ID: 1168831459

View in Genome Browser
Species Human (GRCh38)
Location 20:847342-847364
Sequence TGAGCTCCAGTCTCATGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 196}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168831459_1168831462 -10 Left 1168831459 20:847342-847364 CCAGCTCATGAGACTGGAGCTCA 0: 1
1: 0
2: 0
3: 9
4: 196
Right 1168831462 20:847355-847377 CTGGAGCTCATGATACTGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 129
1168831459_1168831463 -9 Left 1168831459 20:847342-847364 CCAGCTCATGAGACTGGAGCTCA 0: 1
1: 0
2: 0
3: 9
4: 196
Right 1168831463 20:847356-847378 TGGAGCTCATGATACTGGTGGGG 0: 1
1: 0
2: 2
3: 18
4: 150
1168831459_1168831467 12 Left 1168831459 20:847342-847364 CCAGCTCATGAGACTGGAGCTCA 0: 1
1: 0
2: 0
3: 9
4: 196
Right 1168831467 20:847377-847399 GGAGACAAGCATGAGGAGGGTGG 0: 1
1: 0
2: 5
3: 56
4: 501
1168831459_1168831466 9 Left 1168831459 20:847342-847364 CCAGCTCATGAGACTGGAGCTCA 0: 1
1: 0
2: 0
3: 9
4: 196
Right 1168831466 20:847374-847396 TGGGGAGACAAGCATGAGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 450
1168831459_1168831465 8 Left 1168831459 20:847342-847364 CCAGCTCATGAGACTGGAGCTCA 0: 1
1: 0
2: 0
3: 9
4: 196
Right 1168831465 20:847373-847395 GTGGGGAGACAAGCATGAGGAGG 0: 1
1: 0
2: 1
3: 31
4: 317
1168831459_1168831464 5 Left 1168831459 20:847342-847364 CCAGCTCATGAGACTGGAGCTCA 0: 1
1: 0
2: 0
3: 9
4: 196
Right 1168831464 20:847370-847392 CTGGTGGGGAGACAAGCATGAGG 0: 1
1: 0
2: 4
3: 20
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168831459 Original CRISPR TGAGCTCCAGTCTCATGAGC TGG (reversed) Intronic
900603733 1:3514782-3514804 TGTGCTCCAGGCTGATGGGCTGG + Intronic
903792129 1:25901020-25901042 TCAGCTTCAGTCTCGTCAGCAGG + Intronic
904089106 1:27932004-27932026 AGGGCTCCACTCTCATGAGTGGG + Intergenic
905748318 1:40438524-40438546 TAAGCTCCAGTCTCCTGCGATGG - Intergenic
906665531 1:47618935-47618957 TGAGCTCCAGTCTCTTTATTTGG - Intergenic
909283337 1:73785361-73785383 TCAGCTTCAGTGTCAAGAGCAGG + Intergenic
910351982 1:86308337-86308359 TAAGCACCAGCTTCATGAGCAGG - Intergenic
912514253 1:110208188-110208210 TGAGCTCCCCTCTCCCGAGCTGG + Intergenic
916185807 1:162131710-162131732 TGAGCTCCAGTGTTATAAGGCGG + Intronic
919744824 1:201002182-201002204 TGGCCTCCTGGCTCATGAGCTGG + Exonic
920493487 1:206437582-206437604 TGAGAGCCAGTCTCAGGAGCTGG + Intronic
921056946 1:211549542-211549564 GGACCTGCAGTCTCATGAGGTGG - Intergenic
921717327 1:218431158-218431180 CTAGCTCCAGACTCATGAACAGG - Intronic
1064990372 10:21251668-21251690 GAAGCTCCACTCTCATGAACGGG + Intergenic
1067910329 10:50339909-50339931 TGAGCTTCAGGCTAAGGAGCTGG + Intronic
1068118723 10:52762514-52762536 TGAGCTTCAGTCTTATGATTGGG - Intergenic
