ID: 1168837259

View in Genome Browser
Species Human (GRCh38)
Location 20:885457-885479
Sequence CTGTAGGCACAGATTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168837247_1168837259 27 Left 1168837247 20:885407-885429 CCCTGCAGCCCGACGATGAGACT 0: 1
1: 0
2: 1
3: 3
4: 48
Right 1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 211
1168837250_1168837259 18 Left 1168837250 20:885416-885438 CCGACGATGAGACTCAAGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 57
Right 1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 211
1168837249_1168837259 19 Left 1168837249 20:885415-885437 CCCGACGATGAGACTCAAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 211
1168837248_1168837259 26 Left 1168837248 20:885408-885430 CCTGCAGCCCGACGATGAGACTC 0: 1
1: 0
2: 1
3: 0
4: 49
Right 1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168837259 Original CRISPR CTGTAGGCACAGATTGAGGA GGG Intronic
902054717 1:13590748-13590770 CTGTAGGCAGAAATAGAGAATGG + Intronic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
904652016 1:32013271-32013293 CTGGAGGGAGAAATTGAGGAAGG - Intergenic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907651207 1:56296424-56296446 ATTGAGGCTCAGATTGAGGAAGG - Intergenic
909546798 1:76857341-76857363 ATGACGGCACACATTGAGGAAGG - Intergenic
909877547 1:80828158-80828180 ATGGAGGCCCAGATTGAGGGTGG - Intergenic
911165630 1:94722180-94722202 CTGTAGGCAGAGACAAAGGAAGG + Intergenic
912079227 1:105914020-105914042 TTATAGGCACAGAATGGGGATGG - Intergenic
912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG + Intronic
912900906 1:113647258-113647280 GAGCAGGAACAGATTGAGGAAGG + Intronic
914910750 1:151784142-151784164 ATTTAGGCACAGGTGGAGGAAGG - Intronic
915311571 1:155008132-155008154 CTGTGGGCACCGAAAGAGGAAGG - Intronic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
919957489 1:202433455-202433477 CTGTAGGCAAAGATAGAGTGAGG - Intronic
1066089354 10:32002654-32002676 CTGTCTGCACATATTGAAGAGGG + Intergenic
1067280882 10:44871760-44871782 CAGTAGGCACTGACTGGGGAGGG - Intergenic
1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG + Intergenic
1068667790 10:59695835-59695857 CTTTAGGTACATATGGAGGAAGG + Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1074520956 10:114223414-114223436 CTGGAGCCCAAGATTGAGGAAGG - Intronic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077098675 11:811209-811231 CTGTAGTCCCAGACTGAGGTGGG + Intronic
1077239223 11:1501964-1501986 CTGTAGGCACAGAGAGACGGTGG - Intergenic
1078154905 11:8791035-8791057 CTTTGGGAACAGATTCAGGAAGG - Intronic
1079120470 11:17680485-17680507 CTGAAGGCACAGACTGAGATTGG - Intergenic
1080231165 11:30018290-30018312 CTGGAGTTACAGTTTGAGGAAGG + Intergenic
1081691316 11:45080439-45080461 CTGTAGGCAGGGGGTGAGGATGG - Intergenic
1082731024 11:56797879-56797901 GTGCAGTCACAGGTTGAGGAGGG - Intergenic
1083144227 11:60746705-60746727 CTGTAGGCCCAGACTAAGCAAGG - Intergenic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1084155498 11:67310646-67310668 CTGTAGGCACAGGCTGGAGAGGG + Intronic
1086815906 11:91370393-91370415 ATGTGGGCCCAGAATGAGGAGGG + Intergenic
1090484502 11:127100797-127100819 ATGTAGGCTCAGTGTGAGGAAGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090750048 11:129738669-129738691 CTGTAGACAAAGAGTCAGGAAGG + Intergenic
1093909395 12:24728591-24728613 CTGTAGAGAGATATTGAGGATGG - Intergenic
1095245286 12:39912556-39912578 CAGTAGCCACAGATTAGGGATGG + Intronic
1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG + Intronic
1100765947 12:97865820-97865842 CTGGGGGGATAGATTGAGGAGGG - Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101970543 12:109309450-109309472 CTGTTGGCAAAGTTTGAAGAGGG - Intergenic
1102765316 12:115427888-115427910 CTTTAGGCCCAGATCAAGGAGGG + Intergenic
1102960256 12:117088130-117088152 CTGTATGCCCAAACTGAGGAGGG + Intronic
