ID: 1168832697

View in Genome Browser
Species Human (GRCh38)
Location 20:855509-855531
Sequence CTGGACATACAGTTGGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 191}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168832697_1168832709 19 Left 1168832697 20:855509-855531 CCAAGCACCAACTGTATGTCCAG 0: 1
1: 0
2: 2
3: 17
4: 191
Right 1168832709 20:855551-855573 GGGGAGTTCGTTCCTGGGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 185
1168832697_1168832701 -1 Left 1168832697 20:855509-855531 CCAAGCACCAACTGTATGTCCAG 0: 1
1: 0
2: 2
3: 17
4: 191
Right 1168832701 20:855531-855553 GTACAGAGCCAGCTGCTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 229
1168832697_1168832708 18 Left 1168832697 20:855509-855531 CCAAGCACCAACTGTATGTCCAG 0: 1
1: 0
2: 2
3: 17
4: 191
Right 1168832708 20:855550-855572 AGGGGAGTTCGTTCCTGGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 152
1168832697_1168832700 -2 Left 1168832697 20:855509-855531 CCAAGCACCAACTGTATGTCCAG 0: 1
1: 0
2: 2
3: 17
4: 191
Right 1168832700 20:855530-855552 AGTACAGAGCCAGCTGCTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 220
1168832697_1168832705 14 Left 1168832697 20:855509-855531 CCAAGCACCAACTGTATGTCCAG 0: 1
1: 0
2: 2
3: 17
4: 191
Right 1168832705 20:855546-855568 CTCCAGGGGAGTTCGTTCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 86
1168832697_1168832704 13 Left 1168832697 20:855509-855531 CCAAGCACCAACTGTATGTCCAG 0: 1
1: 0
2: 2
3: 17
4: 191
Right 1168832704 20:855545-855567 GCTCCAGGGGAGTTCGTTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 88
1168832697_1168832702 0 Left 1168832697 20:855509-855531 CCAAGCACCAACTGTATGTCCAG 0: 1
1: 0
2: 2
3: 17
4: 191
Right 1168832702 20:855532-855554 TACAGAGCCAGCTGCTCCAGGGG 0: 1
1: 0
2: 1
3: 45
4: 747
1168832697_1168832707 17 Left 1168832697 20:855509-855531 CCAAGCACCAACTGTATGTCCAG 0: 1
1: 0
2: 2
3: 17
4: 191
Right 1168832707 20:855549-855571 CAGGGGAGTTCGTTCCTGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 127
1168832697_1168832710 20 Left 1168832697 20:855509-855531 CCAAGCACCAACTGTATGTCCAG 0: 1
1: 0
2: 2
3: 17
4: 191
Right 1168832710 20:855552-855574 GGGAGTTCGTTCCTGGGAGGGGG 0: 1
1: 0
2: 2
3: 23
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168832697 Original CRISPR CTGGACATACAGTTGGTGCT TGG (reversed) Intronic
900027696 1:292289-292311 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900041651 1:471731-471753 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900063086 1:706708-706730 CTGGACAAACAGAGTGTGCTGGG - Intergenic
903788846 1:25878872-25878894 CTGGACAGACAGGTCTTGCTGGG + Intergenic
905410992 1:37767707-37767729 CTGGACATTCAGTTAGACCTCGG + Intergenic
906208775 1:44000828-44000850 CAGGACATCCAGATGATGCTGGG - Exonic
906315767 1:44785552-44785574 CAGGACATACAGTAGGCACTGGG + Intronic
906520853 1:46466247-46466269 CTGGACACACAGAAGGCGCTGGG + Intergenic
907306701 1:53517331-53517353 CTGGACAGACAGGTGGTGCTAGG - Intronic
908806608 1:67938747-67938769 TTGGACACAGAGATGGTGCTGGG + Intergenic
912152522 1:106878079-106878101 CTGGACAAACAGTTAGTGGAGGG - Intergenic
912548851 1:110471256-110471278 TTGTAAATACAGTTTGTGCTGGG - Intergenic
917211319 1:172634495-172634517 TTGGACACCCAGTTGGTGTTTGG + Intergenic
919037626 1:192335526-192335548 CTGGACATTCATATAGTGCTAGG + Intronic
922260029 1:223931733-223931755 CTGGACAAACAGAGTGTGCTGGG - Intergenic
923766818 1:236900050-236900072 CTGGACATACAGGTGGGAGTTGG - Exonic
