ID: 1168831487

View in Genome Browser
Species Human (GRCh38)
Location 20:847465-847487
Sequence TCCCCATGCTGAAGGAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 188}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168831477_1168831487 16 Left 1168831477 20:847426-847448 CCCAGCAGTTTTGACAATGCAGG 0: 1
1: 0
2: 3
3: 7
4: 128
Right 1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG 0: 1
1: 0
2: 1
3: 25
4: 188
1168831479_1168831487 15 Left 1168831479 20:847427-847449 CCAGCAGTTTTGACAATGCAGGA 0: 1
1: 0
2: 2
3: 10
4: 128
Right 1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG 0: 1
1: 0
2: 1
3: 25
4: 188
1168831475_1168831487 25 Left 1168831475 20:847417-847439 CCCATGGTGCCCAGCAGTTTTGA 0: 1
1: 0
2: 1
3: 6
4: 140
Right 1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG 0: 1
1: 0
2: 1
3: 25
4: 188
1168831474_1168831487 26 Left 1168831474 20:847416-847438 CCCCATGGTGCCCAGCAGTTTTG 0: 1
1: 0
2: 2
3: 10
4: 147
Right 1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG 0: 1
1: 0
2: 1
3: 25
4: 188
1168831476_1168831487 24 Left 1168831476 20:847418-847440 CCATGGTGCCCAGCAGTTTTGAC 0: 1
1: 0
2: 0
3: 17
4: 242
Right 1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG 0: 1
1: 0
2: 1
3: 25
4: 188
1168831472_1168831487 28 Left 1168831472 20:847414-847436 CCCCCCATGGTGCCCAGCAGTTT 0: 1
1: 0
2: 1
3: 20
4: 196
Right 1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG 0: 1
1: 0
2: 1
3: 25
4: 188
1168831473_1168831487 27 Left 1168831473 20:847415-847437 CCCCCATGGTGCCCAGCAGTTTT 0: 1
1: 0
2: 4
3: 34
4: 399
Right 1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG 0: 1
1: 0
2: 1
3: 25
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168831487 Original CRISPR TCCCCATGCTGAAGGAGTGA TGG Intronic
900188294 1:1343027-1343049 TCCCCATGCTGGGGGGGTGGGGG - Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
904326871 1:29732184-29732206 TCCCAGTACTGAAGGGGTGAAGG - Intergenic
904334404 1:29787489-29787511 TCCTAATGCTGAAGGACCGAAGG + Intergenic
906545814 1:46618701-46618723 ACCCCAGGCTGCAGGAGTGTGGG + Intergenic
908924044 1:69231546-69231568 TCAACATGCTGTAGGAGTCAGGG - Intergenic
909681967 1:78301594-78301616 TTCCCATGCTGCAGCAGAGATGG - Intergenic
910473310 1:87578610-87578632 ACCCCTTGGTGAAGGGGTGAGGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913456986 1:119042927-119042949 TAAGCATGCTGAAGCAGTGAGGG + Intronic
913531568 1:119737564-119737586 TCCACATGCCGTGGGAGTGAAGG + Intronic
915653422 1:157336771-157336793 TGCCCAGGCTGGAGGTGTGAGGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915797422 1:158751938-158751960 CCCCCAGGCTGTAGGTGTGAAGG + Intergenic
916538641 1:165729980-165730002 TCTTCATGATGAAGGATTGAGGG - Intronic
922053003 1:222012210-222012232 TGCCACTGCTGAAGGAGTGAAGG - Intergenic
1064087955 10:12359584-12359606 TGCCCAGGCTGATGGAGAGAGGG - Intronic
1065614672 10:27507667-27507689 TTCCCATGCAGAAGTAGAGATGG - Intronic
1070305465 10:75236383-75236405 GCATCAGGCTGAAGGAGTGAGGG + Intergenic
1071499055 10:86190576-86190598 TCCCCATCCTGCAGGTGTGCAGG + Intronic
1072019557 10:91384401-91384423 TCTCCATGCTGTGGGAGTGTGGG + Intergenic
