GTGGATTCTCTTGACTTTCCTGG + Intergenic
947616021 2:231557415-231557437 GTGGGTGCTCCTTCCTCTCCTGG + Intergenic
1168831261 20:846427-846449 GTGGGTTCTCATAACTCTCCTGG + Intronic
1171461718 20:25301750-25301772 GTGGGTACTCATGGCTCTCTGGG + Intronic
1173510424 20:43623953-43623975 TTGGGATCTCATCACTCTCCTGG - Exonic
1173903705 20:46610446-46610468 CTGTGTTCTCTTCACTCTCCTGG + Exonic
1177445394 21:21188985-21189007 GAGGGTTCTCATAAGTTTCTGGG - Intronic
1178464316 21:32832927-32832949 GTGGGTTCTGGTAATTCCCCTGG + Intergenic
1181386287 22:22548243-22548265 GGATGTCCTCATAACTCTCCAGG + Exonic
950884850 3:16354224-16354246 CTGTGTTCTCATAACTCTCTGGG - Intronic
950942380 3:16905892-16905914 ATGAGTGCCCATAACTCTCCAGG + Intronic
952148866 3:30564549-30564571 GTGTGTTTTCATAATTCTTCTGG + Intergenic
955363330 3:58291762-58291784 GTGGTTTCTGATATCTCTCCAGG + Intronic
956752415 3:72353804-72353826 GTGTGCTCTGAGAACTCTCCAGG - Intergenic
956886684 3:73567222-73567244 GGGGCTTTTCATAACTTTCCTGG + Intronic
957567932 3:81908450-81908472 GTGGATTCTCATAATTCACTAGG + Intergenic
962119511 3:132546926-132546948 GTGGGTTCTCAGATCTCGCATGG + Intergenic
962729920 3:138272231-138272253 GTGGGTTTTCTTAACTTTACTGG - Intronic
968940619 4:3635609-3635631 GTGGGTTCTCACGTCACTCCAGG - Intergenic
970242492 4:14024007-14024029 GTATTTTCTCATAATTCTCCAGG - Intergenic
971573903 4:28250016-28250038 GTGAGTTCTCATAAATGCCCCGG + Intergenic
971576332 4:28280123-28280145 GTGGGTTCTCTTGGCTTTCCTGG - Intergenic
971906149 4:32728449-32728471 CTGGGTTCACAAAATTCTCCTGG - Intergenic
976256469 4:83105649-83105671 GTGGTTCCTCATAACTCTCATGG - Intronic
977387163 4:96356392-96356414 CTGGGTTCTTATAACCCCCCAGG + Intergenic
978037485 4:104013701-104013723 GGTGGTGCTCATATCTCTCCAGG - Intergenic
982829345 4:160041910-160041932 GTGGATTCTCTCAACTTTCCTGG - Intergenic
992417808 5:76568892-76568914 GAGGGTTCTCATACCTGTCTTGG + Intronic
996238073 5:121158664-121158686 GTGGGTTGGGATAACTCTTCTGG + Intergenic
1000600546 5:163269469-163269491 GTAGGTTCTCTTAGCTATCCAGG - Intergenic
1004051670 6:12086945-12086967 GTGTGTTTTTATAATTCTCCTGG - Intronic
1005244061 6:23861791-23861813 GTGGATTCTCTTAGCTTTCCTGG - Intergenic
1007739755 6:44003242-44003264 GTGAGGCCTCATAGCTCTCCTGG - Exonic
1009641859 6:66348724-66348746 GTGGGTTCACATAAATCTATTGG + Intergenic
1010973511 6:82288082-82288104 GAGAGTTCTCATGACTCTCCAGG + Intergenic
1013872512 6:114783022-114783044 GTGGGTTCACATTACTATCTGGG + Intergenic
1015850682 6:137568773-137568795 CTGGGTTCTGACAACTGTCCGGG - Intergenic
1016175829 6:141077072-141077094 GTGGATTCTCTTAGCTTTCCTGG - Intergenic
1023060006 7:36317751-36317773 GAGGGGTCTCATAGGTCTCCTGG + Intergenic
1025187912 7:56875387-56875409 GTGGTTTCTCTTATCTGTCCTGG + Intergenic
1025684010 7:63701537-63701559 GTGGTTTCTCTTATCTGTCCTGG - Intergenic
1025820519 7:64958743-64958765 GTGGGTTCTCTCAGCTTTCCTGG - Intergenic
1032991408 7:137398665-137398687 ATGGGATTTCATAATTCTCCTGG + Intronic
1035412042 7:158652274-158652296 GCGGGTACTCAGAACTCCCCAGG - Exonic
1035583203 8:753111-753133 CTGGCTTCTCAGAACCCTCCTGG - Intergenic
1039314075 8:36352645-36352667 GTGGATTCTCATATCTACCCTGG - Intergenic
1044390573 8:91645770-91645792 TTGGCTTCTCATAAGTGTCCAGG - Intergenic
1044788250 8:95819153-95819175 GTGGGTTCTCTCAGCTTTCCTGG + Intergenic
1045416852 8:101976112-101976134 GTGGGTTCTGGTAACTCTCCAGG + Intronic
1049569871 8:143364364-143364386 GTGGGTGCTCATGTCCCTCCTGG - Intergenic
1050195682 9:3080839-3080861 GTGTGTTCTCAGATTTCTCCAGG - Intergenic
1050230447 9:3519174-3519196 CTAGGTTTGCATAACTCTCCTGG - Intronic
1051437997 9:17053369-17053391 TTGGGTTCTCATATCAATCCTGG - Intergenic
1052517931 9:29507776-29507798 GTTAGTTTACATAACTCTCCTGG - Intergenic
1052771938 9:32697920-32697942 GTGGGTTCTCGTCACTAGCCTGG + Intergenic
1053607656 9:39677573-39677595 CTGGGTTCTCATAACTCCCTAGG - Intergenic
1053865500 9:42433928-42433950 CTGGATTCTCATAACTCCCTGGG - Intergenic
1054245878 9:62664833-62664855 CTGGGTTCTCATAACTCCCTAGG + Intergenic
1054560004 9:66699366-66699388 CTGGGTTCTCATAACTCCCTAGG + Intergenic
1060314568 9:122497209-122497231 GTGGATTCTCTTGACTTTCCTGG + Intergenic
1185776811 X:2809808-2809830 GTGGGCTCTCACATCCCTCCAGG + Intronic
1186480045 X:9889723-9889745 GTGGGTTGTCATGACTCCCTGGG + Intronic
1194380863 X:93190509-93190531 GTGGGTTCTCTTAGCTTTCCTGG - Intergenic
1199913597 X:152315093-152315115 GTGGGTTCTCTCAGCTTTCCTGG - Intronic
1200481680 Y:3711657-3711679 GTGGATTCTCTTAAGTGTCCAGG + Intergenic
1200792220 Y:7309683-7309705 GTGGGTTATCGTAACACTGCAGG - Intergenic