924341194 1:243034293-243034315 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1064612008 10:17113550-17113572 CTGGAGATTCAGTTGCTGCAGGG + Intronic
1065139747 10:22708616-22708638 CATCACATACAGTTGGGGCTGGG + Intronic
1065150833 10:22821559-22821581 CTGGACACACAGAAAGTGCTTGG + Intergenic
1070940290 10:80338883-80338905 TTGGACATTCAGTTTGTGTTTGG - Intronic
1072536625 10:96369227-96369249 CTTGGCATATAGTTGGTGCTTGG - Intronic
1074103780 10:110374230-110374252 CTGGGCATACAGGTGGGCCTGGG + Intergenic
1076163546 10:128264398-128264420 CTGGGCTTACAGTTTATGCTGGG + Intergenic
1076967926 11:107959-107981 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1077305461 11:1866889-1866911 CTGGGGCTGCAGTTGGTGCTGGG - Exonic
1077634014 11:3829628-3829650 CTGGAGATTCAGTTGGACCTGGG + Intronic
1077849664 11:6063183-6063205 CTGTACATCCTGTTGGTGATAGG + Intergenic
1079346524 11:19657277-19657299 CTGGGCATCCAGTTTGTGCCAGG + Intronic
1079995663 11:27292783-27292805 CTTGAAATACAGTTGGTGATGGG - Intergenic
1080424881 11:32146251-32146273 ATGGACATACAGGTTTTGCTTGG + Intergenic
1080524215 11:33097779-33097801 CTGGACACTCTGTAGGTGCTAGG - Intronic
1081413058 11:42782754-42782776 CTGGGACTACATTTGGTGCTGGG - Intergenic
1084876289 11:72136098-72136120 CTGGCCATACAGCTCGTCCTCGG - Exonic
1084881161 11:72172594-72172616 CTGGCCATACAGCTCGTCCTCGG - Intergenic
1084909030 11:72372805-72372827 CTGGGCACACAGTGGGTGCTGGG + Intronic
1084955155 11:72687260-72687282 CTGGACTAACAGTAGGTGCTAGG + Intronic
1085057093 11:73411394-73411416 CTGGGCATACAGATTCTGCTGGG + Exonic
1085348534 11:75783592-75783614 ATGGGCACACAGTAGGTGCTTGG + Intronic
1085789122 11:79481335-79481357 CCTGACATACAGTTGTTGCCTGG - Intergenic
1087702407 11:101450244-101450266 CTGGACATATAATGGGAGCTAGG + Intergenic
1088785157 11:113174897-113174919 ATGGAGATACAGTTGTTGGTGGG - Intronic
1089127280 11:116185577-116185599 TTGGACACTCATTTGGTGCTGGG - Intergenic
1090093156 11:123717432-123717454 CTTGACATGCACTTGGTGGTTGG + Intergenic
1099519944 12:83648378-83648400 TTGAACATACAGTTGATGCTTGG - Intergenic
1100040632 12:90313137-90313159 CTTGAAAGACAGTTGGTGGTTGG + Intergenic
1100536486 12:95515411-95515433 CTGGACATACTGTCAGGGCTGGG + Exonic
1101438285 12:104682899-104682921 CTGGACACAGGGTTGGTACTTGG - Intronic
1101746531 12:107545847-107545869 CTGGACAGGCTGTTGGGGCTAGG - Intronic
1102199656 12:111048561-111048583 CTGGACATAGAGCTGGTGCAAGG + Intronic
1102786815 12:115611760-115611782 CTGGGCAGCCAGTTGGTGCTGGG - Intergenic
1103983559 12:124752287-124752309 CCTGGCATACAGTAGGTGCTCGG - Intergenic
1109776307 13:67045193-67045215 CAGGCCTTACAGTTGGTGATAGG - Intronic
1110359929 13:74613087-74613109 CTGGGTCTACAGTTGGTGCACGG + Intergenic
1114304782 14:21412614-21412636 CTTGACATACAGTTGGAGGTGGG - Intronic
1114360060 14:21961784-21961806 CAGGACACAGAGTTGCTGCTTGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119585366 14:75829249-75829271 TTGCACATATATTTGGTGCTTGG + Intronic
1119888145 14:78161826-78161848 CTGGATATACAGTAGGTGTTAGG - Intergenic
1121418531 14:93796084-93796106 CTGAGTATACAGTTGGTGGTAGG - Intergenic
1127201631 15:56659871-56659893 CTATACATACATGTGGTGCTGGG - Intronic
1127301360 15:57656939-57656961 CTGGAGAGACACTTGGTTCTGGG - Intronic
1132694831 16:1197319-1197341 CTGAACGTACAGTGGGTGCCGGG - Intronic
1133798561 16:9066346-9066368 CTGGACACCCAGTTGGTGTGTGG + Intergenic
