ID: 1168837250

View in Genome Browser
Species Human (GRCh38)
Location 20:885416-885438
Sequence CCACACTTGAGTCTCATCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 57}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168837250_1168837256 14 Left 1168837250 20:885416-885438 CCGACGATGAGACTCAAGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 57
Right 1168837256 20:885453-885475 CCCACTGTAGGCACAGATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 111
1168837250_1168837260 19 Left 1168837250 20:885416-885438 CCGACGATGAGACTCAAGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 57
Right 1168837260 20:885458-885480 TGTAGGCACAGATTGAGGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 216
1168837250_1168837253 2 Left 1168837250 20:885416-885438 CCGACGATGAGACTCAAGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 57
Right 1168837253 20:885441-885463 GAACGTCCTGTGCCCACTGTAGG 0: 1
1: 0
2: 1
3: 4
4: 80
1168837250_1168837258 17 Left 1168837250 20:885416-885438 CCGACGATGAGACTCAAGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 57
Right 1168837258 20:885456-885478 ACTGTAGGCACAGATTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 147
1168837250_1168837259 18 Left 1168837250 20:885416-885438 CCGACGATGAGACTCAAGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 57
Right 1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168837250 Original CRISPR CCACACTTGAGTCTCATCGT CGG (reversed) Intronic
903400064 1:23036675-23036697 CTACACTTGTGTCTCATACTAGG - Intronic
910718904 1:90263426-90263448 ACACACTTGAATCTGATGGTGGG + Intergenic
915228683 1:154429754-154429776 CCACCCTTCAGTTTCATCTTTGG + Intronic
918003125 1:180516682-180516704 CCACAGCTGAGTATCATCCTGGG + Intergenic
922962895 1:229663423-229663445 TCACACTTGAGCCTCCTTGTTGG + Intergenic
924104047 1:240633143-240633165 CCACCATTCAGTCCCATCGTGGG - Intergenic
924496615 1:244596474-244596496 CCACACTTGGGGCTCAGCTTGGG - Intronic
1070653996 10:78258505-78258527 CCACACTTGAGCCTCAGCTGGGG - Intergenic
1070807805 10:79280746-79280768 CCACATTTGAGTCTCACCTTTGG + Intronic
1077588046 11:3469638-3469660 CCACACTTGAGTTCCATCTGGGG + Intergenic
1080110374 11:28559996-28560018 CTGCACTTGAGTCTCTTCATAGG + Intergenic
1084243742 11:67841276-67841298 CCACACTTGAGTTCCATCTGGGG + Intergenic
1091633463 12:2179616-2179638 CCAGACCTGAGTCTCAAAGTTGG + Intronic
1092364710 12:7867474-7867496 CAACAATTCAGTCTCATCTTCGG - Intronic
1093678507 12:21972548-21972570 CCACATGTGAGTCACATGGTGGG - Intergenic
1099846752 12:88036457-88036479 CCTCACTTGAGTTTCATCATTGG + Intronic
1104751921 12:131245371-131245393 CCACACTTGGGCCTCCTCCTGGG - Intergenic
1104779971 12:131413704-131413726 CCACACTTGGGCCTCCTCCTGGG + Intergenic
1106080659 13:26497780-26497802 CCACACTTTAGTGTCATCTCTGG + Intergenic
1106819448 13:33447402-33447424 CCATACTTCAGTTTCATGGTTGG - Intergenic
1107110486 13:36692259-36692281 CAACAGTTGAGGCTCATGGTGGG + Intronic
1110748874 13:79089736-79089758 ATACACTTGACTCTCATGGTGGG - Intergenic
