ID: 1168837249

View in Genome Browser
Species Human (GRCh38)
Location 20:885415-885437
Sequence CACACTTGAGTCTCATCGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168837249_1168837259 19 Left 1168837249 20:885415-885437 CCCGACGATGAGACTCAAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 211
1168837249_1168837256 15 Left 1168837249 20:885415-885437 CCCGACGATGAGACTCAAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168837256 20:885453-885475 CCCACTGTAGGCACAGATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 111
1168837249_1168837258 18 Left 1168837249 20:885415-885437 CCCGACGATGAGACTCAAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168837258 20:885456-885478 ACTGTAGGCACAGATTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 147
1168837249_1168837260 20 Left 1168837249 20:885415-885437 CCCGACGATGAGACTCAAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168837260 20:885458-885480 TGTAGGCACAGATTGAGGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 216
1168837249_1168837253 3 Left 1168837249 20:885415-885437 CCCGACGATGAGACTCAAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168837253 20:885441-885463 GAACGTCCTGTGCCCACTGTAGG 0: 1
1: 0
2: 1
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168837249 Original CRISPR CACACTTGAGTCTCATCGTC GGG (reversed) Intronic
902159334 1:14517173-14517195 TAGACTTGAGTCTCATAGCCTGG - Intergenic
903620744 1:24696240-24696262 CACACTTGAGTGTCCTGGGCTGG - Intergenic
905708895 1:40084228-40084250 AACAATTCAGTCACATCGTCAGG - Intronic
906660108 1:47575894-47575916 CACACCTGAGCCTCCTCTTCTGG + Intergenic
907113076 1:51944693-51944715 CACAATTCAGTCACATCTTCAGG - Intronic
910718905 1:90263427-90263449 CACACTTGAATCTGATGGTGGGG + Intergenic
910956320 1:92710267-92710289 CACACTGCAGTCTCAACTTCCGG - Intronic
913117695 1:115712011-115712033 CACCCTTGTGTCTCAGCCTCAGG - Intronic
914936844 1:151989162-151989184 CACCCTTGAGTATCTTCTTCAGG + Intronic
1064196078 10:13244935-13244957 CACCCTTGAGTGTCATCTTCAGG - Intergenic
1064717755 10:18194367-18194389 CAACTTTGAGTCTCATTGTCAGG - Intronic
1067854974 10:49784246-49784268 CTTACTTGATTCTCATCCTCAGG - Intergenic
1075008512 10:118847997-118848019 CTCACTGCAGTCTCAACGTCCGG - Intergenic
1079636527 11:22748703-22748725 CAAACTTGAGTCTGACCCTCTGG + Intronic
1085290104 11:75392005-75392027 CACAGTTAAGTTTCATAGTCAGG - Intergenic
1092364709 12:7867473-7867495 AACAATTCAGTCTCATCTTCGGG - Intronic
1095283231 12:40381861-40381883 CACTCTTGAGTCTCAATGCCTGG - Intergenic
1095906606 12:47384861-47384883 CAGAATTGAGTCTGATCTTCAGG + Intergenic
1096222758 12:49842436-49842458 CACACATGAGTCTCAATATCAGG + Intronic
1102674711 12:114649753-114649775 CCCACTTGAGTCTCCCCGTCAGG + Intergenic
1104235653 12:126934099-126934121 CAGACATGAGTCTCCTCGCCTGG - Intergenic
1107533372 13:41305723-41305745 CAAACTTGCTTCTCATCCTCAGG + Intergenic
1113137464 13:107108830-107108852 CACAGTTCAATCGCATCGTCAGG + Intergenic
1116925115 14:50626473-50626495 CAAAATTGAGTCACATCTTCAGG - Intronic
1120441405 14:84545602-84545624 CAAACCTGAGTCTCAGGGTCAGG + Intergenic