1072668798 10:97414225-97414247 TGAGCTACAGTCACTTGAGGGGG - Intronic
1074454100 10:113582411-113582433 GGATCTCCAGTGTCTTGAGCAGG + Intronic
1075292206 10:121240340-121240362 GGAGGTCCGGTCTCCTGAGCAGG - Intergenic
1075448910 10:122533771-122533793 TGAGCCCAATTCTCATGACCTGG - Intergenic
1075655297 10:124157062-124157084 AGAGGACCTGTCTCATGAGCCGG - Intergenic
1076440280 10:130476753-130476775 GGGGCTCCACTCTCATGACCTGG + Intergenic
1078867716 11:15313224-15313246 TGAGCTCCACCCTCATGAATGGG + Intergenic
1079308173 11:19342944-19342966 TGACTTCCAGGCTCATGATCAGG + Intergenic
1081361829 11:42189726-42189748 TGAGCTCCAGTCTCCTCAGTTGG + Intergenic
1081826396 11:46057735-46057757 TGAGATCGGGTCTCATGAGAAGG + Intronic
1083142899 11:60736272-60736294 TGAGCTTCAGTCTCTTCATCTGG - Intronic
1084327880 11:68412127-68412149 TGAGCCTCATTCTCATGATCTGG - Intronic
1086405474 11:86495735-86495757 TAACCTCCTGTCTCCTGAGCTGG + Intronic
1087190686 11:95251066-95251088 TGATCTCCAATTTCATGGGCAGG + Intergenic
1089554622 11:119309622-119309644 GGAGCCCCAGTCTCCCGAGCGGG - Exonic
1089605475 11:119638890-119638912 TGAGCCCCACTCACAAGAGCAGG + Intronic
1089757202 11:120695726-120695748 TGAGATGCAGTGTCATTAGCAGG + Intronic
1090728697 11:129551229-129551251 TGAGTTCTTGTCTCATGACCAGG - Intergenic
1096599267 12:52717905-52717927 TGAGCACCCCTCTCCTGAGCTGG - Intergenic
1096782870 12:54000941-54000963 GGAGCTCCTCTCTCAGGAGCTGG + Intronic
1098764889 12:74474054-74474076 GAAGCTCCAGTTTCATGAGATGG + Intergenic
1099818273 12:87675950-87675972 AGGGCTCCAGTCTCATGATTGGG - Intergenic
1100887990 12:99093622-99093644 TGAGTTGCAGTCTCCTGAGAAGG + Intronic
1102077972 12:110074984-110075006 TGCTCTCCAGTCTCCTGAACTGG - Intergenic
1103464534 12:121131564-121131586 TGCTCTCCAGTCTCCTGAACTGG + Intergenic
1103994375 12:124819633-124819655 TCAGCTCTAGTCTAATGGGCTGG - Intronic
1104724207 12:131066113-131066135 GCAACTCCAGACTCATGAGCAGG + Intronic
1105265028 13:18808290-18808312 TGAGCAGCAGGCTCAGGAGCGGG - Intergenic
1105986446 13:25572081-25572103 TGGGCTTCAGTCTCTTCAGCTGG + Intronic
1110347892 13:74469403-74469425 TGACCTTCATTCTAATGAGCAGG + Intergenic
1111838609 13:93421128-93421150 TCAGCTGCAGCCTCATTAGCTGG + Intronic
1114102745 14:19393242-19393264 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1116558809 14:46349422-46349444 TGAGCTCAAGTTTCTTGTGCAGG - Intergenic
1118278115 14:64404220-64404242 TGAGCTCCAGGCTCTTGGTCTGG + Intronic
1118752032 14:68814621-68814643 CCACCTCCAGTCTCAAGAGCAGG + Intergenic
1118816374 14:69317138-69317160 GGATCTCCAGTCTCTTGAGCTGG + Intronic
1122844772 14:104486889-104486911 TGAGTCCCAGTGTCAGGAGCAGG - Intronic
1202837291 14_GL000009v2_random:87616-87638 TGAGCAGCAGGCTCAGGAGCAGG + Intergenic
