ID: 1168836412

View in Genome Browser
Species Human (GRCh38)
Location 20:880732-880754
Sequence TGGGAGCCACTGATTGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168836408_1168836412 -2 Left 1168836408 20:880711-880733 CCTTAAATTTTAGGACAACCTTG 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1168836412 20:880732-880754 TGGGAGCCACTGATTGAAAATGG 0: 1
1: 0
2: 2
3: 17
4: 218
1168836406_1168836412 19 Left 1168836406 20:880690-880712 CCTTCTTATCGGATGACTTGACC 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1168836412 20:880732-880754 TGGGAGCCACTGATTGAAAATGG 0: 1
1: 0
2: 2
3: 17
4: 218
1168836405_1168836412 20 Left 1168836405 20:880689-880711 CCCTTCTTATCGGATGACTTGAC 0: 1
1: 0
2: 1
3: 3
4: 46
Right 1168836412 20:880732-880754 TGGGAGCCACTGATTGAAAATGG 0: 1
1: 0
2: 2
3: 17
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168836412 Original CRISPR TGGGAGCCACTGATTGAAAA TGG Intronic
903302208 1:22387114-22387136 GGGGAGGGACTGATTGCAAAAGG + Intergenic
903321563 1:22546533-22546555 AGGGAGCGACTGAATGAAAGAGG - Intergenic
904018130 1:27440192-27440214 AGGATGCCACTGATTGAAAGAGG + Intronic
907010386 1:50957923-50957945 TGGAATGCACTGTTTGAAAAAGG - Intronic
907287802 1:53393169-53393191 TGGGAGATACTGATTGGAAGAGG - Intergenic
907775128 1:57506753-57506775 TTGGAGCCATTGATAGAAACTGG - Intronic
911838207 1:102647976-102647998 TGGAAACCACATATTGAAAATGG - Intergenic
920081022 1:203373001-203373023 TGGGAGCCAGTGGATGAAGAGGG + Intergenic
920877732 1:209852947-209852969 TGGGAGCCACTGTCTGAGAAAGG - Exonic
920921861 1:210303982-210304004 TGTGAGCCACTGAATGGAGATGG + Intergenic
921764075 1:218950016-218950038 TGAGAGGCACGGATTGAAGAAGG + Intergenic
921793523 1:219317133-219317155 TGAGAAAAACTGATTGAAAAGGG - Intergenic
1065213287 10:23425073-23425095 TGAGAGCCAGGGATTCAAAAAGG - Intergenic
1065229514 10:23582943-23582965 TGGTACCCACTGATGGAGAAAGG + Intergenic
1067095309 10:43295608-43295630 TGGGAGCCACCGAATGGAAAGGG + Intergenic
1067432151 10:46251814-46251836 TGGAAGCCACAGATGGACAAGGG - Intergenic
1067825501 10:49569608-49569630 TGGGAGGCATTTAGTGAAAAAGG - Intergenic
1068892122 10:62158961-62158983 TGGGAAAAACTGATTGTAAAGGG - Intergenic
1068917259 10:62445766-62445788 TGAGAACCACTGATTCAAAGTGG + Intronic
1070076746 10:73143892-73143914 TGGGAACCACTGATCTAAATGGG - Intronic
1075175946 10:120161149-120161171 TGAGAACCACTGATTTAAGATGG - Intergenic
1075258064 10:120940715-120940737 AGGGAGGCACTGTTTGACAAGGG - Intergenic
1076802774 10:132839038-132839060 AAGGAGACACTGATTGAAGATGG - Intronic
1080553509 11:33394826-33394848 TGGGAGCCACAGACTGAATATGG - Intergenic
1081650726 11:44822432-44822454 TGGAAGCCACATGTTGAAAATGG - Intronic
1082107838 11:48239976-48239998 TGGGAGCTAAACATTGAAAACGG - Intergenic
1082583034 11:54897249-54897271 TTGAGGCCACTGGTTGAAAAGGG + Intergenic
1084036529 11:66514720-66514742 TGGCAGCCACTGGGTGAAGAGGG + Intronic
