ID: 1168848996

View in Genome Browser
Species Human (GRCh38)
Location 20:963899-963921
Sequence CAGGCACACGAGGCTGCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 220}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168848996_1168849013 15 Left 1168848996 20:963899-963921 CCCACCGCAGCCTCGTGTGCCTG 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1168849013 20:963937-963959 CCTGGGCAGGGCCTCTGGATGGG 0: 1
1: 0
2: 3
3: 45
4: 372
1168848996_1168849004 -3 Left 1168848996 20:963899-963921 CCCACCGCAGCCTCGTGTGCCTG 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1168849004 20:963919-963941 CTGTCCTGGGGCTCACCTCCTGG 0: 1
1: 0
2: 2
3: 41
4: 302
1168848996_1168849011 14 Left 1168848996 20:963899-963921 CCCACCGCAGCCTCGTGTGCCTG 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1168849011 20:963936-963958 TCCTGGGCAGGGCCTCTGGATGG 0: 1
1: 0
2: 2
3: 56
4: 522
1168848996_1168849008 3 Left 1168848996 20:963899-963921 CCCACCGCAGCCTCGTGTGCCTG 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1168849008 20:963925-963947 TGGGGCTCACCTCCTGGGCAGGG 0: 1
1: 0
2: 5
3: 38
4: 244
1168848996_1168849007 2 Left 1168848996 20:963899-963921 CCCACCGCAGCCTCGTGTGCCTG 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1168849007 20:963924-963946 CTGGGGCTCACCTCCTGGGCAGG 0: 1
1: 0
2: 1
3: 46
4: 345
1168848996_1168849009 10 Left 1168848996 20:963899-963921 CCCACCGCAGCCTCGTGTGCCTG 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1168849009 20:963932-963954 CACCTCCTGGGCAGGGCCTCTGG 0: 1
1: 0
2: 3
3: 73
4: 951
1168848996_1168849005 -2 Left 1168848996 20:963899-963921 CCCACCGCAGCCTCGTGTGCCTG 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1168849005 20:963920-963942 TGTCCTGGGGCTCACCTCCTGGG 0: 1
1: 0
2: 1
3: 28
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168848996 Original CRISPR CAGGCACACGAGGCTGCGGT GGG (reversed) Intronic
900138939 1:1130992-1131014 CCGGCTCCCGAGGCTGCTGTGGG + Intergenic
900364547 1:2305756-2305778 CAGTCACTTGAGGCTGCGGCGGG - Intronic
900520068 1:3101093-3101115 CTGGCACACCAGGATGCCGTGGG + Intronic
903417921 1:23197053-23197075 CAGGCACACCAGGCTTCCTTGGG - Intergenic
903477680 1:23631050-23631072 CAGACTCAGGAGGCTGAGGTGGG + Intronic
904462255 1:30687023-30687045 CAGGCAAAGGAGGCTGAGGAGGG - Intergenic
906306255 1:44721615-44721637 CAGGCTTATGAGGCTGAGGTGGG + Intronic
906888661 1:49682290-49682312 CAGGTACAGGAGGCTGAGGCAGG + Intronic
906896049 1:49773635-49773657 CAGGCACATGGGGGTGCAGTAGG + Intronic
906988568 1:50713046-50713068 CAGCTACAGGAGGCTGAGGTGGG + Intronic
907240510 1:53078502-53078524 CAGGTACTCCAGGCTGCGGATGG - Exonic
908375974 1:63541674-63541696 CAGCCTCAGGAGGCTGAGGTAGG - Intronic
908770206 1:67589146-67589168 CAGGAATTCAAGGCTGCGGTGGG + Intergenic
913653795 1:120942553-120942575 GAGGCATATGAGGCTGCGGCGGG + Intergenic
915414395 1:155729531-155729553 TTGGCTCACGAGGCTGAGGTGGG + Intronic
918190574 1:182170180-182170202 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
919880302 1:201896612-201896634 CAGGCACAGGGGGGTGCAGTGGG + Exonic
