ID: 1168850547

View in Genome Browser
Species Human (GRCh38)
Location 20:973752-973774
Sequence CACTCTATGAGGCCTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 330}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168850547_1168850555 -7 Left 1168850547 20:973752-973774 CCCCTCCCAGGCCTCATAGAGTG 0: 1
1: 0
2: 2
3: 16
4: 330
Right 1168850555 20:973768-973790 TAGAGTGCTGGCCCACTGGATGG 0: 1
1: 0
2: 1
3: 6
4: 110
1168850547_1168850558 18 Left 1168850547 20:973752-973774 CCCCTCCCAGGCCTCATAGAGTG 0: 1
1: 0
2: 2
3: 16
4: 330
Right 1168850558 20:973793-973815 CTTAGCATCCTTCAATACCCTGG 0: 1
1: 0
2: 2
3: 34
4: 269
1168850547_1168850560 28 Left 1168850547 20:973752-973774 CCCCTCCCAGGCCTCATAGAGTG 0: 1
1: 0
2: 2
3: 16
4: 330
Right 1168850560 20:973803-973825 TTCAATACCCTGGTCTTTGAAGG 0: 1
1: 2
2: 0
3: 19
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168850547 Original CRISPR CACTCTATGAGGCCTGGGAG GGG (reversed) Intronic
900481615 1:2902292-2902314 CACTCTCTGAGCCCAGGGAAAGG + Intergenic
901374313 1:8826600-8826622 CACTCTGGGAGGCCGAGGAGTGG + Intergenic
901396944 1:8988559-8988581 CACTTACTGAGGCCTGAGAGGGG - Intergenic
902791504 1:18771571-18771593 CACTCTGTGTGCCCTGGGTGTGG - Intergenic
902896188 1:19481740-19481762 CACCCCAAAAGGCCTGGGAGTGG + Intronic
903893220 1:26584222-26584244 CATTCTATAAGGCCTGGGAATGG + Intergenic
904095346 1:27972670-27972692 CTCTCTGTGTAGCCTGGGAGAGG + Exonic
905106979 1:35569531-35569553 CACTCTCTGAGGCATGGAGGTGG - Intergenic
905207216 1:36349787-36349809 CTGTCTAAGAGGCCTGGGAAAGG + Intronic
905266912 1:36760626-36760648 AACCATAAGAGGCCTGGGAGGGG + Intergenic
905285191 1:36874739-36874761 CAGGCTATGAGGACTGGGACAGG + Intronic
905395816 1:37665688-37665710 CATTCTATGGGGCCTGTGTGGGG + Intergenic
905575629 1:39042248-39042270 CACTTTGGGAGGCCGGGGAGGGG + Intergenic
905657894 1:39697565-39697587 CACCCATTGAGGCCTGGGGGTGG - Intronic
905914663 1:41676366-41676388 CACTCCCTGAGGCCTGGGTGAGG + Intronic
906703912 1:47880721-47880743 CACTGTCTGAGTCCTGGGACTGG + Intronic
907165415 1:52406235-52406257 CACTCTGGGAGGCCCGGGGGGGG - Intronic
907340374 1:53731204-53731226 GACTCTCTGAGGCCATGGAGGGG - Intronic
907502417 1:54891205-54891227 CACTTTGGGAGGCCTGGGGGAGG + Intergenic
908333225 1:63092654-63092676 CATTCTATGAAGGCTGAGAGAGG - Intergenic
908340744 1:63176222-63176244 CATTCTATGAAGGCTGAGAGAGG - Intergenic
909778237 1:79511145-79511167 CACACTTTTAAGCCTGGGAGGGG - Intergenic
910019939 1:82575317-82575339 CACTTTGGGAGGCCTAGGAGGGG + Intergenic
910298332 1:85675916-85675938 AACTCTATGAAGGCTGAGAGAGG - Intronic
911362372 1:96894730-96894752 CACACTCTAATGCCTGGGAGGGG - Intergenic
912731438 1:112109949-112109971 CAGTCTATGAAGGCTGTGAGAGG - Intergenic
916597248 1:166256579-166256601 CACTCTGTAAAGCCTGGAAGAGG - Intergenic
916930619 1:169574934-169574956 AACTCTATGAAGGCAGGGAGTGG - Intronic
917864985 1:179185997-179186019 CACTCTGGGAGGCCCGGGCGGGG + Intronic
918194223 1:182206821-182206843 CACTATATGGGGCCTGGAATGGG - Intergenic
920340701 1:205273523-205273545 GACTCTAAGAGGCCTGGATGGGG - Intergenic
920685467 1:208105763-208105785 CACTCTCTGAGGCCTGAGAATGG + Intronic
921081159 1:211739205-211739227 CTCTTTATTAGGCCTTGGAGAGG - Intergenic
