ID: 1168836126

View in Genome Browser
Species Human (GRCh38)
Location 20:878488-878510
Sequence TTTTCCCTCTAGCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168836126 Original CRISPR TTTTCCCTCTAGCAGGTGGA GGG (reversed) Intronic
901036061 1:6336992-6337014 TTTTCCCTGTAGCAGGGGCTGGG - Intronic
901167115 1:7229041-7229063 ATCTCCCTGGAGCAGGTGGAGGG + Intronic
902265113 1:15257683-15257705 CTTTCCCTTCAGCACGTGGAGGG + Intronic
902852437 1:19170774-19170796 TATTGGCTCTAGCAGGTGCAAGG - Exonic
905759882 1:40546499-40546521 TTTTCTCTATAGCATGTTGATGG + Intronic
906006394 1:42476164-42476186 TTTTCCTTCTAGCAAAGGGAGGG + Intronic
906145697 1:43558794-43558816 CTTTCCCTCCAGGAGGTTGAGGG + Intronic
906537687 1:46560738-46560760 TTGTCCCTCTGGCATGTGGCAGG + Intronic
907767236 1:57423716-57423738 TTTTCCTCCCAGCAAGTGGAGGG + Intronic
908414231 1:63897177-63897199 TTTTCTCTCTAGCAAGTTTATGG + Intronic
908854452 1:68408862-68408884 TTTTCTCTCAAGCAGGAGAAAGG - Intergenic
910264035 1:85319867-85319889 TTTCCCCCGTAGCAGATGGAAGG - Exonic
914901813 1:151715171-151715193 TCTTCCCTGTGCCAGGTGGAGGG + Intronic
917695898 1:177523728-177523750 TTCTCCCTTTAGTTGGTGGATGG + Intergenic
918602370 1:186378544-186378566 TTTTCCCTCTGGTCTGTGGATGG - Intronic
918891338 1:190274099-190274121 TTTTACCCCTACCAGGAGGATGG + Intronic
919941834 1:202292535-202292557 TTTGGCCTGTAGCTGGTGGAAGG + Intronic
920770016 1:208875135-208875157 TTTTCCCCCTAGAGGCTGGAGGG - Intergenic
922116580 1:222618742-222618764 TTTTCCCAGTGGCAGGTTGATGG + Intronic
923314699 1:232768521-232768543 TTGTCCATCAAGCAGGAGGATGG - Intergenic
1063147702 10:3310941-3310963 ACTTCCCTCCAGCAGGTGGCTGG + Intergenic
1064592343 10:16907164-16907186 GTTACCCTCTAGGAGGTAGATGG + Intronic
1064705306 10:18066863-18066885 TTTTTCCTCTCCCAGGTGGAAGG + Intergenic
1066193592 10:33077865-33077887 CTTCCCCACTAGCAGGTGAAGGG - Intergenic
1066561622 10:36675927-36675949 TTGTCTCTCTTGCATGTGGAGGG - Intergenic
1068635064 10:59339319-59339341 TTTTCCCTCTTGTATGTTGAAGG - Intronic
1068635098 10:59339605-59339627 TTTTCCCTCTTGTAAGTTGAGGG - Intronic
1069214383 10:65801251-65801273 TTTTTCCCTTAGTAGGTGGAAGG + Intergenic
1070025863 10:72631416-72631438 TTTTACCACTAGGAGGTGGGAGG + Intergenic
1072024686 10:91443320-91443342 TTTTCCTTCTAACAGTTAGAAGG + Intronic
1072025011 10:91446275-91446297 TTTTCCTTCTAACAGTTAGAAGG - Intronic
1074465969 10:113680936-113680958 TCTTGCCTCTAGCAGCTGGGAGG - Intronic
1074492642 10:113952980-113953002 TTTTACCTCTAGCATTTAGATGG - Intergenic
1074503854 10:114049845-114049867 TTTACCCTTTTGTAGGTGGAGGG + Intergenic
1074708254 10:116155345-116155367 TTCCCCCTCTAGCAGAGGGAAGG + Intronic
1075941997 10:126397890-126397912 TTGGCACTCTACCAGGTGGAAGG - Intergenic
1078959888 11:16252766-16252788 TTTTCCTTCTCCCAAGTGGAAGG - Intronic