1123552601 15:21397636-21397658 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1123553134 15:21400831-21400853 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1123588847 15:21835024-21835046 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1123589380 15:21838219-21838241 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1128763894 15:70239117-70239139 AGAGCTCCAGCCTCATGGGGAGG - Intergenic
1129226857 15:74175152-74175174 TGAGGTCCAGGCTCTTGAGATGG - Exonic
1130773591 15:86951731-86951753 TGAGCTCCACACTCATGATTTGG + Intronic
1130939612 15:88496847-88496869 TGATCTCCAGTCTCAAGGTCTGG + Intergenic
1131300357 15:91194313-91194335 TGAGGTCCAGAGGCATGAGCAGG - Intronic
1202960950 15_KI270727v1_random:124856-124878 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1202961483 15_KI270727v1_random:128051-128073 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1133843923 16:9436801-9436823 TGAGTTCTTGTCTCATGACCAGG - Intergenic
1135138044 16:19899106-19899128 TGAGCTCCACCCTCAGGAGGAGG - Intergenic
1139282365 16:65781579-65781601 TGAACCCAAGCCTCATGAGCAGG - Intergenic
1140990303 16:80204681-80204703 TGGCCTTCAGTCTGATGAGCTGG + Intergenic
1141834769 16:86531543-86531565 TGGGCTTCAGGCTCCTGAGCTGG - Exonic
1146473940 17:33146650-33146672 CGAGCTCCAGAGGCATGAGCTGG - Intronic
1152618754 17:81350364-81350386 TGTGCACCAGTTTCAGGAGCAGG + Intergenic
1152894476 17:82902902-82902924 GGGGCTCCAGCCTCTTGAGCCGG + Intronic
1154423365 18:14253254-14253276 TGAGCAGCAGGCTCAGGAGCGGG + Intergenic
1156814572 18:41294339-41294361 TGTGCCCCAGATTCATGAGCTGG - Intergenic
1157790889 18:50529903-50529925 TGAGCTCCTGACTCATGTGAGGG + Intergenic
1159082999 18:63756437-63756459 TTAGTTCCAGACTCATGTGCAGG + Intronic
1160778481 19:867369-867391 TGAGCTCCCGCCTCGCGAGCCGG + Intergenic
1161408776 19:4104756-4104778 TGTGCTGCAGCCTCAGGAGCTGG + Intronic
1161666503 19:5580226-5580248 TGAAATCCAGGCTCAAGAGCTGG - Intergenic
1161959679 19:7516530-7516552 TGAGCTCCAGACCCCAGAGCTGG - Intronic
1162344207 19:10110329-10110351 TGAGCTGCAGTGTCATCCGCGGG - Exonic
1164437285 19:28241660-28241682 TTAGCTCCAGTCTGGGGAGCTGG - Intergenic
1164642789 19:29838806-29838828 TGATCTCCAGGCTCATGCGAGGG - Intergenic
1165605777 19:37102370-37102392 TTAGCTCCAGCCTCCTCAGCTGG - Intronic
1165722820 19:38091703-38091725 TGAGCTCCTAACTCATGAGTGGG - Intronic
1202635352 1_KI270706v1_random:39735-39757 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1202649622 1_KI270706v1_random:168914-168936 TGAGCAGCAGGCTCAGGAGCAGG + Intergenic
925290794 2:2747443-2747465 GGAGCCCTAGTTTCATGAGCAGG + Intergenic
927470801 2:23374936-23374958 TGAGCTCAAGTCTCCTGGCCAGG - Intergenic
928360221 2:30656514-30656536 TGAGCTTCAGTTTCCTCAGCTGG + Intergenic