1087466813 11:98518211-98518233 CCAGAGCCACTGATTGAACAGGG + Intergenic
1087789585 11:102392196-102392218 TGGGAGACACTGGTTAAAGAGGG - Intergenic
1089288524 11:117423063-117423085 TGGAAGCCACTTATTGAAGATGG - Intergenic
1090355903 11:126140233-126140255 TGTGAATCACTGATTCAAAAGGG - Intergenic
1092535573 12:9383495-9383517 TGCCAGCCACTGATTGATTATGG + Intergenic
1092594951 12:9992066-9992088 TGGTAGCCACTAGTTAAAAAAGG + Intronic
1095791326 12:46170567-46170589 TTGGAGCTACTGATTCCAAAAGG - Intergenic
1096418538 12:51435290-51435312 TGGGAGAGACTAAATGAAAAGGG - Intronic
1096863503 12:54547278-54547300 AAGGAGCCACAGAGTGAAAAAGG + Exonic
1099883038 12:88491746-88491768 TGTGATGAACTGATTGAAAAAGG + Intergenic
1100881103 12:99017617-99017639 TGGGTGCCACTGATTGGTTAGGG - Intronic
1105334572 13:19454615-19454637 TGGGATACTCTGATTAAAAATGG + Intronic
1105860341 13:24404721-24404743 TGGGATACTCTGATTAAAAATGG - Intergenic
1106656656 13:31753901-31753923 TGGAAGCCACAGAGAGAAAAGGG + Intronic
1108352984 13:49604227-49604249 TGGAAGCCACTTGTTGAAGATGG - Intergenic
1109069103 13:57740142-57740164 TTGGAGCCACTGAATGACAGAGG - Intergenic
1110170090 13:72490259-72490281 TCTGAGCCAATAATTGAAAATGG + Intergenic
1110250188 13:73372505-73372527 TGGAAGCCACTTGTTGAAGATGG + Intergenic
1111904282 13:94237565-94237587 AAGGAGCCACTCATTGAACAAGG + Intronic
1113729914 13:112633984-112634006 GGGGACCCACTGCTTGAAACTGG - Intergenic
1115478019 14:33834878-33834900 TGGCAGGTAGTGATTGAAAAAGG + Intergenic
1116057830 14:39885730-39885752 CAGGAGCCAGTGACTGAAAAGGG - Intergenic
1116699164 14:48216501-48216523 TGTGAGCCACTGCCTGAAAGGGG - Intergenic
1117511991 14:56461625-56461647 TGGGAGCTACTGAATGTAATTGG + Intergenic
1117986564 14:61391908-61391930 TGGGAGCAGGGGATTGAAAAAGG - Intronic
1120337753 14:83179813-83179835 AGGTAGCCACTTTTTGAAAATGG - Intergenic
1120718106 14:87862067-87862089 TGGGATCAACTGATTGATCAAGG - Intronic
1120849298 14:89155049-89155071 CGAGAGTCACTTATTGAAAATGG + Intronic
1121693273 14:95892948-95892970 TGGGAGCCACTTATAGGAAAAGG + Intergenic
1123498460 15:20855586-20855608 TGGGAGCCACTGCTTGGGGAAGG + Intronic
1123555695 15:21429214-21429236 TGGGAGCCACTGCTTGGGGAAGG + Intronic
1123591937 15:21866545-21866567 TGGGAGCCACTGCTTGGGGAAGG + Intergenic
1125861027 15:43000449-43000471 GGGGAGCCACTGTGTAAAAAAGG + Intronic
1128987194 15:72230395-72230417 TGGGAGGCGGTGATGGAAAAGGG + Intronic
1130244166 15:82228210-82228232 GGGTAGCCACTGACTGCAAATGG + Exonic
1130456285 15:84112929-84112951 GGGTAGCCACTGACTGCAAATGG - Intergenic
1202964036 15_KI270727v1_random:156424-156446 TGGGAGCCACTGCTTGGGGAAGG + Intergenic
1134087093 16:11364863-11364885 TGGGAGGCTCAGATGGAAAAGGG + Intronic
1134360426 16:13526101-13526123 TGGGAGACAGTGAATTAAAAGGG + Intergenic
1134747374 16:16598755-16598777 AGGTTGCCACTGATTGAGAAGGG + Intergenic
1135184686 16:20305262-20305284 TGGGAGCCTCTGTCTGAGAATGG - Intergenic
