ID: 1168837224

View in Genome Browser
Species Human (GRCh38)
Location 20:885310-885332
Sequence CCCGCAGCGCGCTCGAGAAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168837224_1168837231 -5 Left 1168837224 20:885310-885332 CCGCTTCTCGAGCGCGCTGCGGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1168837231 20:885328-885350 GCGGGGTAGGGGGCGCACAGAGG 0: 1
1: 0
2: 3
3: 22
4: 292
1168837224_1168837232 4 Left 1168837224 20:885310-885332 CCGCTTCTCGAGCGCGCTGCGGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1168837232 20:885337-885359 GGGGCGCACAGAGGTGAGCCTGG 0: 1
1: 0
2: 2
3: 32
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168837224 Original CRISPR CCCGCAGCGCGCTCGAGAAG CGG (reversed) Exonic
901632331 1:10653944-10653966 GCCCCAGCGCGCCCGAGGAGCGG + Exonic
904160395 1:28518494-28518516 CCCGCGGGGCGCTCCAGCAGCGG + Intronic
913600097 1:120414640-120414662 CCCCCAGCTCCCCCGAGAAGTGG - Intergenic
920556750 1:206909734-206909756 CCCGCGGCGCGCTCGTGGAGCGG - Exonic
922806875 1:228394794-228394816 GCCGCAGCGTCCCCGAGAAGGGG + Exonic
923490340 1:234478610-234478632 CCCGCCACGCGCTCCAGTAGCGG + Exonic
923549910 1:234955350-234955372 CTAGCAGTGCGCTCAAGAAGTGG + Intergenic
1062946234 10:1464302-1464324 CAGGCAGCGCGCCGGAGAAGAGG + Intronic
1062946250 10:1464368-1464390 CGGGCAGCGTGCTGGAGAAGAGG + Intronic
1062946279 10:1464500-1464522 CAGGCAGCGCGCCGGAGAAGAGG + Intronic
1062946308 10:1464632-1464654 CGGGCAGCACGCTGGAGAAGAGG + Intronic
1062946336 10:1464764-1464786 CGGGCAGCGTGCTGGAGAAGAGG + Intronic
1064443026 10:15370786-15370808 CCCGCAACGCGCTCCCGAGGGGG - Intronic
1081890942 11:46542146-46542168 CCCTCAGTCCGCTCGAGAGGTGG + Exonic
1093170837 12:15858587-15858609 CCAGCAGGGGGCTCGAGAGGAGG + Intronic
1101773814 12:107775706-107775728 CCAGCAGCGAGCCCGAGGAGGGG + Exonic
1102676832 12:114665099-114665121 CCCGCCGCGCGGGCGCGAAGAGG + Intergenic
1105368860 13:19785453-19785475 CCTGCAGCCCTCTCCAGAAGTGG + Intergenic
1113083067 13:106536643-106536665 ACCGCAGAGCGCTCGAGATGCGG - Intergenic
1120813019 14:88824563-88824585 CCCGCAGCGCGCCTGAGAACAGG - Exonic
1122108652 14:99480472-99480494 CCCGCAGGGCGCCCGGGCAGAGG + Intronic
1124722328 15:32120971-32120993 CCCACAGCAGGCTCGGGAAGGGG - Intronic
1127717941 15:61668754-61668776 CCCGCAGCGCACTCGTAAAGCGG + Intergenic
1142369484 16:89670202-89670224 CCCCCAGAGCACTGGAGAAGGGG - Exonic
1145936544 17:28717782-28717804 CCCGCAGGCCGCTGGAGGAGGGG + Intronic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1160494807 18:79366764-79366786 CACGCAGAGCCCTAGAGAAGGGG + Intronic
1160948845 19:1656092-1656114 CCCCCAGCGCCCTCCAGCAGGGG + Intergenic
1161669004 19:5594163-5594185 CCCGCAGGGAGCGCGAGCAGCGG - Exonic
1162031714 19:7920434-7920456 CCTGGAGCGCTCGCGAGAAGCGG + Exonic
1167427451 19:49436786-49436808 CCCGCAGCCTTCTGGAGAAGCGG - Exonic
937337151 2:121069082-121069104 CATGCAGCGGGCTCCAGAAGAGG - Intergenic
947731654 2:232434722-232434744 CCCGCAGGGCGCTGGTCAAGGGG + Intergenic
1168837224 20:885310-885332 CCCGCAGCGCGCTCGAGAAGCGG - Exonic
1174204179 20:48827506-48827528 CCCGCAGGGCGCGCGGAAAGCGG - Intronic
1182995322 22:34806975-34806997 CCCGCAGAACTCTCGAAAAGAGG + Intergenic
1184491372 22:44811126-44811148 CCAGCAGCCCCCTCGAGAAAGGG - Intronic
1023038613 7:36153656-36153678 CCCGCAGAGCGGCCGAGAGGTGG + Exonic
1032279042 7:130486438-130486460 CTCGCAGCCCGCTCCAGGAGTGG + Intronic
1052362127 9:27573095-27573117 GCCGCTGCGGGCTCGAGAAAAGG - Intronic
1056992293 9:91423579-91423601 CCCGCAGCGCGCCCTGGGAGCGG + Intronic
1057347271 9:94261310-94261332 ACCGCACCCCGCTCGAGACGGGG + Intronic
1060979494 9:127784519-127784541 CCCGCAGAGGGCTGGAGAGGAGG + Intergenic
1186448672 X:9653848-9653870 TCCGCAGCGCGCCCCATAAGCGG - Intronic