936021251 2:108996614-108996636 TGGGCTCCATGCTCATGGGCAGG - Intergenic
936081388 2:109434947-109434969 AGTGCTCCAGTGTCAGGAGCTGG - Intronic
938281372 2:130065847-130065869 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
938435056 2:131277927-131277949 TGAGCAGCAGGCTCAGGAGCAGG + Intronic
939984372 2:148815413-148815435 TCAGCTCCTGTTTCCTGAGCAGG + Intergenic
941425681 2:165341889-165341911 TTAGCACCAGTCTCATCTGCAGG + Intronic
944683797 2:202100129-202100151 AGAGCCCCAGTCTCCTGATCTGG - Intronic
946879618 2:224163958-224163980 TGAGCTCCTTTCTTATGACCAGG - Intergenic
948165283 2:235856615-235856637 TGAGCCCCAGTCACAGGAACTGG - Intronic
948229659 2:236340855-236340877 TGAGGTGCAGTCCCATGAACAGG + Intronic
948831117 2:240598698-240598720 CGGGCTCCAGTCACCTGAGCTGG - Exonic
1168754872 20:309474-309496 TGAACTTCAGTTTCCTGAGCAGG + Intergenic
1168831459 20:847342-847364 TGAGCTCCAGTCTCATGAGCTGG - Intronic
1169001673 20:2172473-2172495 TGAGCTCTGGTCTCTTGAGCTGG + Intronic
1169426597 20:5502015-5502037 TGAGCCCCAGTTTCACGAGGGGG + Intergenic
1170924074 20:20706862-20706884 TGAGCTTCAGTTTCCTCAGCTGG + Intronic
1171881495 20:30620900-30620922 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1171881862 20:30622985-30623007 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1173809857 20:45949105-45949127 TGAGCTGGAGGCTCAAGAGCTGG + Intronic
1174141344 20:48416116-48416138 TGAGCTCCTGCCTCATGAAAGGG - Intergenic
1175297352 20:57918122-57918144 TGAGCTGCAGACTCATGACAGGG - Intergenic
1175561071 20:59932081-59932103 TGGGCTCCAGTCTACTGAACTGG + Exonic
1176412747 21:6457816-6457838 TGAGCTGCAGCCGCATGTGCTGG - Intergenic
1176602200 21:8803633-8803655 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1176626027 21:9092545-9092567 TGAGCAGCAGGCTCAGGAGCAGG + Intergenic
1176820346 21:13650348-13650370 TGAGCAGCAGGCTCAGGAGCAGG + Intergenic
1178864959 21:36319887-36319909 TGAACTCCAGTCACTTGACCTGG - Intergenic
1178919368 21:36728615-36728637 TGAGCTGCAGTCACATGGGAGGG + Intronic
1179688241 21:43066138-43066160 TGAGCTGCAGCCGCATGTGCTGG - Intronic
1180117352 21:45719047-45719069 TGACCTCCCGTCCCATTAGCTGG - Intronic
1180344485 22:11695184-11695206 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1180365356 22:11933492-11933514 TGAGCAGCAGGCTCAGGAGCAGG + Intergenic
1180722815 22:17922044-17922066 TGAGCTGCAGTCTCAAGTGCAGG - Intronic
1180993669 22:19953828-19953850 TGAGCTCCTGCCACATGAGCAGG + Intronic
1184751741 22:46490219-46490241 TTGGCTCCTGTCTCATGAGATGG - Intronic
956891909 3:73622239-73622261 TCAGCTGCAGTCTCAGCAGCTGG - Intronic
957014498 3:75047217-75047239 TGAGCTTGAGTCCCTTGAGCAGG - Intergenic
958750013 3:98184441-98184463 TGAGCTACAGTTTCATGACGTGG + Intronic