1079917629 11:26390304-26390326 TTTTCCCTCTAAAAGGAGGAGGG - Intronic
1083252622 11:61478039-61478061 TTTTCCTTTTAGCAGGTGGAGGG - Intronic
1085014376 11:73163264-73163286 TTTTACCTTAAGCTGGTGGAGGG + Intergenic
1085902270 11:80715336-80715358 TTTTCCCTCAAGAAAGTGAAAGG - Intergenic
1088086518 11:105987262-105987284 TTTTCCTTCCAGGAGATGGAAGG + Intergenic
1090463274 11:126910805-126910827 TGTTTCCCCTAGCAGGTGAATGG - Intronic
1091302360 11:134515609-134515631 TTCTGTCTCTAGCAGGAGGACGG - Intergenic
1093662480 12:21773679-21773701 GTTTCCCTCGTGCAGGAGGACGG - Exonic
1096593409 12:52677735-52677757 TTGTTCCTCTAGGATGTGGATGG - Exonic
1097624448 12:61982853-61982875 TATTCCCACCAGCAAGTGGAAGG + Intronic
1098516862 12:71387582-71387604 TTTTCAATCTAACAGCTGGAGGG + Intronic
1098838691 12:75452922-75452944 TTTTGCTTCTGGCAGGGGGAAGG - Intergenic
1099139668 12:78956472-78956494 TTTTCTTTCTAGCAGGGGTAGGG - Intronic
1103493507 12:121342496-121342518 TTTTATTACTAGCAGGTGGAAGG - Intronic
1103842139 12:123873716-123873738 TTGACGCTCAAGCAGGTGGAGGG + Intronic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1106821752 13:33472573-33472595 TGTTCCCTAGAGCAGGTAGAGGG + Intergenic
1109645113 13:65244098-65244120 GTTTGCTTCTAGCAGGAGGATGG - Intergenic
1110097214 13:71542769-71542791 TTTTCTCTATAACATGTGGATGG - Intronic
1114530581 14:23393050-23393072 TCTTCCCTCCAACAGCTGGAGGG - Exonic
1116386254 14:44334151-44334173 CTTTGCCTCTAGGAGGTGGCAGG - Intergenic
1116458501 14:45145232-45145254 TTTTTCCTCAAGCAGAAGGAAGG + Intronic
1118096868 14:62546778-62546800 TTTCCCCTCAAGCAGAGGGAAGG - Intergenic
1118251823 14:64169174-64169196 TTTTCCGTATGGTAGGTGGATGG + Intronic
1118685597 14:68287427-68287449 TGTTCCTTCTAATAGGTGGATGG + Intronic
1118860499 14:69659350-69659372 TTTTCCCTCCATCAGATGAATGG + Intronic
1119013044 14:71016798-71016820 TTGTTCTTCTAGCAAGTGGAAGG - Intronic
1125430298 15:39587250-39587272 TTCACCCTCTGGCAAGTGGAGGG + Intronic
1127998618 15:64170611-64170633 AGGTCCCTCTGGCAGGTGGAAGG + Exonic
1130980898 15:88811288-88811310 TTTTTCCTAAAGCAGATGGAGGG + Intronic
1132106955 15:99069795-99069817 TTTCCCCTCCAGCAGGTACACGG - Intergenic
1132195729 15:99913406-99913428 TTTTCCAGCTAGCAGGAGGGTGG + Intergenic
1138469439 16:57221463-57221485 TTTTCCCCCTAGTTGGTGGGTGG + Intronic
1140119226 16:72068990-72069012 TTTTCCCTCAATCAGCTGGGAGG - Intronic
1140880239 16:79191534-79191556 TTTTGCTTCTAGCTGGTCGAAGG + Intronic
1141291194 16:82719438-82719460 TTTTCCCACTTGCAGAAGGAAGG + Intronic
1143662735 17:8336749-8336771 TCTCCCCTCCAGCAGCTGGAGGG + Intergenic
1143862994 17:9904843-9904865 TTCTCCCTCTACGACGTGGACGG - Exonic
1143893199 17:10117924-10117946 TTTTGCCTCCAGCGGCTGGAAGG + Intronic
1144710680 17:17399584-17399606 TTTTCCTTCTAGCAGTCAGAGGG + Intergenic