1136067604 16:27769350-27769372 TGTGAGCCAGGGGTTGAAAAAGG + Intronic
1137078412 16:36007791-36007813 TTGAAGCCTATGATTGAAAAGGG + Intergenic
1139138763 16:64235601-64235623 TGGGAGCCTCAGAAAGAAAATGG + Intergenic
1140207010 16:72941342-72941364 TGGGAACCACTGGAAGAAAACGG + Intronic
1143264263 17:5624048-5624070 TGGGAGGCTCTGATGGAAGAGGG + Intergenic
1144463919 17:15481409-15481431 TGGGAGGCACTGATTCTAGAAGG + Intronic
1144713152 17:17416104-17416126 TGGAAGCCACTGGCTGAGAATGG - Intergenic
1148829494 17:50421763-50421785 TGGCAGCCACAGAAAGAAAAGGG - Intergenic
1149740552 17:59041711-59041733 TGGTAGCCACTGCTTGTACATGG - Intronic
1151365638 17:73614552-73614574 TGGGGGACAAGGATTGAAAAGGG + Intronic
1154456464 18:14532011-14532033 TGGGAGCCACTGCTTGGGGAAGG + Intronic
1155265503 18:24088998-24089020 TGGGGGTCACTGATGGAAACTGG - Intronic
1155412040 18:25557113-25557135 TAAGAGCCAGTGATTGAGAAGGG - Intergenic
1156198285 18:34801097-34801119 AGGGGACAACTGATTGAAAATGG - Intronic
1157967526 18:52224961-52224983 TGGGAGTCACTGATTTACACGGG - Intergenic
1158196668 18:54894426-54894448 CAGAAGCCACTGATTGAATAAGG - Exonic
1158957357 18:62552568-62552590 TGAGAGCCATTTTTTGAAAATGG - Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163817909 19:19478231-19478253 TGGGGCCCACAGATGGAAAAGGG - Intronic
1166870710 19:45868762-45868784 TGGGAGACAGTGGTTGAGAAGGG + Intronic
1167487059 19:49768725-49768747 TGGGAGCCACTGTTAGCAGACGG + Intronic
1167610537 19:50505938-50505960 TGGGAGTCACTGAGTGGAAGGGG + Intergenic
1167654377 19:50753927-50753949 TAGGAGGGTCTGATTGAAAAGGG + Intergenic
1167658305 19:50780637-50780659 TGGGAGTCACACATTGAAAATGG - Intergenic
925216874 2:2103989-2104011 TGAGAGCCCCTGATAGAGAAAGG - Intronic
926423215 2:12718206-12718228 TCGGTGCCACTGATTTTAAAAGG - Exonic
927049684 2:19314539-19314561 TGGGAGTCACAGATTGGCAATGG - Intergenic
927462900 2:23314250-23314272 TGGAAGCCACATATTAAAAATGG + Intergenic
927619040 2:24632585-24632607 TGGGAGCCAATAATGGAGAAGGG - Intronic
928057790 2:28075392-28075414 TGGGAGCCACTGTTTACTAAAGG - Intronic
929852844 2:45608766-45608788 TGGGTGCCACTTATTGAGATGGG - Intronic
930615139 2:53585663-53585685 GGAGAGCCACTTCTTGAAAATGG - Intronic
931094015 2:58919450-58919472 TGGGACCCACTGATGGAAGAGGG + Intergenic
931690915 2:64834264-64834286 TTGGAGCCACACATTGATAATGG + Intergenic
932045422 2:68343968-68343990 TGGGAGCCTCAACTTGAAAAAGG - Intergenic
932294517 2:70613301-70613323 TAGGGGCCATTGATTGCAAAGGG + Intronic
933721297 2:85399088-85399110 TGGGAGCCTCTGCTTGAAAGTGG - Intronic
935981080 2:108628302-108628324 TGGGAGACACTGAAAGACAAAGG - Intronic
936061414 2:109297748-109297770 TGGGAGGCACTGACTGGATAAGG - Intronic
936856977 2:116970024-116970046 TGGGGGCCACTGATTGTCTAGGG + Intergenic
937021301 2:118658919-118658941 TGAGATCCACTGATAAAAAATGG - Intergenic
939299719 2:140319871-140319893 TTGGTGCCAATTATTGAAAAGGG - Intronic
939401637 2:141702141-141702163 TGGGCGACACTGGGTGAAAATGG + Intronic