920411618 1:205765952-205765974 CAGCTACTCGAGGCTGAGGTGGG + Intergenic
920812403 1:209299055-209299077 CAGGCACACAAAGCTGAGGGAGG - Intergenic
921816351 1:219568493-219568515 AAGGCACATGAACCTGCGGTAGG - Intergenic
924223706 1:241903534-241903556 CGTGCGCACGAGGCTGAGGTGGG + Intergenic
1062971670 10:1653489-1653511 CAGGCACACAAGGCGTCGGGTGG - Intronic
1062971676 10:1653526-1653548 CAGGCACACGAGGCGTCTGGTGG - Intronic
1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG + Intronic
1063478583 10:6350283-6350305 CAGGAAGAAGAGGCTGAGGTAGG - Intergenic
1064001065 10:11664230-11664252 CAGGCAGAGAAGGCTGCGGTGGG + Intergenic
1064201150 10:13285979-13286001 CAGGAATTCGAGGCTGCAGTGGG - Intronic
1070788013 10:79173438-79173460 CAGGGACACTAGGCTGCCCTTGG - Intronic
1073198724 10:101717301-101717323 CAGCTACAGGAGGCTGTGGTGGG - Intergenic
1073382497 10:103090289-103090311 CAGGAAGTCGAGGCTGCAGTGGG - Intronic
1075271437 10:121055090-121055112 CAGGAACACCATGCTGCAGTTGG - Intergenic
1075675253 10:124291593-124291615 GAGGAACACGAGGCAGAGGTGGG + Intergenic
1076380306 10:130020788-130020810 CAGGAACACGAGGCTGTCATCGG + Intergenic
1077217788 11:1402231-1402253 CAGGCACAGCAGGCTGTGGTGGG + Intronic
1077368749 11:2171901-2171923 CAGGCACAGCAGGCAGGGGTGGG - Intergenic
1080551853 11:33379290-33379312 CAAGCAAAAGAGGCTGGGGTGGG - Intergenic
1083068577 11:59951476-59951498 AAGTCACACGAGGCAGCGGGTGG + Intergenic
1083661027 11:64251822-64251844 CGGGCAGGCGAGGCTGGGGTGGG - Intronic
1084124601 11:67090844-67090866 CAGTCCCAGGAGGCTGAGGTGGG + Intergenic
1085475413 11:76785733-76785755 CAGGCACAGCAGGGTGCGGTTGG + Intronic
1088186389 11:107176335-107176357 CAGCCACACGAGGATGCAGAAGG - Intergenic
1090464517 11:126922455-126922477 CAGGCACACGATGATGAGTTTGG - Intronic
1091454517 12:596808-596830 CAGCTACAGGAGGCTGAGGTGGG + Intronic
1093452295 12:19329945-19329967 CAGGCACACGCCACTGCGCTCGG - Intronic
1093473072 12:19525599-19525621 AAGGCACAGGAGGCTGAGGCAGG - Intronic
1094149524 12:27267516-27267538 CTAGAACACGAGGCTGAGGTGGG - Intronic
1098339575 12:69438020-69438042 CAGGTACAGGAGGCTGAGGCAGG + Intergenic
1101642908 12:106601362-106601384 CAGGGACAGGAGACTGGGGTGGG + Intronic
1102366643 12:112342343-112342365 CAGGCTCAGGAGGCTGAGGTGGG + Intronic
1103739722 12:123083104-123083126 CAGCTACAGGAGGCTGTGGTGGG + Intronic
1103916714 12:124379554-124379576 CCGTCACACCAGGCTGTGGTGGG - Intronic
1104746120 12:131211466-131211488 CCGACACAGGAGGCTGCTGTTGG - Intergenic
1106066011 13:26350542-26350564 CAGGAAGTCGAGGCTGCAGTGGG + Intronic
1106086398 13:26546202-26546224 CAGGCACAACAGGCTGCTGTGGG - Intergenic
1106192440 13:27465487-27465509 CAGGCGGTCGAGGCTGCAGTGGG + Intergenic
1107512942 13:41103230-41103252 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
1112268325 13:97946387-97946409 CATACACAGGAGGCTGAGGTAGG - Intergenic
1112341953 13:98559900-98559922 CAGCCACTCGAGGCTGAGGCAGG + Intronic
1112948775 13:104963360-104963382 CAGTCACACGAGGCTGCCTTGGG + Intergenic
1114291141 14:21289393-21289415 CAGCTACTCGAGGCTGAGGTGGG + Intronic
1114496529 14:23136871-23136893 CATGCACACGAGGTTGCTGTGGG + Intronic