921402594 1:214742632-214742654 AATTCTATGAAGCCTGAGAGAGG - Intergenic
922253676 1:223872962-223872984 AATTCCATGAGGACTGGGAGAGG + Intergenic
922305578 1:224341121-224341143 CTCCCCACGAGGCCTGGGAGCGG + Intergenic
922333192 1:224595874-224595896 AATTCTATGAGGGCTGAGAGAGG + Intronic
1063105504 10:2988356-2988378 CATTCCATGTGGACTGGGAGTGG - Intergenic
1063241442 10:4174135-4174157 CACTTTAGGAGGCTGGGGAGAGG - Intergenic
1063520786 10:6738751-6738773 CACTCTGTAAGGGCTGGGATAGG + Intergenic
1063788588 10:9413244-9413266 CATTCTATGAAGGCTGAGAGAGG + Intergenic
1064912393 10:20416836-20416858 CACTTTGGGAGGCCTGGGTGGGG - Intergenic
1066461421 10:35615710-35615732 CACTCAATGGGGCCAGGGTGTGG + Intergenic
1067045604 10:42983560-42983582 CCCTCACTGAGCCCTGGGAGTGG - Intergenic
1067547372 10:47203522-47203544 TACTCAATGAGTCCTAGGAGAGG + Intergenic
1067764537 10:49075164-49075186 CTCTCTGTGAGGCCTGGAGGAGG + Intronic
1068910802 10:62376171-62376193 TACTCTAAAAGTCCTGGGAGGGG - Exonic
1070626324 10:78053814-78053836 GACTCTTTGAGGGCTGGAAGTGG + Intronic
1074460670 10:113634272-113634294 CACTTTATTGGGCTTGGGAGAGG - Intronic
1075186105 10:120259316-120259338 ACCTCTATGAAGCCTGAGAGAGG - Intergenic
1075315941 10:121453691-121453713 CACTTCATCAGGCCTGGGGGTGG - Intergenic
1075971153 10:126654465-126654487 AATTCTATGAAGCCTGAGAGAGG - Intronic
1076463047 10:130659422-130659444 CATGCTTTGAGGCATGGGAGAGG - Intergenic
1077045733 11:544489-544511 GATTCTATGGGGCCTGGTAGAGG - Intronic
1077207493 11:1351971-1351993 CCAGGTATGAGGCCTGGGAGGGG - Intergenic
1077207630 11:1352303-1352325 CCAGGTATGAGGCCTGGGAGGGG - Intergenic
1077207649 11:1352346-1352368 CCAGGTATGAGGCCTGGGAGGGG - Intergenic
1078397709 11:10996030-10996052 CTCTCTCTGAGAGCTGGGAGAGG + Intergenic
1080133645 11:28827296-28827318 CAGTCCATGAAGACTGGGAGAGG - Intergenic
1081713037 11:45230232-45230254 CAGCATATGAGGCCTGGCAGTGG - Intronic
1081779602 11:45700782-45700804 AACTCTCTGAGCCCTGGGATGGG - Intergenic
1084178881 11:67437004-67437026 CTCTCCCTGAGGCCTGGGATGGG + Intronic
1084289466 11:68152541-68152563 CCCTCACTGAGGCCTGGGGGCGG - Intergenic
1085110341 11:73882255-73882277 CACTTTGGGAGGCCAGGGAGCGG - Intronic
1085386287 11:76160087-76160109 CACTTCATGGGGCCTGGCAGGGG + Intergenic
1086554506 11:88092935-88092957 CACTTTATGAAGCCTGGCTGTGG - Intergenic
1088738681 11:112749157-112749179 CCCTGCATGAGGCCAGGGAGAGG + Intergenic
1089415294 11:118284185-118284207 AATTCTATGAAGCCTGAGAGAGG + Intergenic
1089692146 11:120193495-120193517 CACTGTATGGGGCCTGTGCGGGG + Intergenic
1091691605 12:2601198-2601220 CACCCTTTGAGGCCAGGAAGGGG + Intronic
1093089578 12:14906114-14906136 CACTCTAGGAGGCCGAGGCGGGG - Intronic
1093946297 12:25113588-25113610 AACTAGATGAGGGCTGGGAGCGG - Intronic
1095719355 12:45384182-45384204 CACTCTATGAAGGCTGAGAGAGG - Intronic
1096805856 12:54140802-54140824 CACTCTATGATTCCTGAGACAGG + Intergenic
1097170434 12:57109940-57109962 CCCTCTGAGAGGCCTGGGAGAGG - Intronic
1097885593 12:64725749-64725771 CACTTTAGGAGGCCAAGGAGGGG + Intronic
1098921733 12:76308764-76308786 CATTCCATGAAGGCTGGGAGAGG - Intergenic
1099116030 12:78625121-78625143 CACTCCATGAAGGCTGGCAGTGG - Intergenic
