ID: 1168837247

View in Genome Browser
Species Human (GRCh38)
Location 20:885407-885429
Sequence AGTCTCATCGTCGGGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 48}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168837247_1168837259 27 Left 1168837247 20:885407-885429 CCCTGCAGCCCGACGATGAGACT 0: 1
1: 0
2: 1
3: 3
4: 48
Right 1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 211
1168837247_1168837258 26 Left 1168837247 20:885407-885429 CCCTGCAGCCCGACGATGAGACT 0: 1
1: 0
2: 1
3: 3
4: 48
Right 1168837258 20:885456-885478 ACTGTAGGCACAGATTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 147
1168837247_1168837253 11 Left 1168837247 20:885407-885429 CCCTGCAGCCCGACGATGAGACT 0: 1
1: 0
2: 1
3: 3
4: 48
Right 1168837253 20:885441-885463 GAACGTCCTGTGCCCACTGTAGG 0: 1
1: 0
2: 1
3: 4
4: 80
1168837247_1168837256 23 Left 1168837247 20:885407-885429 CCCTGCAGCCCGACGATGAGACT 0: 1
1: 0
2: 1
3: 3
4: 48
Right 1168837256 20:885453-885475 CCCACTGTAGGCACAGATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 111
1168837247_1168837260 28 Left 1168837247 20:885407-885429 CCCTGCAGCCCGACGATGAGACT 0: 1
1: 0
2: 1
3: 3
4: 48
Right 1168837260 20:885458-885480 TGTAGGCACAGATTGAGGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168837247 Original CRISPR AGTCTCATCGTCGGGCTGCA GGG (reversed) Intronic
911322825 1:96435787-96435809 GGTCTCATCCTGGGGATGCAAGG - Intergenic
915759908 1:158300616-158300638 AGTCTCTTCGTAGGTCTGTAAGG + Intergenic
916295444 1:163214079-163214101 AGTCCCATGGTTGGGCTCCATGG + Intronic
920250613 1:204619985-204620007 AGCCTCATGGTGGAGCTGCAGGG + Exonic
924773414 1:247096774-247096796 AGTCTAATCTTCAGACTGCAAGG - Intergenic
1065877322 10:30008592-30008614 AGTCACATAGTCAAGCTGCAAGG - Intergenic
1067429571 10:46234221-46234243 AGGCACATCCTTGGGCTGCAGGG + Intergenic
1067444082 10:46329707-46329729 AGGCACATCCTTGGGCTGCAGGG - Exonic
1076868665 10:133182081-133182103 TGTCTCAGGGTCAGGCTGCAGGG - Intronic
1095377338 12:41546075-41546097 AGTATAATTGTCGGGCAGCATGG + Intronic
1095878089 12:47104004-47104026 AGTCTGACCTTCAGGCTGCATGG - Intronic
1097901590 12:64878777-64878799 AGTCTAATCGCTGGGTTGCAGGG + Intronic
1123945160 15:25235428-25235450 AATCACATCTTGGGGCTGCAGGG - Intergenic
1131775726 15:95796257-95796279 AGTCTCATAGTCTTCCTGCAAGG + Intergenic
1132159554 15:99525962-99525984 AGACTCATGGCCAGGCTGCAGGG + Intergenic
1132362962 15:101233202-101233224 AGTGTCATCCTGGGGCTGCAGGG - Intronic
1137015464 16:35369779-35369801 AGTCTCATCGTCTAGGTGAAGGG + Intergenic
1141187147 16:81796102-81796124 AGTCTCATCGCTGGGCTGCATGG + Intronic
1161045149 19:2130630-2130652 AGCCACAGCGTCGGGCTGGAGGG - Intronic
1161384104 19:3981908-3981930 AGTCGCATCGGCGGGGTGCCTGG + Intronic
933893540 2:86791014-86791036 AGCCTCCTCGCCGGGCTGGAAGG - Exonic
943343819 2:186713257-186713279 AGACTCATTCTAGGGCTGCATGG + Intronic
944018834 2:195076199-195076221 AGTCTCTTTGTAGGGCTGTAAGG - Intergenic
1168837247 20:885407-885429 AGTCTCATCGTCGGGCTGCAGGG - Intronic
1168863106 20:1060288-1060310 AGTCTCCTCATCCGCCTGCATGG + Intergenic
1176694238 21:9955020-9955042 AGTCTCATCCCAGGGATGCAAGG - Intergenic
1177160944 21:17547264-17547286 AGTCACATGGATGGGCTGCAGGG + Intronic
953912325 3:46899293-46899315 GGTCTCTTAGGCGGGCTGCAGGG + Exonic
957548195 3:81667774-81667796 AGTTTCATCCCCGGGATGCAAGG - Intronic
967449117 3:189602669-189602691 AGCCTCTTCTTTGGGCTGCAGGG + Intergenic
967656627 3:192057823-192057845 CGTGTCTTCGTCGGGTTGCAAGG + Intergenic
969427776 4:7135840-7135862 TGTCTCATCTCAGGGCTGCAAGG - Intergenic
972136031 4:35895339-35895361 AGTTTCATCCCCGGGATGCAAGG + Intergenic
980366858 4:131815218-131815240 AGTCTCATCCCAGGGATGCAAGG - Intergenic
983179126 4:164627061-164627083 AGTTTCATCTTAGGGATGCAAGG + Intergenic
986490491 5:8284483-8284505 AGTTTCATCCTTGGGATGCAAGG + Intergenic
1003401483 6:5794642-5794664 AGACTCCTCATCTGGCTGCAAGG - Intergenic
1010015243 6:71097856-71097878 AGTTTCATCCTAGGGATGCAGGG - Intergenic
1019924391 7:4182567-4182589 TGTCTCATAGCAGGGCTGCAGGG + Intronic
1031282642 7:119823318-119823340 ACTCTCACCCCCGGGCTGCATGG + Intergenic
1037641335 8:20746458-20746480 AGTTTCATCCTTGGGTTGCAAGG + Intergenic
1043642150 8:82467752-82467774 GGTCTCATACTCGGGATGCAGGG + Intergenic
1045901284 8:107283343-107283365 AGTCTCATGGTGGGGGTGGAGGG - Intronic
1048207946 8:132430678-132430700 AGACTCATTGTCTGTCTGCATGG - Intronic
1048237232 8:132703025-132703047 AAGCTCATCTTCAGGCTGCAAGG - Intronic
1049674910 8:143885085-143885107 GGCCTCATGGTCGGGCTGCGGGG - Intergenic
1049841743 8:144777635-144777657 TGTCTCACCCTGGGGCTGCAGGG + Intronic
1060155980 9:121320048-121320070 AGTCTCACAGTCAGGCTGCCAGG - Intronic
1061991695 9:134162958-134162980 AGCTTCATTGTCGGGGTGCAGGG + Intergenic
1187226304 X:17377180-17377202 AGTCTGCTAGGCGGGCTGCAGGG + Intronic
1189209588 X:39273433-39273455 ATTCTCATCCCCGGGATGCAAGG - Intergenic
1193283065 X:79678486-79678508 AGTTTCATCCTCGGGATGCAAGG + Intergenic
1195102075 X:101564973-101564995 AGTCTCATCCTTTGGCTGCAAGG - Intergenic