ID: 1168846980

View in Genome Browser
Species Human (GRCh38)
Location 20:952001-952023
Sequence GCTTCGGAGGAGGGAAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168846972_1168846980 -6 Left 1168846972 20:951984-952006 CCAAGGTATCTGATGGCGCTTCG No data
Right 1168846980 20:952001-952023 GCTTCGGAGGAGGGAAGGGAGGG No data
1168846970_1168846980 1 Left 1168846970 20:951977-951999 CCATGGTCCAAGGTATCTGATGG No data
Right 1168846980 20:952001-952023 GCTTCGGAGGAGGGAAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168846980 Original CRISPR GCTTCGGAGGAGGGAAGGGA GGG Intergenic
No off target data available for this crispr