1145193604 17:20868137-20868159 TCCACCCTCCAGCAGGTGGAAGG + Intronic
1146511005 17:33448617-33448639 TTTTCCCTATAGCCCCTGGAGGG + Intronic
1148080513 17:44965594-44965616 TTTTCCCTCCAGCAGGGGCAGGG - Intronic
1149613233 17:57974077-57974099 TTCTCCCTATACAAGGTGGATGG - Exonic
1151680193 17:75619060-75619082 TTTTCCTTCATGCATGTGGATGG + Intergenic
1151803558 17:76391671-76391693 TAGTCCCCCTGGCAGGTGGAGGG - Intronic
1155065730 18:22267423-22267445 TTTTCCCTCAAGCATGTGATAGG - Intergenic
1155988016 18:32251322-32251344 ATTCCCCTCTAGAAGGTGAATGG - Intronic
1156513930 18:37663863-37663885 TTTTCCCTCTTAAAGGTGGAGGG - Intergenic
1156917369 18:42477501-42477523 TTTTCCATCTAGCAGTTCTAAGG - Intergenic
1156939105 18:42743304-42743326 TTTTGCCTTTAACAGTTGGATGG - Exonic
1158313963 18:56190069-56190091 TTTCCTCTCTAGCAGGTTCATGG + Intergenic
1158875933 18:61734579-61734601 TTTGCACTCTATCAGGTGAAAGG + Intergenic
1159244462 18:65787453-65787475 TTTACCTACTAGCAGGAGGATGG + Intronic
1160583964 18:79902712-79902734 TCTTCCCTTCCGCAGGTGGAGGG - Exonic
1162044516 19:7989616-7989638 TTTTTCCTCTTTCTGGTGGAAGG - Intronic
1163075335 19:14885985-14886007 ATTCCTCTCTAGCAGGTTGATGG + Intergenic
926601979 2:14855012-14855034 TTTCTCCTCTAGCAGGTGGAAGG - Intergenic
928337862 2:30413511-30413533 TTGTCTGTCTGGCAGGTGGATGG + Intergenic
931777717 2:65554641-65554663 TTTCCACTCTAGCAGCTGGTGGG + Intergenic
933264483 2:80167801-80167823 TTTTCCCTCTAAGAGCTGAATGG - Intronic
933496479 2:83056327-83056349 GTTTCTCTCAAGCAGGTGGTAGG - Intergenic
936288775 2:111201530-111201552 TCTTCCCTCCAGCAGCTGGGAGG - Intergenic
937094471 2:119226463-119226485 TCCTCCCTCTAGGAGTTGGAAGG + Intronic
939042768 2:137211048-137211070 TGTTCACTTTAACAGGTGGAGGG - Intronic
939695195 2:145314752-145314774 TTTTCCCTCTTTGAGGTGGTAGG - Intergenic
941323233 2:164081712-164081734 TTTTCCCTGTAGCCTCTGGAGGG + Intergenic
941901086 2:170678921-170678943 TTTCCCATCTGGCAGGTGGTTGG - Intergenic
945510923 2:210701924-210701946 TTTTCCATCTAGCAGTGGAAAGG + Intergenic
1168836126 20:878488-878510 TTTTCCCTCTAGCAGGTGGAGGG - Intronic
1169041158 20:2496761-2496783 TTTTGCCTGGAGCAGTTGGAAGG + Intronic
1174395097 20:50242508-50242530 CTTTCCCTCCAGAAGGTGGGTGG + Intergenic
1175433119 20:58921250-58921272 TTCTCCCTCTAGCATGAGAATGG - Intergenic
1180001295 21:44996688-44996710 TGTTCCCTGTGGCAGGAGGAAGG + Intergenic
1181389545 22:22570244-22570266 TTTTCCTTCTAGCATAGGGAGGG + Intergenic
949610152 3:5696036-5696058 TTTTCCCTCTATCACCTGGGAGG + Intergenic
950677514 3:14563609-14563631 TTCTCCCTCTAGCAGCCAGAGGG - Intergenic
951123127 3:18951664-18951686 TTTCCCTTCAAGCAGGTGGAGGG + Intergenic
951423785 3:22518735-22518757 TTTTCCATGGACCAGGTGGAGGG + Intergenic
951742884 3:25943867-25943889 AGTTCCCTTTAGCAGGTGGCAGG + Intergenic