1104005702 12:124890713-124890735 CTGTAGACACAAATTGCAGATGG + Intergenic
1106329349 13:28725064-28725086 CTCTAAGCACAAATTGTGGAAGG + Intergenic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1108002046 13:45912664-45912686 CTGGAAGCACAGCTTGAAGATGG - Intergenic
1111742118 13:92217541-92217563 TTGTAGCCACAGATTGGAGATGG - Intronic
1111919417 13:94394831-94394853 CAGTAGGCACAGTTAGAGGCTGG + Intronic
1113356815 13:109588917-109588939 CCATAGTCACAGATTTAGGAAGG + Intergenic
1113868530 13:113544307-113544329 CTTTAGGCCCTGAGTGAGGAAGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1116360585 14:43991605-43991627 CTGTAGTCACAGAGTGTGGTAGG + Intergenic
1118728088 14:68644595-68644617 CTTTAGGCAGAGATTCAGGAAGG - Intronic
1120655859 14:87189155-87189177 CTGTAGGTCAAGGTTGAGGATGG - Intergenic
1121904118 14:97724060-97724082 ATGTAGCCACAGCTCGAGGAAGG - Intergenic
1122260636 14:100518766-100518788 CTGTAGTCCCAGCTAGAGGACGG + Intronic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1128301378 15:66568140-66568162 GTGGAGGCACAGAGTGGGGAAGG + Intergenic
1129117296 15:73371668-73371690 GGGCAGGCACAGATGGAGGAAGG + Intergenic
1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG + Intronic
1129906979 15:79195399-79195421 CTGTGGGCACATGCTGAGGAGGG - Intergenic
1131507142 15:93029068-93029090 CTGTTGGCGCTGACTGAGGAGGG - Intergenic
1132095961 15:98985092-98985114 CTGGACGCAGAGCTTGAGGAGGG + Intronic
1132858856 16:2060186-2060208 CTGTGAGCACAGAACGAGGACGG - Intronic
1137930628 16:52584052-52584074 CTGGAGGCACAGGGTGAGGGAGG - Intergenic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1139259888 16:65581219-65581241 CTGTAGATACACATTGAGGTTGG + Intergenic
1139725147 16:68891764-68891786 CTGTAGCTACAGCTTAAGGAAGG + Intronic
1142174909 16:88640686-88640708 CTCAAGGCACTGCTTGAGGAAGG - Intergenic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1142993469 17:3747193-3747215 CCGGAGGCACATAGTGAGGAGGG + Intronic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143520554 17:7441923-7441945 CTCAAGGGACAAATTGAGGAAGG - Intronic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1147174740 17:38647848-38647870 CTGTAGGGACAGGTTTGGGATGG + Intergenic
1147768488 17:42852172-42852194 CTGGAGGCCCAGTTTGAGGCCGG + Exonic
1147771076 17:42868104-42868126 CTGGAGGCCCAGTTTGAGGCCGG + Intergenic
1149080632 17:52652225-52652247 CAGTAGGTACAGTTTAAGGAGGG + Intergenic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1150501613 17:65656334-65656356 CTCTAGGTACAGATTGATAAAGG - Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151107314 17:71631368-71631390 GTGTAGGCAGAGTTTGTGGATGG - Intergenic
1151298278 17:73201959-73201981 CTGAAGGAACTGATTGAGGTTGG - Intronic
1151750186 17:76032746-76032768 CTCTAGGCCCAGCTGGAGGAGGG - Intergenic
1151867497 17:76813900-76813922 CTGTAGCCACAGGCTGAGGTGGG - Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG + Intergenic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161627238 19:5334378-5334400 GTGTAAGCACAGATTCAGAACGG - Intronic
1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG + Intergenic
1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG + Intergenic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1166698831 19:44870191-44870213 GTGGAGGCAGAGACTGAGGAGGG + Intronic
1166879575 19:45919574-45919596 GTGTAGCGACAGATTGAGGTGGG + Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG + Intergenic
931132823 2:59357195-59357217 CTACAGGCATAGATTGAGAATGG + Intergenic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
931741523 2:65250000-65250022 CTCTTGGCCCAGATTGAGGGAGG + Intronic
934954519 2:98606506-98606528 CTGTAGGCAGAGATTATGGTTGG - Intronic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
940716679 2:157233769-157233791 CTGTAGGCACAAAGTGATGATGG - Intergenic