939525856 2:143293484-143293506 TGAGACCCACTGATTGTTAAAGG + Intronic
940144700 2:150533736-150533758 TGTGAGCCATTGATAGAGAAAGG - Intronic
940368094 2:152871155-152871177 TAGGAGGCACTGGTGGAAAACGG - Intergenic
942383599 2:175419036-175419058 TGGGAGCCACAGATTCACAGGGG - Intergenic
943786975 2:191888117-191888139 TGAGAGACAGTGACTGAAAAGGG + Intergenic
945388973 2:209240865-209240887 TGGGAGACAGTGAGTGAAAGTGG + Intergenic
945872569 2:215244101-215244123 TAGAAGCCAGTGCTTGAAAAGGG - Intergenic
947235725 2:227938760-227938782 TGGTAGGACCTGATTGAAAAGGG - Intergenic
1168836412 20:880732-880754 TGGGAGCCACTGATTGAAAATGG + Intronic
1169285722 20:4305602-4305624 TGGGAGCCAGTGAATGTAGAGGG + Intergenic
1169516772 20:6325169-6325191 TGCTATCCACTGATTGAATAGGG - Intergenic
1169910461 20:10643942-10643964 TGAGAGCCACTGACTGTAACTGG - Intronic
1170217027 20:13902230-13902252 TCGGATCCACTGATTGATTAGGG + Intronic
1172368240 20:34365901-34365923 TGGGAACCACTGAGGGCAAATGG + Intronic
1172894563 20:38291426-38291448 TGGGAGCCACTGGTTCAGAGAGG - Intronic
1174670008 20:52298231-52298253 TGGAAGCCACTTCTTGAAGATGG + Intergenic
1176378355 21:6098423-6098445 TGAGACCCACTAATAGAAAACGG + Intergenic
1176676099 21:9778844-9778866 TGGGAGCCACTGGTTGGACACGG + Intergenic
1176817700 21:13621326-13621348 TGGGAGCCACTGCTTGGGGAAGG - Intronic
1177974192 21:27826928-27826950 TGGGGGCCAGTGTTTGAGAATGG - Intergenic
1179485865 21:41710498-41710520 TGGGAGCCACTGTTTTCTAAGGG - Intergenic
1179745117 21:43439804-43439826 TGAGACCCACTAATAGAAAATGG - Intergenic
1183219585 22:36504088-36504110 TGGAACTCACTTATTGAAAATGG + Exonic
1184165699 22:42726125-42726147 AGGGAGCCACTGCTTTAAACTGG - Intergenic
1184477697 22:44730287-44730309 TGGGCGCCTCTGAGTGAAGAGGG - Intronic
1185215849 22:49599645-49599667 TGGGAGCCACTGCTTGAAATGGG + Intronic
949416446 3:3819817-3819839 TGGGATACACTGATGGTAAATGG + Intronic
949648299 3:6124457-6124479 TGGTACCGACTGATTAAAAATGG - Intergenic
950896600 3:16457626-16457648 TCGGTGCCTCTGATTGAAAGTGG + Intronic
953768269 3:45760432-45760454 AGGGAGTCACTGATTGACAGGGG - Intronic
953824493 3:46238944-46238966 AGGGAGTCATTGATTGAAATGGG + Intronic
955622985 3:60885921-60885943 TGGGAGCCAATAAATGAATATGG - Intronic
955829513 3:62986272-62986294 TGGGAGCCACTGATAGAACGTGG - Intergenic
957227533 3:77469153-77469175 GGGGAGCTTCTGGTTGAAAAAGG + Intronic
957357091 3:79103954-79103976 TGGGAGCCTATGATAGGAAAGGG + Intronic
957433292 3:80142084-80142106 AGTCAGCCACTGATTGGAAAAGG + Intergenic
958214646 3:90547528-90547550 TTGAGGCCAATGATTGAAAAGGG - Intergenic
961782974 3:129332162-129332184 TAGGACCCACTAATTGAAATAGG - Intergenic
963658566 3:148091973-148091995 TGGGAATCACTGTTTGAAAACGG - Intergenic
966181701 3:177194903-177194925 TGGGAGACACTGGTGGTAAATGG - Intronic
967371437 3:188750778-188750800 TGGGAGCCACAGTTTGCAGATGG - Intronic
969511958 4:7623177-7623199 TGAGTGTCACTGATTGTAAAAGG - Intronic
