ID: 1168845731

View in Genome Browser
Species Human (GRCh38)
Location 20:943291-943313
Sequence GCCTCAACCCCCCTGAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168845731_1168845734 18 Left 1168845731 20:943291-943313 CCTGAACTCAGGGGGGTTGAGGC No data
Right 1168845734 20:943332-943354 TGCCACTGCACTACAGCCTGGGG 0: 20
1: 2214
2: 5344
3: 6406
4: 5307
1168845731_1168845732 16 Left 1168845731 20:943291-943313 CCTGAACTCAGGGGGGTTGAGGC No data
Right 1168845732 20:943330-943352 CGTGCCACTGCACTACAGCCTGG 0: 227
1: 27229
2: 129737
3: 210545
4: 211862
1168845731_1168845735 19 Left 1168845731 20:943291-943313 CCTGAACTCAGGGGGGTTGAGGC No data
Right 1168845735 20:943333-943355 GCCACTGCACTACAGCCTGGGGG 0: 27
1: 3338
2: 5275
3: 4454
4: 2870
1168845731_1168845733 17 Left 1168845731 20:943291-943313 CCTGAACTCAGGGGGGTTGAGGC No data
Right 1168845733 20:943331-943353 GTGCCACTGCACTACAGCCTGGG 0: 578
1: 57074
2: 157083
3: 214857
4: 180949

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168845731 Original CRISPR GCCTCAACCCCCCTGAGTTC AGG (reversed) Intergenic
No off target data available for this crispr