ID: 1168845062

View in Genome Browser
Species Human (GRCh38)
Location 20:938841-938863
Sequence GGCTGCACAGCCTTTGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168845062_1168845066 10 Left 1168845062 20:938841-938863 CCTGCTACAAAGGCTGTGCAGCC No data
Right 1168845066 20:938874-938896 CTTTCTGACCCTCCTGCAGCTGG No data
1168845062_1168845067 11 Left 1168845062 20:938841-938863 CCTGCTACAAAGGCTGTGCAGCC No data
Right 1168845067 20:938875-938897 TTTCTGACCCTCCTGCAGCTGGG No data
1168845062_1168845068 14 Left 1168845062 20:938841-938863 CCTGCTACAAAGGCTGTGCAGCC No data
Right 1168845068 20:938878-938900 CTGACCCTCCTGCAGCTGGGTGG No data
1168845062_1168845071 21 Left 1168845062 20:938841-938863 CCTGCTACAAAGGCTGTGCAGCC No data
Right 1168845071 20:938885-938907 TCCTGCAGCTGGGTGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168845062 Original CRISPR GGCTGCACAGCCTTTGTAGC AGG (reversed) Intergenic
No off target data available for this crispr