1134764247 16:16742725-16742747 ATTGACATATAGTAGGTGCTTGG + Intergenic
1134981811 16:18616490-18616512 ATCGACATATAGTAGGTGCTTGG - Intergenic
1135464342 16:22672349-22672371 CTGGCCACACTGGTGGTGCTGGG + Intergenic
1136275390 16:29176759-29176781 CTGCACATCCAGGTGGGGCTGGG - Intergenic
1136627001 16:31467387-31467409 CTGGACACACAGATCTTGCTTGG + Intergenic
1138446332 16:57066545-57066567 CTGGACACAGAGCTGCTGCTGGG - Exonic
1139296040 16:65901755-65901777 ATGGACACACAGTAGGAGCTGGG + Intergenic
1140322139 16:73963287-73963309 ATGGAAATACAGTTCCTGCTTGG + Intergenic
1140684794 16:77423050-77423072 CTGAACATTCAGTAGGTCCTGGG - Intronic
1140956826 16:79874160-79874182 TTTGGCATACAGTGGGTGCTTGG + Intergenic
1141281690 16:82634910-82634932 CTGCACACACAAGTGGTGCTTGG - Intronic
1141495820 16:84408697-84408719 CTGGACACACAGGTGCTTCTGGG + Intronic
1141851625 16:86650079-86650101 CTGGACATGGAGCTGGTGCCGGG + Intergenic
1142079750 16:88142824-88142846 CTGCACATCCAGGTGGGGCTGGG - Intergenic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1142452754 16:90191180-90191202 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1143968986 17:10778832-10778854 CAGGACCTACAGTGGGTGTTGGG - Intergenic
1144848841 17:18233956-18233978 CCGGGCACACAGTGGGTGCTGGG - Intronic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1145965450 17:28913561-28913583 CTGGACATACCACAGGTGCTCGG - Intronic
1147583270 17:41638591-41638613 CTGGGTATACAGGGGGTGCTGGG - Intergenic
1151310297 17:73288648-73288670 CTGGACTTCCAGTGGGTGCTTGG - Intronic
1153366117 18:4258269-4258291 CAGGACAAACAGTTGATCCTAGG - Intronic
1154948528 18:21185495-21185517 CTGGACTTCCAGGAGGTGCTAGG - Intergenic
1155449332 18:25946981-25947003 CAGGACACACATTGGGTGCTGGG + Intergenic
1156157847 18:34324725-34324747 CTTTACAAACAGTTGGTGGTAGG + Intergenic
1159927806 18:74284314-74284336 ATGGACATTCAGTATGTGCTAGG - Intronic
1160034170 18:75285930-75285952 CTGGAGCTGCAGCTGGTGCTGGG - Exonic
1160644731 19:177582-177604 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1160986962 19:1843515-1843537 CTGGAGGGACGGTTGGTGCTAGG - Intronic
1162575693 19:11497559-11497581 CTGGGCACACAGTGAGTGCTGGG + Intronic
1165038657 19:33053342-33053364 CTGGAAATACAGTTGATTCATGG - Intronic
1165863932 19:38924513-38924535 CTGGCCACTCAGTAGGTGCTGGG + Intronic
1167658621 19:50782726-50782748 CTGAACCCACAGTTGGGGCTTGG - Intergenic
925500913 2:4503732-4503754 CTGTAGTTACAGTTGGTGCTTGG - Intergenic
925739025 2:6989021-6989043 CTGGACAAACAGCTGATTCTAGG - Intronic
927666850 2:25038856-25038878 CTGGACTTACAACTGGTGTTGGG - Intergenic
928282873 2:29964261-29964283 CTGGAGAAGCAGTTGCTGCTTGG - Intergenic
928976476 2:37092230-37092252 CTGGACATCCAGTTGTTGACAGG - Exonic
930567659 2:53043306-53043328 CTGGACTTAAATTTGATGCTTGG - Intergenic
931447930 2:62342610-62342632 CTTGACACATAGTAGGTGCTCGG - Intergenic
933170093 2:79115301-79115323 CTGGACATCTGGTTGCTGCTGGG + Intergenic
935881540 2:107570585-107570607 TTGGATATTCAGTTGGTGCCTGG - Intergenic
936631658 2:114209751-114209773 CTGAACAAACAGTAGGTGCATGG - Intergenic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
939224806 2:139351519-139351541 CTGGACATTAAGTTGGTAGTTGG + Intergenic
941948103 2:171122391-171122413 TTGGTGATACAGTTGCTGCTGGG - Intronic
945769072 2:214016943-214016965 ATGGACATGCAGATGGTGTTAGG + Intronic
947996215 2:234529948-234529970 CTGGTCATACAAATGGTTCTGGG + Intergenic
948306811 2:236954548-236954570 CTGGACATCTACTTTGTGCTGGG + Intergenic