1100386544 12:94109381-94109403 GACTCAGAGAGGCCTGGGAGGGG - Intergenic
1101439840 12:104695287-104695309 CAAACTATCAGGCCTTGGAGGGG - Intronic
1102569889 12:113820979-113821001 CACTGTGTGAGCCCTGGCAGGGG + Intronic
1102753722 12:115319821-115319843 CACTCTGGAAGACCTGGGAGGGG + Intergenic
1103156322 12:118688189-118688211 CATTCTTTGAGGGCTGGGTGGGG + Intergenic
1105337679 13:19488628-19488650 GATTCAATGAAGCCTGGGAGAGG - Intronic
1107076940 13:36332244-36332266 CACTCTGGGAGGCCAAGGAGAGG + Intronic
1108472301 13:50779658-50779680 CAATCCGTGAGACCTGGGAGAGG - Intronic
1112374986 13:98830752-98830774 CACTCCATGAGGGCTGGGAGAGG + Intronic
1113511319 13:110856953-110856975 CACTCAAGCAGCCCTGGGAGAGG - Intergenic
1113737352 13:112688611-112688633 CACCCTAAGAGGCTTGGGGGCGG + Intergenic
1114263329 14:21055557-21055579 CACTCAGGGAGGCCTGGGAATGG - Intronic
1114398601 14:22388982-22389004 CTCTCTTTGAGGGCTGGCAGAGG - Intergenic
1115964865 14:38876886-38876908 TACTCTTTGAGGCCTGCGAGAGG - Intergenic
1116181685 14:41543397-41543419 CACTCTCTGAGCACTGGGAAGGG - Intergenic
1117342869 14:54806725-54806747 CACTTTAGGAGGCCGAGGAGGGG + Intergenic
1117351225 14:54883812-54883834 AACACTATGAGGCCTGGGGCAGG + Intronic
1119702883 14:76767408-76767430 AACACAATGAGGCCTGGGGGAGG - Intronic
1121028957 14:90641382-90641404 GACTCCCTGAAGCCTGGGAGTGG - Intronic
1121534673 14:94683209-94683231 CACTTTGGGAGGCCTAGGAGGGG + Intergenic
1121914501 14:97824409-97824431 CACTCTATGTGGTCTGGAGGTGG + Intergenic
1122106851 14:99464440-99464462 CACTCACTGAGGCCTGGAACAGG + Intronic
1122834246 14:104423359-104423381 CGTTCTCAGAGGCCTGGGAGGGG + Intergenic
1127503293 15:59574789-59574811 CACTCTGGGAGGCCGAGGAGGGG - Intergenic
1128730157 15:70015447-70015469 CATGCCATGAGGCCTGGGTGGGG + Intergenic
1131831924 15:96359983-96360005 GACTCTCTGCGGCCTTGGAGGGG + Intergenic
1132356612 15:101175497-101175519 GGTTCTATGGGGCCTGGGAGGGG + Intergenic
1137099074 16:36352347-36352369 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1137113045 16:36584026-36584048 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1137117914 16:36664536-36664558 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1137129070 16:36849106-36849128 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1137131316 16:36886469-36886491 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1137135023 16:36948292-36948314 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1137140233 16:37034558-37034580 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1137160152 16:37364029-37364051 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1137164816 16:37441141-37441163 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1137175326 16:37614746-37614768 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1137182926 16:37740428-37740450 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1137185670 16:37785938-37785960 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1137188415 16:37831794-37831816 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1137192401 16:37897696-37897718 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1137196156 16:37959496-37959518 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1137202386 16:38062413-38062435 CACTCTGTGAAGCCTGCCAGTGG + Intergenic