1117406826 14:55411936-55411958 CAGGAACACGCGGCGGCGGAGGG - Intergenic
1118934222 14:70271529-70271551 CAGCTACTCGAGGCTGAGGTAGG + Intergenic
1121742709 14:96265324-96265346 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1122496177 14:102157148-102157170 CAGCTACAAGAGGCTGAGGTGGG + Intronic
1123632635 15:22272682-22272704 CAGGCTCAGGGGGATGCGGTGGG + Intergenic
1123632653 15:22272746-22272768 CAGGCTCAGGGGGATGCGGTGGG + Intergenic
1123632668 15:22272809-22272831 CAGGCTCAGGGGGATGCGGTGGG + Intergenic
1123632687 15:22272873-22272895 CAGGCTCAGGGGGATGCGGTGGG + Intergenic
1123708047 15:22964812-22964834 CAGGCAGACGGGGCTGGGGTTGG - Intronic
1124913511 15:33946299-33946321 CAGGCAAAGGAGGCAGAGGTAGG + Intronic
1129825127 15:78629873-78629895 CAGCCACAGGACGCTGCCGTTGG + Exonic
1131385309 15:92001470-92001492 CGGGCACAGGAGGCTGGGGCAGG - Intronic
1132491148 16:232061-232083 CAGCCACTCGAAGCTGAGGTTGG + Intergenic
1132598216 16:762730-762752 CAGGAACAGGAGGCTGCCGAGGG - Exonic
1132773072 16:1575439-1575461 CACGCTCAGGAGGCTGAGGTGGG + Intronic
1133825240 16:9272606-9272628 CAGGGTGAGGAGGCTGCGGTGGG + Intergenic
1135543393 16:23349411-23349433 CAGGAGCTCGAGGCTGCAGTGGG + Intronic
1135566601 16:23516079-23516101 CAGGCAGTTGAGGCTGCAGTGGG - Intronic
1136624136 16:31451378-31451400 CAGGAAGTCGAGGCTGCAGTGGG + Intergenic
1137231239 16:46569557-46569579 CAGGCACCAGAAGCTGCGCTGGG - Intergenic
1139950149 16:70664574-70664596 CAGGCCCGCGGGGCTGGGGTGGG - Intronic
1140760489 16:78104428-78104450 CAGGAGCTCGAGGCTGCAGTGGG + Intronic
1141050862 16:80762110-80762132 CAGGAAGTCGAGGCTGCAGTGGG + Intronic
1141513369 16:84526805-84526827 CCTGCACACAGGGCTGCGGTGGG - Intronic
1141897968 16:86970793-86970815 CAGGCAGACGGGGCTTCTGTGGG - Intergenic
1141970350 16:87477763-87477785 CAGGCTCAGGGGGATGCGGTGGG - Intronic
1147012139 17:37458786-37458808 CATGCTCAGGAGGCTGAGGTGGG - Intronic
1147124811 17:38359692-38359714 CAGGCACTCAATTCTGCGGTAGG + Intronic
1147796872 17:43050159-43050181 CAGGCACAGGAGGCAAAGGTGGG + Intronic
1148603180 17:48909016-48909038 TGGGCACACGAGGCGGGGGTTGG - Intronic
1148773122 17:50078307-50078329 TAGGCACAGCAGGCTGGGGTGGG - Intronic
1151265377 17:72951186-72951208 CAGGAAGGCGAGGCTGCAGTGGG + Intronic
1151398269 17:73839213-73839235 CAGGGTCCCGAGGCTGGGGTAGG + Intergenic
1151556831 17:74850906-74850928 CAGGGACCCGAGGCTGGGGGAGG - Intronic
1151761783 17:76108258-76108280 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1152033742 17:77859186-77859208 CAGGCAAAGGAGGCTCTGGTGGG - Intergenic
1152364964 17:79850200-79850222 CAGGCTCACGTGGCTGAGGGCGG + Intergenic
1153566271 18:6421033-6421055 CAGGCTCAGGAGGCTGATGTGGG - Intergenic
1153702266 18:7707563-7707585 CAGGAATTCGAGGCTACGGTGGG + Intronic
1154036524 18:10808160-10808182 CAGGCACTCAAGGCTGCAGTGGG - Intronic
1156205698 18:34883421-34883443 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1156690125 18:39697487-39697509 AAGGCAGAGGAGGCTGAGGTGGG + Intergenic
1156752539 18:40476744-40476766 CAGCTACAGGAGGCTGAGGTGGG - Intergenic