1072695764 10:97601768-97601790 TCCCCAGGCTGAAGAGGTGCTGG + Intronic
1072799345 10:98382241-98382263 TCCTGATGCTGAATGAGGGAGGG + Intergenic
1073793250 10:106960964-106960986 TCCCTATCCAGAAGGAGTGAGGG - Intronic
1074006001 10:109424251-109424273 TCCCCAGGCTCAAGAAGTTAAGG + Intergenic
1075730189 10:124631298-124631320 TCCGGAGGCTGAAGGAGTGGGGG + Intronic
1076447206 10:130524843-130524865 TCACCAAGCTGAAGGACTGAGGG - Intergenic
1076940460 10:133603521-133603543 ACACCATGCTGCTGGAGTGAAGG - Intergenic
1077044378 11:537926-537948 CCCCCATGGTGAAGGGGCGAGGG + Intronic
1080223683 11:29935612-29935634 TCACCAGGCAGAGGGAGTGAGGG - Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081992299 11:47344364-47344386 TCCCCATGCTGCTGCAGTGGGGG + Intronic
1083330730 11:61897259-61897281 GCCCCAGGGTGCAGGAGTGAGGG + Intergenic
1084473627 11:69376842-69376864 TCCCCAGGGTGAAGGCGAGAGGG - Intergenic
1084679187 11:70656139-70656161 GCCCCATGTTGTGGGAGTGAAGG + Intronic
1084734409 11:71095023-71095045 TTCCCGTACAGAAGGAGTGACGG + Intronic
1085700999 11:78746228-78746250 ACCCCCTCCTCAAGGAGTGATGG - Intronic
1086147045 11:83563338-83563360 TCCCCTTACTGAAGTAGTGAAGG + Intronic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1089322136 11:117633614-117633636 CCCACATGCTGAAGGATTGAGGG - Intronic
1091461127 12:643948-643970 TCCCTCTGCAGATGGAGTGAAGG + Intronic
1095554111 12:43480788-43480810 TCCACATGCTGAGGGAGTGTGGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098079432 12:66768535-66768557 CCAGCAGGCTGAAGGAGTGAAGG + Intronic
1099467495 12:83005535-83005557 TCCCCATGCTCTGAGAGTGACGG + Intronic
1101650406 12:106672364-106672386 TGCCCAGGCTGAAAGAGAGAAGG + Intronic
1102874335 12:116437987-116438009 ACATCATGCTGAAGAAGTGAAGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1111330851 13:86761075-86761097 GCCCCCTGCTGTAGTAGTGAAGG + Intergenic
1113368962 13:109705517-109705539 TCCACAGGCTGAAGGAGGCAAGG + Intergenic
1113720352 13:112551522-112551544 TCCAGTTGCTGAAGGAGTGATGG - Intronic
1118684785 14:68280627-68280649 ACCCTATTCTAAAGGAGTGAAGG - Intronic
1118814182 14:69298326-69298348 TCTACAAGCTGAAGGAGGGAGGG - Intronic
1119436265 14:74599811-74599833 TGCCCATGCTCAGGGAGTGCTGG - Intronic
1119512367 14:75221544-75221566 TCCCCATGCTGAGGGTTTCAGGG + Intergenic
1119636461 14:76277530-76277552 TATCCATGATGAAGGAATGATGG - Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121335715 14:93076504-93076526 GCCCAATGCTGGAGGAGAGAAGG + Intronic
1121751830 14:96363643-96363665 TCCCCATCCGGAAGGCCTGACGG - Exonic
1122344520 14:101050237-101050259 TCTCCATCGGGAAGGAGTGAAGG - Intergenic
1122566079 14:102657305-102657327 TCCTCATGTTCAAGGAGTAATGG + Intronic
1122875468 14:104662309-104662331 TCTCCATGCGGGCGGAGTGACGG + Intergenic
1122896695 14:104761092-104761114 TCCCCAGGCAGAAGGAGCGAGGG - Intronic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1123476006 15:20592937-20592959 CCCTCAGGCTGGAGGAGTGATGG - Intergenic
1123642005 15:22407426-22407448 CCCTCAGGCTGGAGGAGTGATGG + Intergenic
1124554606 15:30712813-30712835 TCCCCTGGCTGAAAGAATGAAGG - Intronic
1124676642 15:31692867-31692889 TCCCCTGGCTGAAAGAATGAAGG + Intronic