1121036658 14:90710279-90710301 CACAGTTCAGTCACATCTTCAGG - Intronic
1121940761 14:98068439-98068461 CACTCTTGAGTCTCATTAACAGG + Intergenic
1139522274 16:67490752-67490774 GGCCCTTGAGTCTCATTGTCTGG - Intergenic
1142014252 16:87735514-87735536 CCCACCAGAGTCTCATCCTCTGG + Intronic
1143287734 17:5802794-5802816 CACACTTACCTCTCATCATCTGG + Intronic
1146154331 17:30507758-30507780 CACAATTCAGTCACATCTTCAGG - Intronic
1148117082 17:45182481-45182503 CACACTTGGGACTCCTGGTCAGG - Intergenic
1151329268 17:73397320-73397342 CACACTGCCGTCTCATCCTCTGG - Intronic
1156183818 18:34638490-34638512 CACACTTGAGTGTCAGTGTAGGG - Intronic
925299824 2:2803876-2803898 CACACTTGAGTCTCAGTACCCGG + Intergenic
925764083 2:7214227-7214249 CACTCTTGATTCTCATCGCCAGG - Intergenic
931804822 2:65794114-65794136 CAGAATTGAGTCTCATTGTTTGG + Intergenic
935877885 2:107531713-107531735 AACACTGGAGACTCATGGTCTGG - Intergenic
943492896 2:188579182-188579204 CACACTTGAATGTCATAATCTGG - Intronic
945650222 2:212549206-212549228 AAAACTTGAGTCTAATCTTCAGG - Intergenic
947177407 2:227381704-227381726 GACACTTGATTCTCACAGTCAGG - Intronic
947843496 2:233225018-233225040 CTCACTACAGTCTCATCTTCTGG + Intronic
948589845 2:239041994-239042016 CACAGTTGTGTCTCATCTTTTGG + Intergenic
1168837249 20:885415-885437 CACACTTGAGTCTCATCGTCGGG - Intronic
1173682435 20:44894314-44894336 AAGACTATAGTCTCATCGTCAGG - Intronic
1174194165 20:48761318-48761340 CCCACTTGAGTCTCACCTCCAGG + Intronic
1179721631 21:43319481-43319503 CACAGCTGAGTCACATCGCCCGG - Intergenic
952502867 3:33980358-33980380 CAAGCTTGAGTCTCATCTTCTGG - Intergenic
954846941 3:53567555-53567577 AACACTTGAGGCTCACCCTCTGG - Intronic
961742002 3:129038951-129038973 CACACTGGAGTCTCCTCCTCAGG - Intronic
969831218 4:9798712-9798734 CAAACTTGAGTATCAAAGTCAGG + Intronic
971356444 4:25899363-25899385 CAAACTTGAGTAGCATTGTCTGG - Intronic
981628617 4:146790705-146790727 CACACATGACTCACATGGTCAGG - Intronic
986358198 5:6949455-6949477 CACACTACATTCTCATTGTCTGG + Intergenic
991354606 5:65754791-65754813 CACCTTTGAGGCTCATCATCTGG + Intronic
997613522 5:135231266-135231288 CACACTTGAGTCTGAAAATCAGG + Intronic
1005646881 6:27847703-27847725 CACACTTGAGTCAGATAGTGTGG - Intronic
1018255041 6:161910103-161910125 CACAATTCAGTCACATCTTCAGG - Intronic
1021289947 7:18830771-18830793 CACGCCTGAGTCTCAATGTCAGG + Intronic
1022566771 7:31411586-31411608 CACAATTTAGTCACATCTTCAGG - Intergenic
1024270319 7:47636612-47636634 CACCCTTGACTGTCATCCTCGGG + Intergenic
1034119631 7:148615744-148615766 AACTCTAGAGTCTCATCATCGGG - Exonic
1041822405 8:62052274-62052296 AACAATTCAGTCTCATCTTCCGG - Intergenic
1048848042 8:138618013-138618035 CACACCAGAGTCTCTTCCTCTGG - Intronic
1057814880 9:98287072-98287094 CAGACATGAGTCCCATCGTCAGG + Intergenic
1058814650 9:108672089-108672111 CAAACTTGAGTCACATGGCCTGG - Intergenic
1061528376 9:131188155-131188177 CACAGTTGAGTATCAATGTCTGG + Intronic
1062649940 9:137570268-137570290 CATACTTGAGGCTCATCTGCAGG - Intronic
1193559524 X:83000742-83000764 CACATTTTAATCTCATCTTCAGG - Intergenic