1158711698 18:59843379-59843401 AAGGCAGTCGAGGCTGCAGTGGG + Intergenic
1158907810 18:62030896-62030918 CAGCTACTCGAGGCTGAGGTGGG + Intergenic
1160512287 18:79459288-79459310 CAGGCCCACGAGGCACGGGTGGG + Intronic
1160925128 19:1540681-1540703 CAGGCACGCTGGGCTGGGGTGGG + Intergenic
1161431626 19:4235813-4235835 CAGTTACAAGAGGCTGAGGTGGG + Intronic
1161866901 19:6839763-6839785 CTGGGAGGCGAGGCTGCGGTGGG - Intronic
1163802093 19:19372263-19372285 CAGGAAGCCGAGGCTGCAGTAGG - Intergenic
1163816891 19:19471879-19471901 CAGGCAGAGGAGGCTGCTTTTGG + Intronic
1165397969 19:35577535-35577557 CAGGAGCACGGGGCTGTGGTGGG - Intergenic
1167072728 19:47230406-47230428 CGGGCGCACGTGGCGGCGGTGGG - Intronic
1167586824 19:50380060-50380082 CAGCCACTCGAGGCTGAGGAGGG + Intronic
1167745536 19:51349557-51349579 CAGCCTCAGGAGGCTGAGGTGGG - Intronic
1168665364 19:58201076-58201098 CAGGAAGTCGAGGCTGCAGTGGG - Intronic
926134334 2:10326026-10326048 GAGGCCCACGAGGCTGCAGAGGG + Intronic
926633211 2:15156325-15156347 CAGGCACAGGAGTGTGAGGTTGG + Intergenic
929158827 2:38811583-38811605 CAGCCACACGAGGATGCAGGAGG + Intronic
929188165 2:39116737-39116759 CAGTCTCAGGAGGCTGAGGTGGG + Intronic
931198268 2:60073551-60073573 CACACACACGAGTCTGCAGTGGG + Intergenic
932199375 2:69812231-69812253 CAGCTACTCGAGGCTGAGGTGGG - Intronic
932592026 2:73073326-73073348 CAGTTACAGGAGGCTGCTGTGGG - Intronic
933046779 2:77548005-77548027 CAGGAAGTCGAGGCTGCAGTGGG + Intronic
933867414 2:86534308-86534330 CAGGTACGGGAGGCTGAGGTAGG - Intronic
937020310 2:118644495-118644517 CAGGGACACAAGGCTGAAGTTGG + Intergenic
937310048 2:120896437-120896459 CAGGCCCACCAAGCTGGGGTGGG + Intronic
940328475 2:152450731-152450753 CAGGCAGAGGAGACTGCGATGGG - Intronic
941713200 2:168736574-168736596 CAGGCACTGGAGGCTGAGGCAGG - Intronic
944724902 2:202461119-202461141 CAGGCACAAGACGCTGCACTCGG + Intronic
946260076 2:218481765-218481787 CAGCTACTCGAGGCTGAGGTGGG - Intronic
947618597 2:231574359-231574381 CAGGGACACAAGGCTGAGGAGGG + Intergenic
948042043 2:234910085-234910107 AAGCCACCCAAGGCTGCGGTAGG + Intergenic
948663970 2:239523244-239523266 CAGGGCCACGAGGGTGCAGTGGG + Intergenic
1168848996 20:963899-963921 CAGGCACACGAGGCTGCGGTGGG - Intronic
1169446359 20:5674751-5674773 CAGTCCCAGGAGGCTGAGGTAGG - Intergenic
1172137108 20:32694240-32694262 CAGGAGGTCGAGGCTGCGGTGGG + Intergenic
1172870022 20:38130045-38130067 CAGGCTCAGGAGGCTGAGATGGG + Exonic
1174129552 20:48333132-48333154 CAGGAATTCAAGGCTGCGGTGGG - Intergenic
1174322579 20:49753710-49753732 CAGTCCCAGGAGGCTGAGGTGGG - Intergenic
1175790601 20:61737876-61737898 CAGAGACAGGAGGCTGTGGTTGG + Intronic
1176262380 20:64188810-64188832 CAGGCACCGGAGCCTGCGGTGGG + Intronic
1177504826 21:22006788-22006810 CAGACACACTAGGGTGGGGTTGG + Intergenic
1178496108 21:33087666-33087688 CAGGCACTTGAGGCTGCCTTTGG - Intergenic
1179993160 21:44959069-44959091 CAGGCACACCAGGAAGCTGTGGG + Intronic
1180067294 21:45418805-45418827 CAGGCACAGGAGGTCGGGGTGGG - Intronic
1180091147 21:45534371-45534393 CAGACACAGGAGGCTGCGTGGGG + Intronic
1181567269 22:23746702-23746724 CAGTCCCAGGAGGCTGAGGTGGG - Intronic