1138246849 16:55473877-55473899 AACTCTATGAAGGCTGAGAGAGG - Intronic
1139094264 16:63685258-63685280 CAATCTATGAGGTCTGTAAGAGG + Intergenic
1139377695 16:66510579-66510601 CACTCACAGGGGCCTGGGAGCGG + Exonic
1139778439 16:69331200-69331222 CACTTTGGGAGGCCGGGGAGGGG + Intronic
1142411943 16:89921398-89921420 CACTCTGAGATGCCTGGAAGGGG + Intronic
1143204627 17:5133284-5133306 CACTCTTTCAGTCCTGGGAAGGG + Intronic
1144875689 17:18395969-18395991 CACTCTTTCAGTCCTGGGAAGGG + Intergenic
1145156537 17:20548452-20548474 CACTCTTTCAGTCCTGGGAAGGG - Intergenic
1146741505 17:35288149-35288171 CACTGTGTCAGGCCTTGGAGAGG - Intergenic
1146844035 17:36172538-36172560 CACTCTTTCAGTCCTGGGAAGGG - Intronic
1146856338 17:36260473-36260495 CACTCTTTCAGTCCTGGGAAGGG - Intronic
1146864278 17:36327902-36327924 CACTCTTTCAGTCCTGGGAAGGG + Intronic
1146872248 17:36384384-36384406 CACTCTTTCAGTCCTGGGAAGGG - Intronic
1146879609 17:36435469-36435491 CACTCTTTCAGTCCTGGGAAGGG - Intronic
1147067137 17:37928490-37928512 CACTCTTTCAGTCCTGGGAAGGG + Intronic
1147075134 17:37985008-37985030 CACTCTTTCAGTCCTGGGAAGGG - Intronic
1147078669 17:38008051-38008073 CACTCTTTCAGTCCTGGGAAGGG + Intronic
1147086659 17:38064554-38064576 CACTCTTTCAGTCCTGGGAAGGG - Intronic
1147094607 17:38131986-38132008 CACTCTTTCAGTCCTGGGAAGGG + Intergenic
1147102602 17:38188517-38188539 CACTCTTTCAGTCCTGGGAAGGG - Intergenic
1147591774 17:41688676-41688698 GACTCTAGGAGAGCTGGGAGGGG - Intergenic
1147750273 17:42727654-42727676 CAGTCAATGAAGCCTGTGAGTGG - Exonic
1148897856 17:50850521-50850543 CCTTCTATGAGGTCTGGGACAGG - Intergenic
1149847177 17:60014984-60015006 CACTCTTTCAGTCCTGGGAAGGG - Intergenic
1150085536 17:62271601-62271623 CACTCTTTCAGTCCTGGGAAGGG - Intergenic
1153932206 18:9887864-9887886 CACTGAAGGAGGCCGGGGAGAGG + Exonic
1155162042 18:23203991-23204013 CAGTCTAGGAGGACAGGGAGTGG + Intronic
1155645330 18:28070679-28070701 AGCTCTGTGAGGGCTGGGAGTGG - Intronic
1155741246 18:29290817-29290839 AATTCTATGAAGGCTGGGAGAGG + Intergenic
1158493784 18:57934416-57934438 CACACTCTGGGGACTGGGAGGGG - Intergenic
1158919220 18:62170977-62170999 CAATCTATGAAGGCTGAGAGAGG + Intronic
1161343558 19:3755546-3755568 CACTTTAGGAGGCCGGGGGGGGG + Intronic
1162096589 19:8313518-8313540 AACTCTGTGAGGTCTGGGCGCGG - Intronic
1163105031 19:15118390-15118412 CACTTTTAGAGGCCTGGGTGGGG + Intronic
1163128232 19:15255967-15255989 CACCCAATGAGGACAGGGAGGGG + Intronic
1163625877 19:18389240-18389262 TTCTCTAGGAGACCTGGGAGGGG + Intergenic
1163665911 19:18604078-18604100 CACTCTAGAAGGGCTGAGAGGGG - Intronic
1163709907 19:18840296-18840318 CTCCCTGTGAGGACTGGGAGGGG - Intronic
1163995150 19:21038671-21038693 CACTTTGTGAGGCCAGGGTGGGG - Intronic
1165277150 19:34764245-34764267 TACTCTTTGATGCCTGGTAGTGG - Intronic
1165308327 19:35015732-35015754 CACACTACAAGGCCTGGGAGTGG + Intronic
1165324195 19:35104661-35104683 CACCCTCTGTGGCCTGGGCGGGG + Intergenic
1165495889 19:36151818-36151840 CGCTCTCTGAGGCCTGGACGTGG + Intronic
1166231472 19:41427611-41427633 GGCTTTGTGAGGCCTGGGAGGGG + Intronic