1118706125 14:68482070-68482092 CCACACTAGAATCTCATGGGTGG - Intronic
1156183819 18:34638491-34638513 TCACACTTGAGTGTCAGTGTAGG - Intronic
1156776016 18:40789897-40789919 CCAGACTGGAATCTCATTGTAGG + Intergenic
1159727586 18:71981346-71981368 CCACACTTGACTCTCATCTCTGG - Intergenic
925492363 2:4409502-4409524 CCAAACTTGCGTGTCACCGTTGG + Intergenic
927899542 2:26809365-26809387 CCACACAGGAGTCACATCCTTGG - Intergenic
929111274 2:38407224-38407246 CAACTGTTGAGTCTCATTGTTGG - Intergenic
937791061 2:125962293-125962315 CCACTGTTGAGTCTCAGCTTCGG + Intergenic
944019943 2:195090136-195090158 CTACACTTTAGTGTCATGGTCGG - Intergenic
948426469 2:237890175-237890197 CCACCCTTGATTCTAATGGTGGG - Intronic
1168837250 20:885416-885438 CCACACTTGAGTCTCATCGTCGG - Intronic
1169016143 20:2294174-2294196 CCACACATGAGTCTCCTCTTGGG + Intergenic
1179240597 21:39587328-39587350 CCACACTAGAGCCACATCTTGGG - Intronic
1179653343 21:42829553-42829575 CATCACCTGAGCCTCATCGTGGG + Intergenic
1182880620 22:33729904-33729926 CCAGGCATGAGTCTCATTGTTGG + Intronic
951245070 3:20331391-20331413 CCTGGCTTGAGTCTCATCCTTGG + Intergenic
954616154 3:51969670-51969692 CCCCACTTCAGTCTCTTCCTGGG + Intronic
957180446 3:76870841-76870863 CCACAGTTGTTTCTCAACGTGGG - Intronic
959393720 3:105809288-105809310 CAACACTTGAGTTTCATCATAGG + Intronic
969750795 4:9109081-9109103 CCACACTTGAGTTCCATCTGGGG - Intergenic
969810695 4:9645368-9645390 CCGCACTTGAGTTCCATCGGGGG - Intergenic
971032105 4:22649893-22649915 CCACATTTGATTCTCTTCATAGG + Intergenic
981962652 4:150559998-150560020 CCATACTTGAGTTTCATCGATGG - Intronic
983813123 4:172089122-172089144 AAACAGTTGAGTCTCATCTTAGG + Intronic
987616106 5:20276561-20276583 TCACACCTGAGTCTCATCCAAGG - Intronic
1001089262 5:168725267-168725289 CCACACTTGAGTCTCTAAGGAGG - Intronic
1001594622 5:172890200-172890222 CCACAGTTCAGTCTAATCATAGG + Intronic
1001698564 5:173690470-173690492 CCACCCTTGAGTCCCAAAGTGGG - Intergenic
1016245821 6:141979566-141979588 CCATACTTGAGTTTCTTAGTTGG - Intergenic
1019642182 7:2109413-2109435 CCACTCTTGAGTGTCCTCCTGGG - Intronic
1028342171 7:89735098-89735120 CCATACTGGAGACTCATTGTTGG + Intergenic
1032152294 7:129439827-129439849 CAAAACTTGAGTCTCAGTGTGGG - Intronic
1036373997 8:8184474-8184496 CCACACTTGAGTTCCATCTCGGG - Intergenic
1036876906 8:12481165-12481187 CCACACTTGAGTTCCATCTCGGG + Intergenic
1040703242 8:50093091-50093113 CCACATATGAATCTCATCATTGG - Intronic
1045866079 8:106867003-106867025 CCACACTTGATGCTCTTCCTTGG - Intergenic
1048554471 8:135460994-135461016 CCAGACTTGTGTTTCATCGTGGG + Intronic
1054892304 9:70264335-70264357 CCCCACTTGAATATGATCGTTGG + Exonic
1056298410 9:85217094-85217116 CCTTTCTTGAGTCTCAACGTGGG + Intergenic
1057490899 9:95518595-95518617 CCACTCTTGAGTATCAGCCTTGG - Intergenic
1061935266 9:133853902-133853924 CCACAGTTGAGTCTGAATGTAGG - Intronic
1188476193 X:30595139-30595161 GAACACTTGAGTTTCATTGTTGG + Intergenic
1194519711 X:94902937-94902959 CCATACTCAAGTCTCATAGTGGG + Intergenic