971025341 4:22584023-22584045 TGGCAGCCTCAGATTTAAAATGG + Intergenic
971294830 4:25378785-25378807 TGAGAGACACTGGTTGAATAAGG + Intronic
972343028 4:38169019-38169041 TGGAAGCCACTTGTTGAAGATGG + Intergenic
973017883 4:45164580-45164602 TGGGAGGATCTGAATGAAAAGGG - Intergenic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
974356263 4:60816383-60816405 TGGAAGCCACACATTGAAGATGG + Intergenic
977474495 4:97488646-97488668 TGGAAGCCAGTTTTTGAAAATGG - Intronic
983423363 4:167549483-167549505 TGGCAACCAATGAATGAAAAAGG - Intergenic
984246998 4:177286697-177286719 TGATAGCCACTGATTGATCAGGG - Intergenic
984390673 4:179127573-179127595 TGGAAGCCACGTGTTGAAAATGG + Intergenic
984707731 4:182860140-182860162 TGGGAGCCACCTATTGCAGACGG + Intergenic
984908010 4:184648451-184648473 TGGGTGCCACTTACTGAGAATGG + Exonic
984926608 4:184812531-184812553 TGCGAGCCACTGATGTAAAGGGG + Intronic
985399431 4:189579902-189579924 TGGGAGCCACTGGTTGGACACGG - Intergenic
986776123 5:11015764-11015786 CTGGAGCCACTGATTCAGAATGG + Intronic
988692262 5:33584526-33584548 TGGGTACGACTGATTGAACAAGG + Intronic
989113879 5:37932795-37932817 TAGGAACCACTGACTGAAGATGG - Intergenic
990533181 5:56694233-56694255 TCAGAGCCACTACTTGAAAAGGG - Intergenic
990720695 5:58692722-58692744 TTGGAGACAGTAATTGAAAAAGG - Intronic
990869864 5:60419790-60419812 TGTTAGCCACTGTTTGAAAACGG - Intronic
992290434 5:75273847-75273869 TGGGTACCACTGCTTTAAAATGG + Intergenic
992369335 5:76126771-76126793 TGGGAGCCTGTGATGGAAACAGG - Intronic
992707003 5:79406430-79406452 TGGGAGCCAGAGATACAAAAGGG + Intronic
994168096 5:96629008-96629030 TGGGAGAAACTGAACGAAAATGG - Intronic
994351550 5:98752255-98752277 TGGGAGACACTGAGTGCATAGGG + Intergenic
994558038 5:101330133-101330155 TGGTAGCTACTGACTGAGAAGGG - Intergenic
995396088 5:111688698-111688720 TGGGAACCACTGATAGAGAGAGG - Intronic
995693777 5:114857364-114857386 TGGGAGGCCCTGAATGGAAATGG + Intergenic
996311756 5:122113822-122113844 TGGTAGCCACTAATTGTATATGG + Intergenic
1000642870 5:163724492-163724514 TGGGAGCAACAGACTGTAAAGGG - Intergenic
1001751065 5:174131797-174131819 TGCAAGCCACTGAATGACAAAGG + Intronic
1002885017 6:1285845-1285867 GGGGAGCCTCTGACTGTAAAAGG - Intergenic
1004734447 6:18391337-18391359 AGGGAACCACTGATTAAAACAGG + Intronic
1007851414 6:44806239-44806261 TGGGAGCCAGTGATTTAATTGGG - Intergenic
1009777465 6:68222956-68222978 TGCCAGCCAGTGATTGAACAAGG - Intergenic
1009937340 6:70249436-70249458 TGGGAGACACTGGTAGAGAAAGG + Intronic
1010744350 6:79544012-79544034 TGGGGGCCACTTATGGAAGATGG - Intergenic
1010766285 6:79779802-79779824 TGCGAGCAAGTGATTGAAAATGG + Intergenic
1015638643 6:135306221-135306243 TGGGGATCACTGATTGAATAAGG + Intronic
1016267579 6:142250471-142250493 TGAAAACCACTGACTGAAAATGG - Intergenic
1016280379 6:142410841-142410863 TGGTAGTAACTGATTGTAAATGG - Intronic
1016946816 6:149542628-149542650 TGTGTGCCACTTATTTAAAATGG + Intronic