1168652510 19:58100662-58100684 CACTCTAGGAGGCCAGCGGGCGG + Intronic
925871405 2:8274562-8274584 AATTCTATGAAGCCTGAGAGAGG - Intergenic
926057522 2:9783270-9783292 CTCTCTATGAAGGCTGAGAGGGG + Intergenic
927201174 2:20578993-20579015 CAGCCTGTGAGGCTTGGGAGGGG - Intronic
927694577 2:25231192-25231214 CACTCCAGGAGGGCTGGGGGAGG - Exonic
929505221 2:42523054-42523076 CACTCTGGGAGGCCTGAGATGGG - Intronic
930035860 2:47084613-47084635 CAGACCATGAGGCCTGAGAGAGG + Intronic
930035867 2:47084643-47084665 CAGACCATGAGGCCTGAGAGAGG + Intronic
930035881 2:47084703-47084725 CAGACCATGAGGCCTGAGAGAGG + Intronic
930322114 2:49868671-49868693 CATTCTATGAAGGCTGAGAGAGG - Intergenic
930559256 2:52939779-52939801 AATTCTATGAAGCCTGAGAGAGG + Intergenic
933328364 2:80866848-80866870 AACTCTATGAAGGCTGTGAGAGG - Intergenic
933942389 2:87255192-87255214 CAAGTTATGTGGCCTGGGAGAGG + Intergenic
934490854 2:94761303-94761325 CACTCTTTGAATCATGGGAGGGG - Intergenic
936337837 2:111606377-111606399 CAAGTTATGTGGCCTGGGAGAGG - Intergenic
936403842 2:112185365-112185387 CACACTTGGAGGCCTGGGTGAGG - Intronic
937525451 2:122763461-122763483 CAGTCCATGAAGACTGGGAGAGG - Intergenic
938338699 2:130521207-130521229 CCCTCTATGAGACCTGGCTGGGG - Exonic
938351141 2:130599543-130599565 CCCTCTATGAGACCTGGCTGGGG + Exonic
938621353 2:133057598-133057620 AATTCTATGAAGCCTGAGAGAGG + Intronic
938898907 2:135781432-135781454 CACTCTATGAGGCCTTTTATAGG + Intronic
939273474 2:139970203-139970225 CACTCAATGAGGCATTGAAGAGG + Intergenic
939934119 2:148268325-148268347 CACTTTGGGAGGCCTGGGTGGGG - Intronic
944255761 2:197622086-197622108 CATTCTATGAAGGCTGAGAGAGG + Intronic
944834282 2:203562808-203562830 GACTCTCGGAGCCCTGGGAGAGG + Intergenic
945413584 2:209542760-209542782 AATTCTATGAAGCCTGAGAGAGG - Intronic
946018001 2:216619694-216619716 AACTCTTTCCGGCCTGGGAGAGG - Intergenic
946121903 2:217523479-217523501 AAGTCTAAGAGGCCTGGGAAGGG + Intronic
946575266 2:221068724-221068746 CATTCTATGAAGGCTGAGAGTGG + Intergenic
947629028 2:231639870-231639892 CACTTTGGGAGGCCTGGGGGGGG - Intergenic
1168850547 20:973752-973774 CACTCTATGAGGCCTGGGAGGGG - Intronic
1169568772 20:6884541-6884563 CTTTCTATGAGGAATGGGAGTGG - Intergenic
1170088862 20:12567755-12567777 TACTCTATGATGCATGGGAATGG - Intergenic
1170549005 20:17459719-17459741 TATTCTATGAGGCTTGGGTGAGG - Intronic
1171093058 20:22304322-22304344 GACTCTATGAGCCCTTGGATAGG + Intergenic
1171880608 20:30615415-30615437 CACTCTTTGAATCGTGGGAGGGG - Intergenic
1172493522 20:35360756-35360778 CACTATCTGTGTCCTGGGAGAGG - Intronic
1174607214 20:51769310-51769332 GACTGTCTGAGGCCTGAGAGTGG - Intergenic
1175331051 20:58164317-58164339 CACTCTGTGAGTCCAGGGGGAGG - Intergenic
1176042611 20:63073301-63073323 CTCTCTAGGAGGCCAGGGATGGG + Intergenic
1179110580 21:38442059-38442081 AATTCTATGAGCCCTGAGAGAGG + Intronic
1181040215 22:20188507-20188529 CTCTCTGTGAGGCCTGGGCAGGG - Intergenic
1181534088 22:23532921-23532943 ACCTCCATGCGGCCTGGGAGGGG - Intergenic
1183366961 22:37411945-37411967 CAGTCCCTGAGGGCTGGGAGTGG - Intronic
1183378204 22:37477300-37477322 CACTCCATGTGGCTTGGGAGGGG + Intronic
1183533261 22:38376106-38376128 GATTCAATGAAGCCTGGGAGAGG - Intronic