1127331467 15:57943964-57943986 TCCCCCTGCAGGAGGAGAGAGGG + Intergenic
1129178785 15:73858619-73858641 TGGAAATGCTGAAGGAGTGATGG - Intergenic
1129616284 15:77100984-77101006 GCCCCTTGCTGAGGGAGGGAGGG + Exonic
1135702341 16:24643230-24643252 GCCCCATGCAGAAGGAAGGAAGG + Intergenic
1136449881 16:30347870-30347892 TCCTCATGCCGGAGGAATGAGGG - Intergenic
1136750091 16:32627468-32627490 CCCACATGCTGAGGGTGTGATGG + Intergenic
1141127068 16:81408434-81408456 TCCCCAGCCTGCAGGAGTCAGGG - Intergenic
1203052219 16_KI270728v1_random:886667-886689 CCCACATGCTGAGGGTGTGATGG + Intergenic
1144713891 17:17421067-17421089 GTCCCAGGCAGAAGGAGTGAAGG + Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146740931 17:35282939-35282961 TCCCTCTGATGAAGGACTGAGGG - Intergenic
1149263976 17:54907794-54907816 ACCCCATGCTGAAATAGAGAAGG - Intronic
1150063401 17:62088323-62088345 TCCCCATCCTGGTGGGGTGACGG - Intergenic
1152514610 17:80816053-80816075 TCCTCTGGCTGGAGGAGTGAGGG - Intronic
1158692956 18:59677712-59677734 TCCCCAGGATGACAGAGTGAAGG + Intronic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1160733501 19:651604-651626 TCCCCACGCTGGAAGGGTGAGGG - Exonic
1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG + Intronic
1162797567 19:13094790-13094812 TCCCCGGGCTGGAGGAGAGAAGG - Exonic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165376953 19:35449635-35449657 TCCGCATCCTGAAGGAGAGCTGG + Intronic
1166753028 19:45173775-45173797 TCCCCAGGAGGAAGGAGTGAGGG + Intronic
925210897 2:2045088-2045110 CCCCCACACTGAAGGAATGAAGG + Intronic
925592938 2:5527998-5528020 TTCCATTGCTGAAGGAGTGAGGG + Intergenic
925593133 2:5529566-5529588 TTCCATTGCTGAAGGAGTGAGGG - Intergenic
926007794 2:9386045-9386067 GCACCATGCTGAAGGACAGATGG - Intronic
926742559 2:16124937-16124959 GCCACATTCTGAAGTAGTGAGGG - Intergenic
927714513 2:25342928-25342950 CCCCCACGGTGAAGGGGTGAGGG - Intergenic
929802139 2:45113073-45113095 GCCCCATGCTGTAGGAGCCAAGG - Intergenic
929897048 2:45969645-45969667 CCCTCATGCTGCAGGAGTGGGGG - Intronic
930066248 2:47329896-47329918 TCCTCATGCTGTATGAGTGCAGG + Intergenic
930674588 2:54187177-54187199 TCCCCCTTCTGAAGGACAGAAGG + Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
935697228 2:105780769-105780791 CTCACATGCTGAAGGGGTGAGGG - Intronic
938783070 2:134602844-134602866 TCCCCAGGGAGAAGGAGGGACGG - Intronic
940372224 2:152916347-152916369 TCCCCCTGCTAGAGGAATGAGGG + Intergenic
941725795 2:168858773-168858795 TTCCCATGCTGGAGGTGTGGGGG + Intronic
947469283 2:230385788-230385810 TGCCCAGGCTGAAGGAGGGAAGG - Intronic
947838544 2:233192096-233192118 TCCCCAAGCTGCAGGAGGGGTGG + Intronic
947934086 2:233988400-233988422 TCGCCATTCTCAAGGAGAGAAGG - Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG + Intronic
1171947371 20:31390308-31390330 TCCCGAAGCTGCAGGAGAGAAGG + Intronic
1173422994 20:42919145-42919167 TCCCCAGGCTGGAGGGGTGATGG - Intronic
1176292523 21:5053817-5053839 TCCCCCAGCTGCAGGGGTGAGGG + Intergenic
1178027260 21:28482529-28482551 GTCACATGCTGAAGGACTGAAGG - Intergenic
1178284678 21:31315636-31315658 TGCCCAGGCTGGAGGAGTGCAGG - Intronic
1179189212 21:39108707-39108729 AGCCCTTGCTGAATGAGTGAAGG + Intergenic
