ID: 1168837248

View in Genome Browser
Species Human (GRCh38)
Location 20:885408-885430
Sequence GAGTCTCATCGTCGGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168837248_1168837260 27 Left 1168837248 20:885408-885430 CCTGCAGCCCGACGATGAGACTC 0: 1
1: 0
2: 1
3: 0
4: 49
Right 1168837260 20:885458-885480 TGTAGGCACAGATTGAGGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 216
1168837248_1168837253 10 Left 1168837248 20:885408-885430 CCTGCAGCCCGACGATGAGACTC 0: 1
1: 0
2: 1
3: 0
4: 49
Right 1168837253 20:885441-885463 GAACGTCCTGTGCCCACTGTAGG 0: 1
1: 0
2: 1
3: 4
4: 80
1168837248_1168837256 22 Left 1168837248 20:885408-885430 CCTGCAGCCCGACGATGAGACTC 0: 1
1: 0
2: 1
3: 0
4: 49
Right 1168837256 20:885453-885475 CCCACTGTAGGCACAGATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 111
1168837248_1168837258 25 Left 1168837248 20:885408-885430 CCTGCAGCCCGACGATGAGACTC 0: 1
1: 0
2: 1
3: 0
4: 49
Right 1168837258 20:885456-885478 ACTGTAGGCACAGATTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 147
1168837248_1168837259 26 Left 1168837248 20:885408-885430 CCTGCAGCCCGACGATGAGACTC 0: 1
1: 0
2: 1
3: 0
4: 49
Right 1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168837248 Original CRISPR GAGTCTCATCGTCGGGCTGC AGG (reversed) Intronic
922795313 1:228336842-228336864 GAGTCTCATCATCTCCCTGCTGG + Intronic
1070103833 10:73413843-73413865 GCGTCTCGTAGCCGGGCTGCCGG - Intronic
1079033314 11:17001666-17001688 CAGTCTCTTCCTGGGGCTGCTGG - Intronic
1079033321 11:17001717-17001739 CAGTCTCTTCCTGGGGCTGCTGG - Intronic
1079033328 11:17001768-17001790 CAGTCTCTTCCTGGGGCTGCTGG - Intronic
1079033335 11:17001819-17001841 CAGTCTCTTCCTGGGGCTGCTGG - Intronic
1083160714 11:60852600-60852622 GCGTCTCCTCGGCTGGCTGCTGG - Exonic
1103780578 12:123396144-123396166 GAGTTTCAAAGACGGGCTGCTGG - Intronic
1110640323 13:77816206-77816228 CAGTCTCATGGTCGGGCTGCAGG + Intergenic
1113482132 13:110628763-110628785 GAGTCCCATCTGCAGGCTGCGGG + Intronic
1113783158 13:112988035-112988057 GAGTCACAGGGTCAGGCTGCGGG + Intronic
1132362963 15:101233203-101233225 AAGTGTCATCCTGGGGCTGCAGG - Intronic
1137015463 16:35369778-35369800 GAGTCTCATCGTCTAGGTGAAGG + Intergenic
1143336303 17:6174153-6174175 GAGTCTCATCTGCAGGCTGATGG - Intergenic
1152230334 17:79111141-79111163 GAGGTTCATCCTGGGGCTGCAGG + Intronic
1161851783 19:6740929-6740951 GAGTCTGGTCGGCGGGCTGTGGG + Intronic
1164313450 19:24066283-24066305 GAGTCACATCATCTGGATGCTGG - Intronic
936141850 2:109947812-109947834 GCGGCTCCTCGCCGGGCTGCGGG - Intergenic
936178538 2:110245760-110245782 GCGGCTCCTCGCCGGGCTGCGGG - Intergenic
936202840 2:110423672-110423694 GCGGCTCCTCGCCGGGCTGCGGG + Exonic
942061981 2:172235573-172235595 GAGTCTCTTCCTGGGGCTCCGGG + Intergenic
942801766 2:179883767-179883789 GAGTCATATCCTAGGGCTGCTGG + Intergenic
1168837248 20:885408-885430 GAGTCTCATCGTCGGGCTGCAGG - Intronic
1171454391 20:25259344-25259366 GAGCCTCATGGCCGGGCTTCTGG + Intronic
961059870 3:123819479-123819501 GAGTCTCATCTTCTGCCAGCAGG + Intronic
961886888 3:130102521-130102543 GAGGCACATAGTAGGGCTGCTGG + Intronic
986200329 5:5573393-5573415 GTGTCACATGGTCAGGCTGCTGG - Intergenic
998321202 5:141234283-141234305 GAGTCGCATGGTGGCGCTGCAGG + Intergenic
999306646 5:150523819-150523841 GAGTCTCATCGTGGGGCCAGTGG + Intronic
1000177873 5:158775718-158775740 AAGTCTCATTATGGGGCTGCAGG - Intronic
1007762171 6:44139524-44139546 GCGGCACATCATCGGGCTGCTGG + Exonic
1010015244 6:71097857-71097879 GAGTTTCATCCTAGGGATGCAGG - Intergenic
1019924390 7:4182566-4182588 GTGTCTCATAGCAGGGCTGCAGG + Intronic
1025156500 7:56611897-56611919 GAGTCACATCATCAGGGTGCTGG + Intergenic
1025751140 7:64294813-64294835 GAGTCACATCACCTGGCTGCTGG + Intergenic
1025758584 7:64369298-64369320 GAGTCACATCATCTGGATGCTGG - Intergenic
1025760384 7:64383851-64383873 GAGTCACATCATCAGGGTGCTGG - Intergenic
1025761635 7:64401332-64401354 GAGTCACATCATCAGGGTGCTGG - Intergenic
1040380118 8:46864433-46864455 GAGTCTCATCATCTGGATTCTGG - Intergenic
1043642149 8:82467751-82467773 GGGTCTCATACTCGGGATGCAGG + Intergenic
1049558776 8:143297057-143297079 GAGTCTCAGAGGCGGGCGGCCGG - Exonic
1049674911 8:143885086-143885108 CGGCCTCATGGTCGGGCTGCGGG - Intergenic
1051365558 9:16319165-16319187 CAGTTTCTTCGCCGGGCTGCTGG + Intergenic
1196171854 X:112597116-112597138 GGGTCTCATGGTAGGGATGCAGG + Intergenic
1200859419 Y:7974571-7974593 GAGTCTCATCCTTAGGGTGCTGG + Intergenic
1202263279 Y:22992184-22992206 GAGTCACATCATCCGGATGCTGG - Intronic
1202265470 Y:23013291-23013313 GAGTAACATCATCGGGATGCTGG - Intergenic
1202416269 Y:24625925-24625947 GAGTCACATCATCCGGATGCTGG - Intronic
1202418463 Y:24647033-24647055 GAGTAACATCATCGGGATGCTGG - Intergenic
1202452323 Y:25023053-25023075 GAGTAACATCATCGGGATGCTGG + Intergenic
1202454518 Y:25044161-25044183 GAGTCACATCATCCGGATGCTGG + Intronic