1184004147 22:41696629-41696651 CACTCTATGATCCCTGGCAGGGG - Exonic
1184195196 22:42922893-42922915 CACTCTAAAAGACCTGGGGGTGG + Intronic
1185310912 22:50153706-50153728 CCCTCTGCGAGGCCTTGGAGAGG - Intronic
1185376170 22:50483526-50483548 CCCTGTAGGAGGCCAGGGAGGGG + Exonic
949515762 3:4805467-4805489 CAGTCTTTGAGGTCTGGGTGGGG - Intronic
950967315 3:17155217-17155239 TCCTCTATGCAGCCTGGGAGGGG - Intergenic
951851832 3:27150067-27150089 AACTCTATGAAGTCTGAGAGAGG + Intronic
954129906 3:48555312-48555334 CACACTGTGAGTCCTGGCAGGGG - Intronic
954325328 3:49860390-49860412 CCATCTTTGAGGCCTGGAAGGGG - Intronic
954438174 3:50506980-50507002 CACTGCATGAGGCTTGGAAGGGG - Intergenic
956800172 3:72750416-72750438 CACTCCAAGAGGCCAGGAAGAGG + Exonic
957536784 3:81515892-81515914 AATTCTATGAAGGCTGGGAGAGG + Intronic
957765566 3:84620404-84620426 AATTCTATGAAGGCTGGGAGAGG - Intergenic
958091964 3:88888104-88888126 AACTCTATGAAGACTGAGAGTGG + Intergenic
958930510 3:100202946-100202968 CACTTTGGGAGGCCGGGGAGAGG + Intergenic
959290991 3:104474307-104474329 AATTCTATGAAGCCTGAGAGAGG + Intergenic
960540607 3:118857541-118857563 CTCTCTATGAAGGCTGAGAGAGG + Intergenic
962415519 3:135178206-135178228 CACTTTGGGAGGCCGGGGAGGGG + Intronic
962488768 3:135870130-135870152 CGCACTTTGAAGCCTGGGAGAGG - Intergenic
964368526 3:155974465-155974487 CACTTTGGGAGGCCTAGGAGGGG - Intergenic
965860625 3:173145739-173145761 AATTCTATGAAGCCTGAGAGAGG - Intergenic
966106133 3:176336186-176336208 AACTCTATGAAGGCTGAGAGAGG + Intergenic
969704833 4:8786008-8786030 CACTCCAAGAAGCCTAGGAGGGG + Intergenic
972786238 4:42329113-42329135 CACCCTATAAGGGCTGGGTGTGG - Intergenic
974188840 4:58476121-58476143 CACTTTGGGAGGCCTGGGGGGGG + Intergenic
974656226 4:64826081-64826103 AATTCTATGACGCCTGTGAGAGG - Intergenic
976058463 4:81097814-81097836 AACTCTATGAAGGCTGAGAGAGG - Intronic
977105904 4:92884242-92884264 AACTCTATGAAGGCTGAGAGAGG - Intronic
978763020 4:112375558-112375580 AACTCTATGAAGACTGAGAGAGG - Intronic
979576867 4:122302863-122302885 AATTCTATGAAGGCTGGGAGAGG + Intronic
982085084 4:151826875-151826897 AACTCTATGAAGGCTGAGAGAGG - Intergenic
982697075 4:158614577-158614599 CATTCTATGAAGGCTGAGAGAGG - Intronic
982788893 4:159567474-159567496 CACACACTGAGGCCTGTGAGAGG - Intergenic
983220571 4:165039963-165039985 CAATCTACAAGGTCTGGGAGGGG + Intronic
984174522 4:176399735-176399757 AATTCTGTGAAGCCTGGGAGAGG + Intergenic
984226755 4:177044493-177044515 CAATCTCTGTGGCCTGTGAGAGG + Intergenic
984439000 4:179741742-179741764 AAATCTATGAAGCCTGAGAGAGG + Intergenic
984828156 4:183946870-183946892 CACTCTGGGAGGCCAAGGAGGGG - Intronic
984920855 4:184762938-184762960 ATCCCTATGAGGCCTGGCAGAGG + Intronic
985185560 4:187311458-187311480 AATTCTATGAAGCCTGAGAGAGG - Intergenic
985344095 4:188984945-188984967 CACTCTGAGGGGCCTGGGTGAGG + Intergenic
985657864 5:1141367-1141389 CTCTCCATTAGGACTGGGAGAGG - Intergenic
986561282 5:9062704-9062726 CACTTTGTGAGGCCAGAGAGGGG - Intronic
987626191 5:20404116-20404138 AACTCTATGAAGACTGAGAGAGG - Intronic
987802570 5:22718295-22718317 CACTTTAAGAGGTGTGGGAGTGG - Intronic
989760134 5:45005382-45005404 AATTCTATGAGGGCTGAGAGAGG + Intergenic