940805936 2:158186479-158186501 CTCAAGTCACAGATTGAGTAAGG - Intronic
941857233 2:170243387-170243409 TTCTAAGCACAGATAGAGGAAGG + Intronic
942980392 2:182073775-182073797 CTGAAGGCACAGAATGTGAATGG + Intronic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943483699 2:188454317-188454339 TTATAGGCACAGAATGGGGAGGG + Intronic
945404806 2:209432294-209432316 CTGTAGGCAGAGAAACAGGAAGG - Intronic
946337904 2:219050571-219050593 CTGTAAGGCCAGCTTGAGGAAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169357372 20:4918914-4918936 GTGTGTGCACACATTGAGGAGGG - Intronic
1170502765 20:16991599-16991621 CTGAAGTCACAGATTGACCATGG + Intergenic
1171058195 20:21928492-21928514 CAGTAGGCACAGATTTAATATGG + Intergenic
1171222268 20:23409758-23409780 CTGTAGGCACGGATTATGGGTGG - Intronic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1171311841 20:24150989-24151011 CTGGAGGCAGAGTTTGAGGCTGG - Intergenic
1172461986 20:35126120-35126142 TTGGAGGGACAGGTTGAGGATGG - Intronic
1172479320 20:35261627-35261649 CTGTTGGCTAAGATTGAGGCAGG - Intronic
1173648056 20:44645999-44646021 CTGTGGGCGCAGAGTGAGGTTGG - Intronic
1174198726 20:48791994-48792016 CAGAAGGCACAGATTGGGGTTGG + Intronic
1174327605 20:49791687-49791709 CTGTAGTCCCAGGCTGAGGAGGG + Intergenic
1174884343 20:54315780-54315802 CTCTAGGCAAAGAATGTGGATGG + Intergenic
1175474885 20:59265186-59265208 CTGAAGGGACAGATTGCTGAAGG + Intergenic
1176161023 20:63648844-63648866 CTGTAGGCTCATACAGAGGAAGG + Intronic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1180614202 22:17117318-17117340 CTGGAAGCACAGATTGTGCATGG + Exonic
1180713223 22:17854205-17854227 CTGTTGACACAGCTTGGGGAGGG + Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1181620202 22:24085885-24085907 CTGTAGGCACACTTTCTGGAAGG + Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182890753 22:33816952-33816974 CTGTAGGGGCAGATTGTGGTGGG - Intronic
950099278 3:10347197-10347219 CCGTAAGCACAGATTGGGGGTGG - Intronic
950871306 3:16231927-16231949 CTCTAGGCACAGATCAAGGGTGG + Intronic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
955666036 3:61350053-61350075 CTATGGGCACGGATTGAGGCAGG + Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
958255599 3:91321304-91321326 CTGTAGGAACATGTTGAGGAGGG - Intergenic
958491460 3:94779469-94779491 GTGTAGCCACAAATGGAGGATGG + Intergenic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
964763906 3:160159960-160159982 CTGTAGGCAGAAGCTGAGGATGG - Intergenic
966961570 3:184944991-184945013 CTGTAGGCACTCATTGAAGTAGG - Intronic
967172477 3:186832763-186832785 CTGTGGTCACAGATAGGGGAAGG + Intergenic
967864246 3:194177331-194177353 TGGAAGGCACAGATGGAGGAAGG + Intergenic
970250554 4:14111017-14111039 TTTTATGCAAAGATTGAGGAGGG + Intergenic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
971076068 4:23151465-23151487 TTATAGGCACAGAATGAGGTGGG - Intergenic
972364303 4:38359976-38359998 CAATAGGCACAGAGTGGGGATGG - Intergenic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974339436 4:60596016-60596038 CTGAAGGAAAAGATTGGGGAAGG - Intergenic
975344810 4:73281782-73281804 CTGTAGCCAGAGCTTGAGCAGGG - Intergenic
975736733 4:77388689-77388711 CTGAGGGTAAAGATTGAGGATGG - Intronic
976783415 4:88787985-88788007 CTGTAGGCACAGATTTTTTAAGG - Intronic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
981166710 4:141567730-141567752 CTGTAGGATCAGAATGGGGAGGG - Intergenic
981281997 4:142969188-142969210 CTGTAGGCAAATTGTGAGGAGGG + Intergenic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
981940908 4:150280720-150280742 ATATGGGCTCAGATTGAGGAAGG + Intronic
984285503 4:177723444-177723466 CCGTAGCCATAGAGTGAGGATGG - Intergenic
984671688 4:182496765-182496787 CTGTAAGGACAAATTGAGGCTGG + Intronic
986585240 5:9309559-9309581 CTGGAGGCATGGATTGAAGACGG + Intronic
988077112 5:26367240-26367262 CTGTAGGCACTAATTGTGGTTGG + Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