1183472488 22:38017009-38017031 CAGGCAGCAGAGGCTGGGGTGGG - Intronic
1184388804 22:44191275-44191297 GAGGGACCCGAGGCTGGGGTGGG - Intronic
1185038400 22:48491103-48491125 CAGGCAGACGAGGCCACCGTGGG + Intronic
950367200 3:12495747-12495769 CATGCAGACGAGGCTGAGTTTGG + Intronic
951893378 3:27587418-27587440 CCTGCACAGGAGGCTGAGGTGGG - Intergenic
952766717 3:36960664-36960686 CAGGAAGTCGAGGCTGCAGTGGG + Intergenic
953842442 3:46400103-46400125 CAGGCCCGGGAGGCTGGGGTGGG - Intergenic
954007343 3:47602216-47602238 CAGGAATTCGAGGCTGCAGTGGG + Intronic
954250814 3:49365910-49365932 CAGGCACACACTGCTGCGCTTGG - Intronic
954314680 3:49794753-49794775 GAGCCACACGGGGCTGCTGTAGG + Intronic
956911851 3:73826303-73826325 TAGGCACAAGAGGCTGCAGATGG + Intergenic
962156827 3:132956830-132956852 CAGGCACACGGGGCAGGGGCGGG - Intergenic
965444199 3:168754189-168754211 CAGCTACTCGAGGCTGAGGTAGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966878323 3:184336053-184336075 CAGGCACGCTAGCCTGCGCTCGG - Intronic
968110707 3:196044478-196044500 CAGCAACTCGAGGCTGAGGTGGG + Intronic
970599234 4:17627715-17627737 CAGGCACAGGAGGCTGAGGCAGG + Exonic
973222394 4:47743594-47743616 CAGGCACAAGAGGCTGGGAACGG + Intronic
976693539 4:87894064-87894086 GGGGCACTCGAGGCTGCAGTGGG - Intergenic
976725287 4:88210299-88210321 CAGCCACTGGAGGCTGAGGTGGG - Intronic
977757536 4:100690761-100690783 CAGGAAATCGAGGCTGCAGTGGG + Intronic
978233010 4:106423703-106423725 CAGCCTCAGGAGGCTGAGGTGGG + Intergenic
978284685 4:107061998-107062020 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
978441937 4:108742621-108742643 CAGGCACACAAAGCTCCAGTGGG + Intronic
983653183 4:170053708-170053730 CACACACAGGAGGCTGAGGTGGG - Intergenic
985665481 5:1179705-1179727 CAGGAACACAAGGCTACGCTGGG + Intergenic
985677844 5:1241496-1241518 CAAGCACAGGAGGCTGGGGTTGG - Intronic
986328912 5:6703116-6703138 CAGGCTCAGGAGGCTGCAGTGGG - Intergenic
987124654 5:14800836-14800858 CAGCTACCCGAGGCTGAGGTGGG - Intronic
987358908 5:17088988-17089010 CAGCCTCAGGAGGCTGAGGTGGG - Intronic
990821641 5:59847100-59847122 CAGGCACACAAGGCTGCTCAAGG + Intronic
990821789 5:59848965-59848987 CAGGCACACAAGGCTGCTCAAGG + Intronic
991087885 5:62664920-62664942 CAGTTACTCGAGGCTGAGGTAGG + Intergenic
992895609 5:81242572-81242594 CAGGCACACAAAGATGGGGTTGG + Intronic
994092312 5:95820237-95820259 CAGCCACGGGAGGCTGAGGTGGG + Intronic
995381146 5:111534747-111534769 AATGCACACAAGGCTGCTGTAGG + Intergenic
996442080 5:123502735-123502757 CATGCACATGAGGCTGAGGCAGG + Intergenic
998558801 5:143151842-143151864 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
998602931 5:143603688-143603710 TAGGCAGACGAGGCTGGGCTCGG + Intergenic
998743242 5:145228862-145228884 CAGCCACACGAGGATGCAGGAGG - Intergenic
1001819935 5:174702565-174702587 CAGCTACAGGAGGCTGAGGTGGG - Intergenic
1002092945 5:176815453-176815475 CAAGGACACGAGGCTTGGGTTGG - Intronic
1002487771 5:179551061-179551083 CAGGCACGCGGGGCTGCGGGGGG - Intronic
1003190535 6:3870741-3870763 GCGGCACAGGAGGCTGAGGTGGG - Intergenic
1003637885 6:7850474-7850496 CAAGCACAGGAGGCTGCTGTTGG + Intronic