989952955 5:50322574-50322596 AATTCTATGAAGACTGGGAGAGG + Intergenic
992462815 5:76978044-76978066 CATTCTATGAAGGCTGAGAGAGG + Intronic
994696958 5:103084578-103084600 CAGTCTATGAAGACTGGAAGAGG - Intergenic
997176260 5:131781165-131781187 AACTCTATGAAGTCTGAGAGAGG + Intronic
997466867 5:134094054-134094076 GACTCCATGAGGCCAGTGAGCGG + Intergenic
997890723 5:137673844-137673866 CAGTCTCTGAGCTCTGGGAGGGG + Intronic
999670995 5:153959172-153959194 GCCTCTTTGGGGCCTGGGAGAGG + Intergenic
999993493 5:157069890-157069912 CACTTTAGGAGGTCAGGGAGGGG - Intergenic
1000586675 5:163108432-163108454 AACTCTATGAAGGCTGAGAGAGG - Intergenic
1000758270 5:165187727-165187749 AACTCTATGAAGGCTGAGAGAGG + Intergenic
1001728460 5:173928595-173928617 CACTGTCTCAGGCATGGGAGGGG + Intronic
1005558023 6:27007911-27007933 CAGTCTGTGAAGACTGGGAGAGG + Intergenic
1006844924 6:37055560-37055582 CAATCTATGAGGCGCTGGAGGGG - Intergenic
1007719887 6:43878680-43878702 CATACTATGAGGCGTGCGAGGGG + Intergenic
1007776788 6:44228475-44228497 CCCTGTATGAGGCCTGCCAGCGG + Intronic
1008622544 6:53285365-53285387 AATTCTGTGAAGCCTGGGAGAGG + Intronic
1010070069 6:71733776-71733798 CACTCACTGGGGCCTGTGAGGGG + Intergenic
1010382528 6:75241698-75241720 CACTTTGGGAGGCCGGGGAGGGG + Intronic
1011217213 6:85017849-85017871 CACTCAAGCAGTCCTGGGAGAGG + Intergenic
1013307533 6:108863326-108863348 CACTCTAGGAGGCCAAGGTGGGG - Intronic
1017367580 6:153662976-153662998 CAGTCTTTGAGGACTGGGAGAGG - Intergenic
1018732476 6:166662825-166662847 CATTAAATGAGGCCTCGGAGTGG + Intronic
1018867207 6:167755584-167755606 CTCTCACTGGGGCCTGGGAGCGG + Intergenic
1019885902 7:3904746-3904768 CACTTTGGGAGGCCTAGGAGGGG + Intronic
1020256336 7:6504636-6504658 CTGGCTATGGGGCCTGGGAGGGG + Intronic
1020548978 7:9573826-9573848 CACTCTGTGAAGGCTGAGAGAGG - Intergenic
1020765023 7:12308570-12308592 CATTCTATGAAGGCTGAGAGAGG - Intergenic
1021282822 7:18740967-18740989 AATTCTATGAGGGCTGAGAGAGG + Intronic
1021549485 7:21854786-21854808 CACTCTGGGAGGCCAAGGAGGGG - Intronic
1024562262 7:50654374-50654396 GACTCTGTGAGGCTTGGCAGCGG - Intronic
1024786297 7:52911445-52911467 CACTCTCAGGGGCCTGGGAAGGG - Intergenic
1026299962 7:69089330-69089352 CACTCCATGAGGCCTGGGCAGGG + Intergenic
1030038246 7:105426502-105426524 AACTCTATGAAGACTGTGAGAGG - Intergenic
1030597934 7:111562074-111562096 CCCTTTGTGAGGACTGGGAGAGG + Exonic
1032936182 7:136734381-136734403 CACTTTAGGAGGCCAAGGAGGGG + Intergenic
1034417295 7:150971861-150971883 GACTCTGTGAGGACTGGCAGAGG + Intronic
1035245188 7:157558673-157558695 CAGTCAGTGCGGCCTGGGAGGGG - Intronic
1035360487 7:158310373-158310395 CATTCTGTGAGGCCTGGGAAAGG + Intronic
1035958816 8:4113859-4113881 AACTCTATGAAGGCTGAGAGAGG + Intronic
1036604870 8:10295800-10295822 GAGTCCATGAGACCTGGGAGAGG - Intronic
1037289570 8:17336524-17336546 TACTCGCTGAGTCCTGGGAGGGG - Intronic
1037634962 8:20693333-20693355 CACTCCTTGGGGCCTGGCAGAGG - Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038082009 8:24149362-24149384 CACTCCATAAAGACTGGGAGAGG - Intergenic
1039451488 8:37678234-37678256 CACTTTGTGAGGCCGAGGAGGGG + Intergenic
1039716458 8:40114688-40114710 CACTTTAGGAGGCCTGGGACGGG - Intergenic
1040020431 8:42736110-42736132 CACTTTGGGAGGCCTGGGGGTGG - Intronic