963603475 3:147396155-147396177 TGAGCTCCTGTTTGATGGGCTGG + Exonic
964762257 3:160145708-160145730 CAAGCTCCAATCTCATGACCTGG + Intergenic
967763150 3:193247564-193247586 TGGGCTCTTGTCTCATGACCAGG - Intronic
970528444 4:16956749-16956771 TGAGCTTCAGTTTCATAAACTGG - Intergenic
973365525 4:49205440-49205462 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
973395069 4:49587014-49587036 TGAGCAGCAGGCTCAGGAGCAGG + Intergenic
974568978 4:63619294-63619316 TGATCTGCAGACTCATGAGATGG - Intergenic
977667265 4:99655427-99655449 TGAGCTGCAGCCTCATGATTCGG + Intergenic
977979871 4:103308455-103308477 GGAGCTCCAGTATCCTGCGCTGG - Intergenic
978167054 4:105622048-105622070 GGACTTCCAGTCTCCTGAGCGGG + Intronic
980774933 4:137425430-137425452 TCAGCTTCAGTCTCATCAACAGG + Intergenic
984589542 4:181601717-181601739 TGAGCTCCAGTCTAACGTGACGG - Intergenic
1202762662 4_GL000008v2_random:125615-125637 TGAGCAGCAGACTCAGGAGCAGG - Intergenic
986108126 5:4680338-4680360 TAAGCTTCAGTCCCATGATCTGG + Intergenic
986252164 5:6070602-6070624 TGAGATGCAGACTCATGGGCTGG + Intergenic
986282231 5:6333068-6333090 TGAACTGAAGTCCCATGAGCAGG - Intergenic
986609043 5:9548433-9548455 TGAGCTACAGTCTCTTCACCTGG + Intergenic
994019455 5:95005891-95005913 TGGGCTCCAGCCTCCTGAACTGG - Intronic
995780536 5:115770537-115770559 TGAGCTCCAGCCTAAGGAGAAGG + Intergenic
1001022932 5:168198907-168198929 TGCGCTCCTGGCTCATGAACGGG - Exonic
1006385861 6:33730559-33730581 TCAGCCCCTGTCTCACGAGCAGG - Intronic
1007099437 6:39235212-39235234 TGAGATGGAGTCTCATGAGGTGG + Intergenic
1007118304 6:39360259-39360281 TGAGCACCTGCTTCATGAGCAGG + Intronic
1008640545 6:53458132-53458154 TGAACCCCAGTGTCATCAGCTGG + Intergenic
1009735950 6:67675731-67675753 TGAGCTCTTGTCTCATGACCAGG + Intergenic
1010004699 6:70983064-70983086 AGAGCTCCAATCTCATGAATTGG + Intergenic
1010018695 6:71135150-71135172 TGAGCTGCACTCTCTGGAGCTGG - Intergenic
1012710117 6:102588841-102588863 TGAGATCCAGTCTCATAACAAGG - Intergenic
1014696075 6:124622874-124622896 TGAACTCCAGGCTCCAGAGCAGG - Intronic
1018603606 6:165574410-165574432 TGAGCTCCACTCACCTGAGTGGG - Intronic
1019469578 7:1211599-1211621 AGAACTCCGTTCTCATGAGCAGG + Intergenic
1021970713 7:25963100-25963122 GTAGCTCCAGTCTCATGGGGAGG - Intergenic
1022479267 7:30732633-30732655 TGAGCTACAGTGACAAGAGCTGG - Intronic
1023981661 7:45074038-45074060 GCAGCTCCACTCTCCTGAGCTGG - Intronic
1024049250 7:45608568-45608590 TGAGCTCCAGTCTCCCATGCTGG + Intronic
1024143868 7:46491170-46491192 TGAACTCCATTCAAATGAGCTGG + Intergenic
1024696841 7:51866678-51866700 TGAGCACCAAGCTGATGAGCTGG + Intergenic
1031330097 7:120453385-120453407 GGACCACCAGTGTCATGAGCTGG - Intronic
1033338857 7:140476681-140476703 TCAGTTCCAGTATCATGAACAGG - Intronic