954449909 3:50566228-50566250 TTTTCCCCCAAGCAGGATGAGGG - Intronic
955975244 3:64474011-64474033 TTGTGCCTGTAGCTGGTGGATGG - Intergenic
964463286 3:156960996-156961018 ATTTTATTCTAGCAGGTGGAAGG - Intronic
965237327 3:166142179-166142201 TTTTCCATCAAGAAGTTGGAAGG + Intergenic
966608369 3:181844300-181844322 ATTTCCCTCTACCTGCTGGAGGG + Intergenic
966640460 3:182183858-182183880 TTATCCATCTAACAGGTGGGCGG - Intergenic
967754593 3:193155052-193155074 TTCTCCCTATACAAGGTGGATGG - Intergenic
967860757 3:194149645-194149667 TATTTCCTCTGGCAGGTGGCAGG - Intergenic
967944108 3:194788638-194788660 CTTTCCCTCCTGTAGGTGGAAGG + Intergenic
969624898 4:8297461-8297483 CTTTCCTTCTAGCAGGGAGACGG + Intronic
970661032 4:18286090-18286112 TTGAGCTTCTAGCAGGTGGAAGG - Intergenic
972289092 4:37674483-37674505 TTTTGCCTTTAGAAGGAGGATGG + Intronic
972734015 4:41822570-41822592 TTTTCCCTATAGAATGTGGAGGG + Intergenic
973138464 4:46735677-46735699 TTTTGCCTGTAGGAGGGGGAAGG - Intronic
974970208 4:68814748-68814770 TTTTCCCTCCAATATGTGGAAGG + Intergenic
975000222 4:69215860-69215882 TTTTCCCTCCAATATGTGGAAGG - Intergenic
975005540 4:69279344-69279366 TTTTCCCTCCAATATGTGGAAGG + Intergenic
975013958 4:69388333-69388355 TTTTCCCTCCAATATGTGGAAGG + Intronic
975148158 4:70993064-70993086 TTTTCCCACTGGCAGGTAAATGG + Intronic
975335405 4:73170171-73170193 TTTTCTCTCAAGCAGAAGGAAGG - Intronic
977111509 4:92962467-92962489 TTTTCCTTCTCCCAGTTGGAAGG + Intronic
977656635 4:99529327-99529349 TCTTCCCTTTATCAGTTGGAAGG - Intronic
978326269 4:107560714-107560736 TTTTTCTTTTATCAGGTGGAAGG + Intergenic
978903487 4:113979941-113979963 CTTTCCCTCTAGCGGGGTGATGG - Intergenic
981402944 4:144336014-144336036 TTTTCCCCCTAGTTGGTGGGTGG - Intergenic
982980977 4:162134649-162134671 TCTTCCCTCTAGCAAGTGAATGG - Intronic
983388499 4:167098209-167098231 TCTTGGTTCTAGCAGGTGGAGGG - Intronic
983895244 4:173074491-173074513 TCTTCCCTAAAGCAGATGGATGG + Intergenic
989261341 5:39423153-39423175 TTTTCCCACTCCCAGCTGGAAGG - Intronic
993843194 5:92906708-92906730 TTATACCACTAGCAGGTGGCAGG - Intergenic
995772787 5:115690555-115690577 TGTTCCCTCTAGGAGGTGGGGGG + Intergenic
999290182 5:150419855-150419877 TTGTCCCTCAAGGAGGGGGACGG - Intergenic
1000653315 5:163845197-163845219 TCCTACCTCTAGCAGATGGAAGG - Intergenic
1001016211 5:168143618-168143640 TTTGCCCTATAGCAGAAGGAGGG + Intronic
1002490921 5:179576885-179576907 TTTTTCTTCTAGAAGGTGGTAGG + Intronic
1002691612 5:181053991-181054013 TTTTCACACTAGCAGGAGGGAGG + Intronic
1007577928 6:42938178-42938200 TTTTCCCTTCAGCACGTGGTTGG - Exonic
1007717705 6:43866791-43866813 TCTTCTCTGTAGCAGCTGGAAGG - Intergenic
1008673084 6:53793764-53793786 TTTTAGCTATAGCAGCTGGAGGG + Intergenic
1009844281 6:69116186-69116208 TTTGCCCTCTAAAATGTGGATGG - Intronic