1045050279 8:98318433-98318455 CACACACTGGGGCCTGGGAGAGG - Intergenic
1045187341 8:99852438-99852460 CACTTTAAGAGGTCAGGGAGAGG + Intronic
1047947404 8:129895248-129895270 CACTTTAGGAGGCCAGGGTGGGG - Intronic
1049333645 8:142070040-142070062 CACGCTATGAGGTCTGAGATTGG - Intergenic
1049469198 8:142767859-142767881 CACTTAATGAGGCCCAGGAGAGG + Intronic
1049499587 8:142954742-142954764 CACTCTATGACGCTTGGGAGCGG + Intergenic
1049763089 8:144339579-144339601 CACAACATGGGGCCTGGGAGGGG - Intergenic
1050678696 9:8085278-8085300 CACTGTATCAGGCATGGGAGAGG + Intergenic
1051796611 9:20878936-20878958 CTCTCTATGAGAGCTGGGACAGG - Intronic
1052339857 9:27354236-27354258 CACCCTATCAGGCCTCTGAGTGG - Intronic
1053495047 9:38543634-38543656 CACTCTTTGAATCGTGGGAGGGG - Intronic
1053667140 9:40324385-40324407 CACTCTTTGAATCATGGGAGGGG + Intronic
1053916730 9:42949496-42949518 CACTCTTTGAATCATGGGAGGGG + Intergenic
1054378286 9:64464413-64464435 CACTCTTTGAAGCATGGGAGGGG + Intergenic
1054517470 9:66051898-66051920 CACTCTTTGAATCATGGGAGGGG - Intergenic
1054923722 9:70566975-70566997 CACAGTATGAGGTTTGGGAGAGG + Intronic
1055404162 9:75956995-75957017 CATTTTTTTAGGCCTGGGAGAGG + Intronic
1057020400 9:91692909-91692931 CACTCTGTGAGACATGGGATGGG + Intronic
1057329421 9:94098913-94098935 ATCTTTATGAGGCCTGGCAGAGG + Intronic
1057673596 9:97118620-97118642 CACTTTAGGAGGCCTGGCGGAGG + Intergenic
1058806825 9:108600945-108600967 CAGACTATCAGACCTGGGAGGGG - Intergenic
1059264858 9:113017583-113017605 AAGTCTATGAAGCCTGAGAGAGG + Intergenic
1059568762 9:115411537-115411559 TACTCTATGAGGTTTGGGTGAGG - Intergenic
1060366718 9:123023426-123023448 CACTTTGGGAGGCCAGGGAGGGG - Intronic
1060745072 9:126125987-126126009 CTCTGTATCAGCCCTGGGAGGGG - Intergenic
1061015442 9:127978582-127978604 CACTCTAGAAGGCCAGGGGGCGG + Intronic
1061508725 9:131047604-131047626 CACTCTGGGAGGCCGGGGTGGGG + Intronic
1061789743 9:133052666-133052688 TGCTCTGTGAGGCCTGGCAGCGG - Intronic
1062118299 9:134820927-134820949 CATCCTATGAGGCATGGGCGTGG - Intronic
1062541420 9:137043302-137043324 GGCTCTATCAGGCCTGGAAGTGG - Intronic
1186748977 X:12602029-12602051 TACTTTATTAGACCTGGGAGTGG + Intronic
1187040420 X:15589221-15589243 AACTTTATGAGGCCTGGGAATGG + Intronic
1189923125 X:45923127-45923149 CATTCTATGAGGGCTAAGAGAGG + Intergenic
1190525159 X:51321819-51321841 CACTTTAGGAGGCCAAGGAGAGG - Intergenic
1191813275 X:65215506-65215528 AACTCTATGAAGGCTGAGAGAGG - Intergenic
1195281515 X:103338991-103339013 CAGTCTGTGAAGACTGGGAGAGG + Intergenic
1195570680 X:106395458-106395480 TCCTCTATGTGGCCTGGGACTGG + Intergenic
1198323102 X:135539369-135539391 AACTCTATGAAGGCTGAGAGAGG - Intronic
1198863114 X:141091886-141091908 TACCCTATGAGGGCCGGGAGGGG + Intergenic
1198899576 X:141495501-141495523 TACCCTATGAGGGCCGGGAGGGG - Intergenic
1199087313 X:143642540-143642562 CACTCTTTGAGGCTTGGAAAGGG - Intergenic
1199220015 X:145306739-145306761 CACTCTCAGAGGACTGGAAGTGG - Intergenic
1199912047 X:152297252-152297274 AACTATATGTGGCCTGGGACTGG - Intronic
1200389183 X:155926479-155926501 AACTCTATGAAGGCTGAGAGAGG - Intronic
1202594176 Y:26519921-26519943 GATTCAATGAAGCCTGGGAGAGG + Intergenic