1033359311 7:140626805-140626827 TCAGCTCCATTCTCTTGTGCTGG - Intronic
1034558384 7:151864150-151864172 TGACCTCCAGCCTCAAGAGCAGG + Intronic
1035623391 8:1052138-1052160 TGAACTCCCGTGTCATGAGGTGG + Intergenic
1036035415 8:5013344-5013366 TGAGCTCAAGTGGCATGACCGGG - Intergenic
1036486317 8:9182623-9182645 TGAGCCCCAGTCTCATCATGTGG - Intergenic
1037453798 8:19043662-19043684 AGAGCTCCACACTCATGAGTGGG + Intronic
1037671112 8:21016125-21016147 TGATCTCCAGGCTCTGGAGCTGG - Intergenic
1038057442 8:23874191-23874213 AGAGCTCCAGTTCCCTGAGCAGG + Intergenic
1039307385 8:36277491-36277513 TGAGTGCCAGGATCATGAGCTGG - Intergenic
1039436464 8:37562818-37562840 CCAGCTCAAGTCTCATGGGCAGG + Intergenic
1040101971 8:43513545-43513567 TGAGCAGCAGGCTCAGGAGCAGG + Intergenic
1043690891 8:83150124-83150146 TGGGTTCCTGTCTCATGACCAGG - Intergenic
1048698028 8:137050329-137050351 TGTGCTGTAGTCTGATGAGCAGG - Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1050205138 9:3188225-3188247 AGAGCTCCAGGCTGATGATCAGG - Intergenic
1050602743 9:7269178-7269200 AGAGAGCCAGCCTCATGAGCTGG - Intergenic
1052059864 9:23946514-23946536 TGAGTTCCTGTCTCATGACCAGG + Intergenic
1052877246 9:33576119-33576141 TGAGCAGCAGGCTCAGGAGCAGG + Intergenic
1053498756 9:38568275-38568297 TGAGCAGCAGGCTCAGGAGCAGG - Intronic
1053662431 9:40293030-40293052 TGAGCAGCAGCCTCAGGAGCAGG + Intronic
1053912882 9:42923185-42923207 TGAGCAGCAGGCTCAGGAGCAGG + Intergenic
1054374562 9:64439256-64439278 TGAGCAGCAGCCTCAGGAGCAGG + Intergenic
1054522179 9:66083254-66083276 TGAGCAGCAGCCTCAGGAGCAGG - Intergenic
1055994738 9:82145251-82145273 AGAGAACCAGTCTCATGAGATGG + Intergenic
1056950393 9:91036653-91036675 TGGCCTGCACTCTCATGAGCGGG - Intergenic
1057161813 9:92894573-92894595 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1057678209 9:97152768-97152790 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1060604087 9:124898863-124898885 ATACATCCAGTCTCATGAGCAGG + Intronic
1203526903 Un_GL000213v1:98573-98595 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1203527014 Un_GL000213v1:99203-99225 TGAGCAGCAGGCTCAGGAGCAGG - Intergenic
1203543425 Un_KI270743v1:110496-110518 TGAGCAGCAGACTCAGGAGCAGG - Intergenic
1189908142 X:45783026-45783048 TGAGCAGCACTCCCATGAGCAGG + Intergenic
1199486753 X:148356880-148356902 TGGGCTCCACTCTCATGAATGGG - Intergenic
1200827626 Y:7660293-7660315 TGTCCTCCTGTCTCATGGGCTGG - Intergenic
1200975481 Y:9208015-9208037 TAAGTACCAGTCTCATTAGCTGG - Intergenic
1201562513 Y:15333110-15333132 TGAGCCCCAGGCTCATGAATCGG - Intergenic
1202107388 Y:21385307-21385329 TGTCCTCCTGTCTCATGGGCTGG - Intronic
1202199554 Y:22331813-22331835 TGTCCTCCTGTCTCATGGGCTGG + Intronic