ID: 1168846980 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:952001-952023 |
| Sequence | GCTTCGGAGGAGGGAAGGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1168846972_1168846980 | -6 | Left | 1168846972 | 20:951984-952006 | CCAAGGTATCTGATGGCGCTTCG | No data | ||
| Right | 1168846980 | 20:952001-952023 | GCTTCGGAGGAGGGAAGGGAGGG | No data | ||||
| 1168846970_1168846980 | 1 | Left | 1168846970 | 20:951977-951999 | CCATGGTCCAAGGTATCTGATGG | No data | ||
| Right | 1168846980 | 20:952001-952023 | GCTTCGGAGGAGGGAAGGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1168846980 | Original CRISPR | GCTTCGGAGGAGGGAAGGGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||