1179864735 21:44209833-44209855 TCCCCCAGCTGCAGGGGTGAGGG - Intergenic
1181763318 22:25072941-25072963 GGCCCATGCTGAAGAAATGATGG - Intronic
1182698127 22:32209924-32209946 TGCCCATGGTGAGGGGGTGAGGG - Intergenic
1184590039 22:45476093-45476115 TCCCGGTGCTGCAGGAGGGAGGG + Intergenic
1184762477 22:46552349-46552371 TCACCTTGCAGAAGGCGTGAAGG - Intergenic
949534236 3:4983460-4983482 TGCCCATGCTGGAGAAGTGCTGG + Exonic
950633553 3:14299550-14299572 TCTCCCTGCTGAAGGTGTAAGGG + Intergenic
954111037 3:48433278-48433300 GACCCATGCTGAATGAATGAAGG + Intronic
954751867 3:52818373-52818395 TCTCGATGTTGAAGTAGTGAGGG - Exonic
955466595 3:59243418-59243440 TCACAAGGCAGAAGGAGTGAGGG - Intergenic
956150952 3:66241786-66241808 AACCTATGCTGCAGGAGTGAGGG + Intronic
957169534 3:76720157-76720179 TCCCATGGCTGAAGGAGTGAGGG - Intronic
961305156 3:125953783-125953805 TCCCTCTGCTGAAGGAGGGCGGG + Intergenic
961339578 3:126209035-126209057 TGCCCATGCAGAAGGCGTCAAGG + Intergenic
961351065 3:126303428-126303450 TCTAAATGCTGAAGGAGTGGAGG - Intergenic
962932396 3:140050471-140050493 TCCCCAGGCTGAAGGAGAAGTGG + Intronic
967227309 3:187304135-187304157 TCCCCAAGCAAAAGGAATGAAGG - Intergenic
971397287 4:26240527-26240549 TACCCGTGCTGAAGTAGGGAAGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975432807 4:74314805-74314827 TTGCCATCCTTAAGGAGTGATGG + Exonic
975559582 4:75696472-75696494 TCCACATGGTGAAGGACTGTTGG - Intronic
976517373 4:85984428-85984450 TCACTTGGCTGAAGGAGTGAAGG + Intronic
978105424 4:104896365-104896387 ACGCCATGCTGAATGAGGGACGG - Intergenic
981478084 4:145208525-145208547 CCCCCATTCTGAATGAATGATGG + Intergenic
983747872 4:171224071-171224093 TCTCCTTGCTGTAGGAGAGACGG + Intergenic
984905111 4:184619234-184619256 ACCCCATGCTGGAGAAGTGATGG - Intergenic
985808943 5:2069055-2069077 TCCCCCTGCTGCAGGGGTGCAGG + Intergenic
986308175 5:6531094-6531116 GCCCCATGGAGCAGGAGTGAAGG - Intergenic
986757688 5:10853514-10853536 TCCACATCCTGCAGGAGTGAGGG + Intergenic
987273956 5:16342413-16342435 TACCCATGCTGGAGGAGCAATGG - Intergenic
987311221 5:16682907-16682929 TGCCCAGCCTGGAGGAGTGAAGG + Intronic
988957866 5:36337192-36337214 TCCCCTTTCTCAAGGAGCGAGGG - Intergenic
991601278 5:68353736-68353758 CCCCCATGCTGTTGGAGTGGGGG + Intergenic
1001991853 5:176123487-176123509 TCCACACGCTGAGGGTGTGATGG + Intronic
1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG + Intergenic
1002200540 5:177525338-177525360 TACCCACCCTGCAGGAGTGAGGG + Intronic
1002225020 5:177714665-177714687 TCCACACGCTGAGGGTGTGATGG - Intronic
1002542837 5:179917515-179917537 TCCGCCTGCTGCAGGTGTGATGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003854266 6:10256298-10256320 TCCCCCTGGTGGAGGCGTGAGGG - Intergenic
1004292677 6:14382748-14382770 TGCCCATGCAGAAGGAGGGCAGG - Intergenic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005844931 6:29769805-29769827 TTCCCTTGCTGAAAGACTGAGGG - Intergenic
1005862874 6:29914755-29914777 TTCCTTTGCTGAAGGACTGAGGG - Intergenic
1005980827 6:30835309-30835331 TTCCCAGGCTGAAGGATTGCTGG + Intergenic