1018373198 6:163187078-163187100 TGGGAGCCACTGATAGGGAAGGG - Intronic
1021168185 7:17366195-17366217 TGAGAGCCACTAATAGAAGAAGG + Intergenic
1021251659 7:18335077-18335099 TGGGAGTGAGGGATTGAAAAGGG + Intronic
1022993796 7:35733415-35733437 TGGGACTGACTGATTTAAAAGGG - Intergenic
1025158312 7:56630385-56630407 TGGGAGCCAGTGAAGAAAAAAGG + Intergenic
1025728274 7:64087777-64087799 TGGGAGCCAGTGAAGAAAAAAGG - Intronic
1028354363 7:89887847-89887869 TGGGAGACAGGGCTTGAAAAGGG + Intergenic
1028753684 7:94410653-94410675 TGAGAGTCACTGATTTAATAAGG - Intronic
1030374051 7:108734885-108734907 TAGGAGCTAATGTTTGAAAAGGG + Intergenic
1034321658 7:150189541-150189563 TGGGAGGGGCTGATTGCAAAAGG - Intergenic
1034771090 7:153777739-153777761 TGGGAGGGGCTGATTGCAAAAGG + Intergenic
1037311797 8:17563870-17563892 TGGGAGATACTGACTTAAAAAGG - Intronic
1038928013 8:32161772-32161794 TTGAAGCCACGTATTGAAAATGG - Intronic
1040764069 8:50885349-50885371 TTGGAGGAAATGATTGAAAATGG - Intergenic
1040770544 8:50970123-50970145 TGAGAGCCACAGAATGAGAAGGG + Intergenic
1042886392 8:73556816-73556838 TGGGAGTGACAGATTGCAAAAGG + Intronic
1042954582 8:74235840-74235862 TGAGAGGCAGTGATTGAACAAGG + Exonic
1045977192 8:108142843-108142865 TGGGAGCCACTGATTTATAATGG + Intergenic
1047058817 8:121198640-121198662 TGGAAGCCATTTGTTGAAAATGG + Intergenic
1047773428 8:128049283-128049305 TTGGAGCCACTGATAGAAGCAGG + Intergenic
1052747440 9:32454131-32454153 TGGGAACCACTGAGTTAAATGGG + Exonic
1052937651 9:34106368-34106390 TGGGGGCTAGAGATTGAAAAGGG - Intronic
1055040630 9:71867845-71867867 TGGGAGCCACATAGGGAAAATGG - Intronic
1057281464 9:93715049-93715071 TTGGAGCCAATGTTTGTAAAAGG + Intergenic
1060765745 9:126294013-126294035 TGGGAGCCACAGATGGGTAAAGG + Intergenic
1203529660 Un_GL000213v1:128175-128197 TGGGAGCCACTGCTTGGGGAAGG + Intergenic
1186133905 X:6498309-6498331 TGGGAGTCACTTATAGCAAAAGG - Intergenic
1186199212 X:7139393-7139415 TGGGAGCCACAGCTGGAAACTGG - Intronic
1186830634 X:13386706-13386728 TGGGAGCTGGTGAATGAAAAGGG - Intergenic
1190761685 X:53442361-53442383 TGGGGGCCTCTGAGTCAAAAAGG + Intergenic
1191856694 X:65633056-65633078 TGGTAGCCACAGATTTAATATGG + Intronic
1192472293 X:71409717-71409739 TGGGAGCCAGTTATTGGAGATGG - Intronic
1196384392 X:115132713-115132735 AGAGAGCCACTGAATGAAATTGG + Intronic
1197334679 X:125198715-125198737 TGGGAGTCACTAATTCAGAATGG - Intergenic
1199008886 X:142735657-142735679 TGAGAACCACTGATTTAAGATGG - Intergenic
1199665396 X:150092658-150092680 TGGAAGCCTCTGATTGAATAGGG - Intergenic
1201519481 Y:14857722-14857744 TGGGATCCAATGGTTCAAAAGGG + Intergenic
1201574359 Y:15446296-15446318 TGGGAGCCACAGGTGGAAACTGG - Intergenic
1202269811 Y:23060782-23060804 TGGGAGCCAGTGAAGAAAAAAGG - Intergenic
1202422805 Y:24694528-24694550 TGGGAGCCAGTGAAGAAAAAAGG - Intergenic
1202447984 Y:24975558-24975580 TGGGAGCCAGTGAAGAAAAAAGG + Intergenic
1202597230 Y:26553512-26553534 TGGGATACTCTGATTAAAAATGG - Intergenic