1004420519 6:15465337-15465359 CAGCTACAGGAGGCTGAGGTGGG + Intronic
1007041934 6:38730345-38730367 CAGGCACAAGATGCTGAGATAGG - Intronic
1007780841 6:44253653-44253675 GGGGCACTCGAGGCTGCAGTGGG - Exonic
1013552275 6:111219415-111219437 GATGCACAGGAGGCTGAGGTGGG + Intronic
1015219309 6:130785924-130785946 CCAGCACAGGAGGCTGAGGTGGG - Intergenic
1019653260 7:2172277-2172299 CAAGCACACGAGGCTCGGGTGGG + Intronic
1019807882 7:3141933-3141955 CAGCCTCAGGAGGCTGAGGTGGG + Intronic
1020132795 7:5569066-5569088 GTGGCACAGGAGGCTGAGGTGGG + Intergenic
1020705657 7:11540905-11540927 CAGGAACTCTAGGCTGTGGTAGG + Intronic
1021101124 7:16586643-16586665 CAGGCGGAGGAGGCTGCGGGAGG + Intergenic
1024251300 7:47507770-47507792 CTGGCACAGGAGGCTGTGTTGGG - Intronic
1026150014 7:67779973-67779995 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
1027128937 7:75577039-75577061 AAAGCACAGGAGGCTGGGGTTGG + Intronic
1032383034 7:131503732-131503754 TGGGTACACGAGGCTGGGGTAGG + Intronic
1033733507 7:144200494-144200516 CAGCCCCAGGAGGCTGAGGTGGG - Intergenic
1033749543 7:144350479-144350501 CAGCCCCAGGAGGCTGAGGTGGG + Intergenic
1034267673 7:149789123-149789145 CAGGCTCAGGACGCTGCTGTAGG - Intergenic
1035118355 7:156543998-156544020 CAGGCCCATGAGGCTGCGCGCGG - Intergenic
1041125289 8:54631775-54631797 CAGGCACACGCCACTGCGCTGGG + Intergenic
1042251903 8:66764580-66764602 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1043389053 8:79773638-79773660 CAGGCACAAGAGGCTCAGGAAGG - Intergenic
1044426801 8:92061697-92061719 CAGGCAGAAGAGGCTGTGCTTGG - Intronic
1046218236 8:111178195-111178217 CGGGCACAGGAGCCTGAGGTGGG - Intergenic
1047254968 8:123207595-123207617 CAGGCCCACGCGGCTGCAGCTGG + Exonic
1047534265 8:125704736-125704758 CTGGCACACCAGGCTACTGTGGG + Intergenic
1049404701 8:142447225-142447247 CAGGGAGACGGGGCTGAGGTGGG + Intergenic
1049709455 8:144057099-144057121 CAGGCACAGTGGGCTGCTGTCGG - Exonic
1049719389 8:144108602-144108624 CAGCCACAGCAGGCTGAGGTTGG - Exonic
1049879090 8:145049937-145049959 CAGGCATGGGAGGCTGAGGTGGG + Intergenic
1052456411 9:28705026-28705048 CAGATACAGGAGGCTGAGGTGGG - Intergenic
1057494848 9:95553040-95553062 CAGGCACAGCAGGCTGGGGCCGG + Intergenic
1057616628 9:96596745-96596767 CAGCTACAGGAGGCTGAGGTGGG + Intronic
1060414917 9:123423424-123423446 CAGGAACACATGGCTGTGGTAGG + Intronic
1060578050 9:124716129-124716151 CAGGAAGAGGAGGCTGCAGTGGG + Intronic
1061181464 9:129027474-129027496 CAGGCCCACGATGCTGAGATTGG - Intronic
1061287662 9:129633321-129633343 CTGGCACTGGAGGCTGCTGTTGG + Intronic
1062118538 9:134821951-134821973 CAGCCACAGGAGGCTGCTGAGGG + Intronic
1062354016 9:136153405-136153427 ATGGCACACGAGGCTGGGCTGGG + Intergenic
1187350800 X:18515088-18515110 CAGACACACGAGGCTGGGCGCGG - Intronic
1195779085 X:108440487-108440509 AAGGCTCACTAGGCTGTGGTGGG + Intronic
1199371553 X:147055847-147055869 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
1200155914 X:153974877-153974899 GAGGCCCAGGAGGATGCGGTGGG + Intronic
1201299173 Y:12491059-12491081 CACACACATGAGGCTGCTGTCGG + Intergenic