1006645757 6:35512947-35512969 TCCCCCTGCTCAAGGAGTGGAGG + Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007165505 6:39825989-39826011 TCCCCATGGTGCAGGTGTGTTGG + Intronic
1010029372 6:71257264-71257286 TCCCAAGGCTGCAGGAGGGAGGG + Intergenic
1011550501 6:88527474-88527496 TCCCAATGCTGAGGGAGGGAAGG + Intergenic
1013212923 6:108002808-108002830 TCCCTATGGGGAAGGAGGGAGGG - Intergenic
1014366500 6:120549778-120549800 TCCCCAAGCTGAATCAGAGAGGG + Intergenic
1018174074 6:161164042-161164064 TCCCTATGCTGCAGGTGGGATGG + Intronic
1022104214 7:27186669-27186691 TCCCCATCCTGCAGGATTGAAGG + Intergenic
1022426001 7:30269361-30269383 TCCAAATACTGAAGGAGAGATGG - Intergenic
1023118630 7:36887007-36887029 TCCCCTTGCTGTAGGAGAGCTGG - Intronic
1024200851 7:47104161-47104183 TCCCCACGCGGAAGGGGAGAGGG + Intergenic
1029099523 7:98117116-98117138 TCCCCATGGTGTACGAGTGCAGG + Intronic
1029114995 7:98232207-98232229 TCCCCATGCAGAAGGCGGGATGG - Intronic
1030978425 7:116156085-116156107 TCCTGATGCTGAAGGAGTCCTGG + Intronic
1032574629 7:133040256-133040278 TATCCCTACTGAAGGAGTGAAGG + Intronic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1034678177 7:152907562-152907584 TCCCCAGTCAGAAGGGGTGAGGG - Intergenic
1035287615 7:157816314-157816336 GCCCCAGGGTGAATGAGTGATGG + Intronic
1036518223 8:9465988-9466010 TCCCCGTGCTGTATGACTGAGGG - Intergenic
1037560164 8:20066194-20066216 GCCCCATGTGAAAGGAGTGATGG - Intergenic
1037804791 8:22053290-22053312 GCAGCATGCTGAAGGAGTGGAGG + Intronic
1039839200 8:41281363-41281385 CCCCCATGCTGAGGGAGTGAGGG - Intronic
1041026235 8:53689549-53689571 ACCCCATCCTCAAGGAGAGAAGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1041780088 8:61568440-61568462 TTCCCATTCTCAAGGAATGACGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043499087 8:80835495-80835517 TCCACATGCTGCAAGAGAGAAGG + Intronic
1044609830 8:94080522-94080544 CCCCCGTGCTGATGGATTGATGG - Intergenic
1045302206 8:100921440-100921462 GGCCCATGCTGAAGGAGCTAGGG + Intronic
1049047844 8:140166628-140166650 TCCTCATGCTGGAGGAGTGGAGG - Intronic
1049089230 8:140501695-140501717 TTCACATGCTGAAGGAATTATGG + Intergenic
1051343524 9:16132188-16132210 TGGCCACGCTGAAGGAGTGTGGG - Intergenic
1053488690 9:38483103-38483125 TCCACGGGCTGAAGGACTGAGGG - Intergenic
1056581269 9:87889315-87889337 CCCTCAGGCTGGAGGAGTGATGG + Intergenic
1057669043 9:97072383-97072405 TCCACGGGCTGAAGGACTGAGGG - Intergenic
1057887301 9:98839712-98839734 CCCGCCTGCTGATGGAGTGAAGG - Intronic
1060157122 9:121327538-121327560 CCCCCAAGCTGAAGGAAAGAAGG - Intronic
1062637593 9:137499723-137499745 TCCCCAGGCTGAAGCAGCAACGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187553794 X:20332056-20332078 TCCCCATGGAAAAGGAATGAGGG - Intergenic
1189004225 X:36979166-36979188 TCCCCTAACTGAAGTAGTGAGGG - Intergenic
1192078977 X:68029652-68029674 ACCCCATGGTGAAGGTGAGAGGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1198237766 X:134751645-134751667 TACCAATGCTGAAGAAGTGTTGG + Intronic
1198317093 X:135478842-135478864 TCACCATGCTGAAGTGTTGATGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201146783 Y:11069081-11069103 TTCCCATGCTGGAAGAGTGCTGG - Intergenic
1201340714 Y:12930327-12930349 TCCACATGATGAGGGATTGAAGG + Intergenic