1010252766 6:73725280-73725302 TTTGCCCTATAGCAGAAGGAGGG + Intronic
1012332600 6:98011631-98011653 TTGTGCTTCTAGCAGGAGGAGGG - Intergenic
1013122334 6:107151803-107151825 TCTTCCCTCTAGCAGGTAACTGG + Intergenic
1015651868 6:135471440-135471462 TTTTCCCTCTAACAGCTTTATGG + Intronic
1016783670 6:147987536-147987558 TTTTCTCGATGGCAGGTGGAAGG - Intergenic
1020238628 7:6374994-6375016 TTTTCCCTCTAGCCGGCGAGCGG - Intronic
1021168316 7:17367982-17368004 TTCTCCTTCTAGGAGGTGGAAGG + Intergenic
1021665744 7:22977088-22977110 TTTTCCCTCTTCCTGATGGATGG - Intronic
1022691788 7:32663256-32663278 TTTTCCTTAAAACAGGTGGAGGG + Intergenic
1026744157 7:72998206-72998228 GTTTCACCCTAGGAGGTGGAAGG + Intergenic
1027030264 7:74882883-74882905 GTTTCACCCTAGGAGGTGGAAGG + Intergenic
1027099580 7:75366886-75366908 GTTTCACCCTAGGAGGTGGAAGG - Intergenic
1027730911 7:81871423-81871445 TTTTCCATCCAGCATCTGGATGG + Intergenic
1029224027 7:99012056-99012078 CTCTCCCTCACGCAGGTGGATGG + Exonic
1030365155 7:108637393-108637415 ACTTCTCTCCAGCAGGTGGATGG + Intergenic
1041895401 8:62918438-62918460 TTTTCCCTTTTGCAGTTGGTGGG + Exonic
1042400520 8:68341033-68341055 TTTTCATTATAGCAGCTGGAAGG - Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1044523171 8:93223152-93223174 TTTTCCTTCAAGCATTTGGAAGG - Intergenic
1047354896 8:124111264-124111286 TTTTCCCTTTAGGAGGTGTAAGG - Intronic
1048623032 8:136155545-136155567 TTTTCTCTTGGGCAGGTGGAAGG + Intergenic
1051542708 9:18237987-18238009 TTTGCCCTCTAGAGGCTGGAGGG + Intergenic
1051851324 9:21512245-21512267 TTTTCCCTCCCTCAGGTGAAAGG - Intergenic
1055064330 9:72103505-72103527 GTTTGCCTCTAGCATGTAGAGGG - Intergenic
1059517891 9:114912868-114912890 TTTTCTTTTTAGCAAGTGGAGGG + Intronic
1061083863 9:128387914-128387936 CCTTCCCTGAAGCAGGTGGAGGG + Intronic
1062095937 9:134703409-134703431 TTTTGCCTCTTGCTGGTGGGAGG + Intronic
1185945716 X:4373865-4373887 CTTTCCCTCTTGCATGTCGAGGG - Intergenic
1186046358 X:5541140-5541162 TCTTACCTCTATCAGATGGAAGG - Intergenic
1186375936 X:9001324-9001346 TTTTCCTTCTAGCAGATTTATGG - Intergenic
1187109808 X:16285369-16285391 TTTTTCCTTTAGCTGGTAGAGGG + Intergenic
1189047497 X:37609194-37609216 ATTTCTTTTTAGCAGGTGGAAGG - Intronic
1192091247 X:68158736-68158758 TTTTCCCTCTAGCAGGTGATTGG + Intronic
1195873680 X:109515105-109515127 TTTTTCTTCTAGCAGTTTGATGG - Intergenic
1196403330 X:115338736-115338758 CTCTCCCTCTATGAGGTGGATGG + Intergenic
1198726802 X:139686635-139686657 TTTTGGCTTTAGCAAGTGGATGG - Intronic
1201993799 Y:20060290-20060312 TCTTCCTTCTGGCAGGTGCATGG + Intergenic
1201994292 Y:20067112-20067134 TTTTCCTTCTGGCAGGTTCATGG - Intergenic
1201994473 Y:20069610-20069632 TGTTCCCTCTGGCAGGTTCATGG - Intergenic
1201996367 Y:20094901-20094923 TCTTCCTTCTAGCAGGTTCATGG + Intergenic
