ID: 1168846138

View in Genome Browser
Species Human (GRCh38)
Location 20:945915-945937
Sequence GGCTCACTCATTGCGCCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168846138_1168846142 25 Left 1168846138 20:945915-945937 CCTGTTGGCGCAATGAGTGAGCC No data
Right 1168846142 20:945963-945985 ATCGCTTTGCACCGTGTGGCTGG No data
1168846138_1168846143 26 Left 1168846138 20:945915-945937 CCTGTTGGCGCAATGAGTGAGCC No data
Right 1168846143 20:945964-945986 TCGCTTTGCACCGTGTGGCTGGG No data
1168846138_1168846141 21 Left 1168846138 20:945915-945937 CCTGTTGGCGCAATGAGTGAGCC No data
Right 1168846141 20:945959-945981 CTGCATCGCTTTGCACCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168846138 Original CRISPR GGCTCACTCATTGCGCCAAC AGG (reversed) Intergenic
No off target data available for this crispr