948418743 2:237838948-237838970 CTGGAGCTACAGTATGTGCTAGG - Intronic
948468186 2:238162094-238162116 CTGGGCAGAAACTTGGTGCTTGG + Intronic
1168832697 20:855509-855531 CTGGACATACAGTTGGTGCTTGG - Intronic
1173431968 20:42996142-42996164 CTGGAAGCACACTTGGTGCTGGG - Intronic
1176258001 20:64162784-64162806 CTGGACATGCTGTGAGTGCTAGG - Intronic
1176280777 20:64308329-64308351 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1178635163 21:34296141-34296163 CTGGGCATACAGCAGGTGGTAGG + Intergenic
1180695046 22:17746533-17746555 CTGGTGACACAGTTAGTGCTGGG + Intronic
1181099677 22:20530974-20530996 CTGGACATACAGGAAGTGCTAGG - Intronic
1181728245 22:24826531-24826553 CTGGCCACACAGCAGGTGCTCGG - Intronic
1184267944 22:43359932-43359954 CTTGGCATATAGTGGGTGCTTGG - Intergenic
1185159543 22:49214945-49214967 CTGAACATACACTCAGTGCTGGG + Intergenic
950639654 3:14340530-14340552 CTGGACACATGGGTGGTGCTTGG - Intergenic
951230192 3:20169722-20169744 CTGAACATACAATTAGAGCTTGG + Intronic
953206776 3:40838257-40838279 CTGGACACACAGGTGGGGTTTGG + Intergenic
956759941 3:72432246-72432268 CAGGACATCCAGTTTGTTCTTGG - Intronic
958910542 3:99989135-99989157 CATGTCATACAGTTGTTGCTAGG - Intronic
961500364 3:127328266-127328288 CTGGACATGCTGTAGGTGCTTGG - Intergenic
962993399 3:140601106-140601128 CTGGAGATGCAGCTAGTGCTGGG - Intergenic
963442720 3:145359662-145359684 CTCTACATACAGTAGTTGCTTGG - Intergenic
963785654 3:149531855-149531877 CTAGGCATACAGTGGGTACTTGG + Intronic
966357161 3:179093142-179093164 ATGGACATGTAGTTGGTTCTAGG - Intergenic
968676244 4:1882086-1882108 CTGTAGATTGAGTTGGTGCTGGG + Intronic
969926489 4:10590504-10590526 CTGGACTAACAGTCGGTGCCTGG - Intronic
970249703 4:14101415-14101437 CTGGAAATACAATTGGTGCAGGG + Intergenic
972834473 4:42853262-42853284 CTGGAGATGTAGTTGGTGGTTGG - Intergenic
973314788 4:48748654-48748676 CCTGACACACAGTTGATGCTTGG - Intronic
976844864 4:89476306-89476328 CTTGATATACAATTAGTGCTGGG - Intergenic
979154481 4:117365655-117365677 CTAGACACACAGGTTGTGCTGGG + Intergenic
979261633 4:118654082-118654104 CTGGACAAACAGAATGTGCTGGG + Intergenic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
979783250 4:124682354-124682376 ATGCACATACTGTTGTTGCTGGG + Intronic
983150205 4:164269248-164269270 CTGGACAAACAGAGTGTGCTGGG - Intronic
983477618 4:168233824-168233846 TTGGAGAAACAGTTGGTGTTTGG - Intronic
984665264 4:182420204-182420226 ATGGATATACATTTGGTGTTTGG + Intronic
986325543 5:6670568-6670590 CTTGATATACAGTAAGTGCTTGG - Intergenic
987037578 5:14033452-14033474 CTGTAGATACAGCTGGTCCTGGG - Intergenic
990200166 5:53363425-53363447 CTAGACATAGAGTTGGTGATTGG - Intergenic
993279975 5:85912865-85912887 CTGGACTTAAACTTGATGCTTGG + Intergenic
996533590 5:124552147-124552169 CAGGAAATACAGTTGGTGCTGGG - Intergenic
997262785 5:132477028-132477050 ATGGACATGGAGTTGGTGTTTGG - Intergenic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
997690737 5:135825965-135825987 CTCGACAGTCAGTGGGTGCTGGG - Intergenic
999253759 5:150197918-150197940 CTGGGCACACAGTGGGTCCTGGG + Intronic
1001423913 5:171610868-171610890 CTTGGCATATAGTTGGTGCTCGG + Intergenic
1001580471 5:172794693-172794715 CAGGACATCCAGCTGGTGCCAGG + Intergenic
1001982055 5:176044481-176044503 CTGGACATCCACTTGGAGCCTGG + Intergenic
1001999564 5:176190073-176190095 CTGGCCATCCAGTGGGTGCACGG - Intergenic
1002235407 5:177799576-177799598 CTGGACATCCACTTGGAGCCTGG - Intergenic
1002732193 5:181347198-181347220 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1002752342 6:126906-126928 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1002841655 6:911753-911775 CTGGACCTGCAGCTGGGGCTTGG + Intergenic
1002915691 6:1526185-1526207 GTGGACAGACAGGTGGGGCTGGG - Intergenic
1008515299 6:52313239-52313261 CTGGACCTACAGTTCTTTCTAGG + Intergenic
1014358543 6:120444590-120444612 CTGGACATCCTGATGTTGCTTGG - Intergenic
1015255018 6:131169446-131169468 TTTGACATACAGTTGGCACTTGG + Intronic
1016328941 6:142935740-142935762 CTGGGCATACAGTTGATATTTGG - Intronic
1018809292 6:167285898-167285920 CTGGACATAGAATTGGTGGGAGG - Intronic
1019236445 6:170619512-170619534 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1019923940 7:4180176-4180198 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923951 7:4180226-4180248 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923994 7:4180426-4180448 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019924011 7:4180501-4180523 CTGGACATAGAGCTGGAGCCAGG - Intronic
1021742447 7:23700975-23700997 CTTTACTTACAGTTGGTGTTAGG + Intronic
1023353788 7:39347090-39347112 CTGGTCAGACAGTTGGTGTGGGG + Intronic
1024627471 7:51220352-51220374 CTGGCCATAGATTTGGAGCTGGG - Intronic
1024688917 7:51778604-51778626 CTGAACATAAAGCTAGTGCTGGG + Intergenic
1026820642 7:73545727-73545749 GAGTCCATACAGTTGGTGCTAGG + Intronic
1028528473 7:91811865-91811887 CTGGGCATACATTTGCTGCAGGG - Intronic
1029710677 7:102297707-102297729 CTGGGCATACAGCAGGCGCTTGG - Intronic
1030484034 7:110143208-110143230 CAGGACATACTGGTGTTGCTTGG - Intergenic
1031828739 7:126600234-126600256 CTGGAAATACAGTTGACCCTTGG + Intronic
1032567179 7:132958566-132958588 CTGGAGATACATTTGTTACTTGG + Intronic
1033217589 7:139504709-139504731 CAGGACACACAGCTGCTGCTTGG + Intergenic
1035080284 7:156210087-156210109 CCGGAGAGACAGTAGGTGCTTGG + Intergenic
1035511325 8:187095-187117 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1037302957 8:17472244-17472266 CTGGCAATACTGTTGGTTCTGGG - Intergenic
1037336679 8:17799160-17799182 CTTGAAATACAGTTGATGGTTGG - Intronic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039642438 8:39238270-39238292 CTGGACTTTCAGTTGGTACTTGG - Intronic
1040900237 8:52410748-52410770 CAGGACATACAACTGGTCCTGGG - Intronic
1046407125 8:113789134-113789156 CTGGACATGCAGTATGTGCATGG + Intergenic
1046806410 8:118483921-118483943 CTTAACATAGAGTTGGCGCTTGG - Intronic
1046839073 8:118837617-118837639 TTGGACACCCAGTTGGTGTTTGG - Intergenic
1049860386 8:144894291-144894313 CTGGGCAGACAGACGGTGCTGGG - Intronic
1051657498 9:19396993-19397015 CTGGGCATATAGCTGGAGCTAGG + Intergenic
1052493399 9:29194461-29194483 CTGTACTTACAGTTGATGCACGG - Intergenic
1056667858 9:88596249-88596271 CTGGACACCCAGTTTGTGTTTGG - Intergenic
1058420924 9:104832658-104832680 CTGGACATCCTCTGGGTGCTTGG + Exonic
1060099952 9:120831212-120831234 TTGGCCCTACAGTAGGTGCTGGG - Intronic
1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG + Exonic
1062756595 9:138299524-138299546 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1190067032 X:47248515-47248537 CTGGGCATGCCATTGGTGCTTGG - Intergenic
1198654457 X:138898496-138898518 TGGGACATAAAGTGGGTGCTGGG - Intronic
1199738778 X:150711708-150711730 TTGGCCATGCAGCTGGTGCTGGG + Intronic
1202383717 Y:24302541-24302563 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1202487066 Y:25367579-25367601 CTGGACAAACAGAGTGTGCTGGG - Intergenic