1201996531 Y:20097074-20097096 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1201996561 Y:20097449-20097471 TCTTCCCTCTGGCAGGTTCATGG + Intergenic
1201996573 Y:20097573-20097595 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1201996602 Y:20097948-20097970 TCTTCCCTCTGGCAGGTTCATGG + Intergenic
1201996850 Y:20101082-20101104 TCTTCCCTCTGGCAGGTTCATGG + Intergenic
1201996861 Y:20101207-20101229 TTTTCCTTCTGGCAGGTTCATGG + Intergenic
1201997137 Y:20104975-20104997 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1201997934 Y:20115511-20115533 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1201998224 Y:20119395-20119417 TCTTCCTTCTGGCAGGTGAATGG + Intergenic
1201998376 Y:20121269-20121291 TCTTCCCTCTGGCAGGTTCATGG + Intergenic
1201998760 Y:20126253-20126275 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1201999257 Y:20133129-20133151 TCTTCCTTCTAGCAGGTTCATGG + Intergenic
1201999600 Y:20137759-20137781 TCTTCCTTCTAGCAGGTTCATGG + Intergenic
1202000546 Y:20150469-20150491 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1202000682 Y:20152220-20152242 TCTTCCTTCTGGCAGGTGAATGG + Intergenic
1202000709 Y:20152595-20152617 TCTTCCTTCTAGCAGGTTCATGG + Intergenic
1202001037 Y:20157228-20157250 TCTTCCCTCTGGCAGGTTCATGG + Intergenic
1202001216 Y:20159486-20159508 TCTTCCCTCTGGCAGGTTCATGG + Intergenic
1202003290 Y:20187254-20187276 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1202003428 Y:20189005-20189027 TCTTCCTTCTGGCAGGTGAATGG + Intergenic
1202003870 Y:20194897-20194919 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1202005034 Y:20259993-20260015 TGTTCCCTCTGGCAGGTTCATGG + Intergenic
1202006745 Y:20282666-20282688 TCTTCCCTCTGGCAGGTTCATGG + Intergenic
1202007737 Y:20295910-20295932 TTTTCCTTCTGGCAGGTTCATGG + Intergenic
1202008350 Y:20304134-20304156 TCTTCCTTCTAGCAGGTTCATGG + Intergenic
1202008503 Y:20306125-20306147 TGTTCCCTCTGGCAGGTTCATGG + Intergenic
1202008820 Y:20310111-20310133 TGTTCCCTCTGGCAGGTTCATGG + Intergenic
1203336440 Y_KI270740v1_random:6356-6378 TCTTCCTTCTGGCAGGTGCATGG + Intergenic
1203337502 Y_KI270740v1_random:20633-20655 TCTTCCCTCTGGCAGGTTCATGG + Intergenic
1203337724 Y_KI270740v1_random:23522-23544 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1203338097 Y_KI270740v1_random:28537-28559 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1203338127 Y_KI270740v1_random:28912-28934 TCTTCCCTCTGGCAGGTTCATGG + Intergenic
1203338139 Y_KI270740v1_random:29036-29058 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1203338169 Y_KI270740v1_random:29411-29433 TCTTCCCTCTGGCAGGTTCATGG + Intergenic
1203338511 Y_KI270740v1_random:33925-33947 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1203338541 Y_KI270740v1_random:34300-34322 TCTTCCCTCTGGCAGGTTCATGG + Intergenic