989717559 5:44482161-44482183 CTGTAAGCACACAGTGATGAGGG + Intergenic
991422955 5:66460045-66460067 GTGTAGGCAGAGATTAGGGAGGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992751328 5:79865479-79865501 CTGTAGTCCCAGGTTGAGGTGGG - Intergenic
993516264 5:88839094-88839116 CTGTAGGCTCTGATAGAGCAAGG - Intronic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1001128117 5:169039132-169039154 TTGTAGACCCAGTTTGAGGATGG + Intronic
1003787989 6:9508557-9508579 CCATACGCAGAGATTGAGGAAGG - Intergenic
1003848235 6:10196194-10196216 CCGCAGGCAGAGAGTGAGGAAGG - Intronic
1006318272 6:33303990-33304012 CTGTGGGGAAAGATTGAGAAGGG + Intronic
1006335123 6:33416362-33416384 CTGGGGGCAGAGACTGAGGAGGG + Exonic
1007628149 6:43258123-43258145 CTCTATGCTCAGATTGAGGGTGG - Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1010342808 6:74776238-74776260 CAGTAGGGACAGATGGAGGCAGG - Intergenic
1011713467 6:90079214-90079236 CTGTAGACACAGATGTTGGAGGG - Intronic
1013296414 6:108761809-108761831 GGGTAGGCACAGATGGAGGTGGG - Intergenic
1014293393 6:119587836-119587858 CTGTAGGCACACCTTGAATATGG - Intergenic
1015074805 6:129143000-129143022 CTGTTGGCACGGATAAAGGAAGG - Intronic
1022797509 7:33743976-33743998 ATGAAGGGAAAGATTGAGGAAGG - Intergenic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1023670407 7:42570450-42570472 ATCTAGGCACAGAATGATGATGG + Intergenic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1030519211 7:110576525-110576547 AGGTATGCAAAGATTGAGGAGGG - Intergenic
1031476394 7:122227829-122227851 CTGTAGTCCCATATTTAGGAGGG - Intergenic
1032018564 7:128394296-128394318 ATGTCGGCCCAGATTGAGGGTGG - Exonic
1034392074 7:150794573-150794595 CTGAAGACACACACTGAGGAGGG + Intronic
1034676923 7:152898598-152898620 CTGTAGCCAGAGAGTGGGGATGG + Intergenic
1036784004 8:11673337-11673359 TTGTAGGCACATGTGGAGGAGGG + Intergenic
1037706030 8:21315950-21315972 ATCTATGCACAGATTGAGGTTGG - Intergenic
1037940213 8:22945590-22945612 CTGGAGGCAGAGAGTGGGGATGG - Intronic
1038388912 8:27176318-27176340 CAGTGAGCAGAGATTGAGGAAGG + Intergenic
1038871254 8:31496370-31496392 CAGTGGGCACAGAGTGAGGGAGG + Intergenic
1039645547 8:39278265-39278287 TTATAGGCACAGAATGGGGAGGG + Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040521549 8:48180593-48180615 CTGCAGGCTCAGGTAGAGGAAGG - Intergenic
1041843477 8:62298722-62298744 CTGGAGGAACAGATTTAGGTTGG - Intronic
1042590261 8:70391322-70391344 TTTTAGGCTCAGATTAAGGAGGG - Intronic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1044190166 8:89306560-89306582 CTGTAGACACTGATTTGGGAGGG - Intergenic
1044731635 8:95233059-95233081 CTGTTGGCAGGGATTGAGAATGG - Intergenic
1044776725 8:95697150-95697172 CTGTAGGCCCAAATGGTGGAGGG + Intergenic
1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG + Intergenic
1047275477 8:123402047-123402069 ATGTCGGCCCAGATTGAGGGTGG + Intronic
1048765827 8:137843416-137843438 CTGGAGGCAGAGGTCGAGGAGGG - Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1050219633 9:3372657-3372679 CTGGAGGCAGAGGTTGAGGCAGG - Intronic
1051535644 9:18154414-18154436 CCGTAGGCACAGCTAGAGGCTGG + Intergenic
1055329375 9:75167598-75167620 CTGTAGACTCAGTGTGAGGATGG - Intergenic
1056879729 9:90379717-90379739 ATGTAAGCTCTGATTGAGGATGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1186810977 X:13188119-13188141 CTGTAGGTACAGGATGAGTACGG + Intergenic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187172150 X:16862503-16862525 CTGTAGGCACTGGTATAGGAAGG - Intronic
1195907601 X:109861052-109861074 CTGAAGGCTCAGCTTGGGGAAGG - Intergenic
1196154818 X:112417211-112417233 AAGTGGGCACAGATTGAAGATGG + Intergenic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1198183194 X:134230027-134230049 GTGTATGCACAAATTAAGGAGGG - Intergenic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic