ID: 1168852511

View in Genome Browser
Species Human (GRCh38)
Location 20:986260-986282
Sequence AGTCCCTCCCTGCTGCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168852511 Original CRISPR AGTCCCTCCCTGCTGCTCAC TGG Intronic
900463453 1:2812331-2812353 AGTGGTTCCCAGCTGCTCACAGG + Intergenic
901013278 1:6212861-6212883 CGTGCCTCCCAGCTGCTAACTGG + Intronic
901809312 1:11757983-11758005 AGGTCCCCCCTGCTCCTCACTGG - Intergenic
903047544 1:20575793-20575815 AGTCCCTCTCTCCCACTCACTGG + Intergenic
903578323 1:24352899-24352921 TGTCTCTCCCTGCCGCTCTCAGG - Intronic
903696974 1:25214872-25214894 AGTCCTTTCCTGTTGCTCAGAGG - Intergenic
903778910 1:25809543-25809565 AGAGCCTCGCTGCTGCCCACTGG + Intronic
906069292 1:43006018-43006040 AGCCTCTCTCTGCTGCTCTCAGG + Intergenic
907241816 1:53085186-53085208 AGTCCCTCCCTGCCACGCCCTGG + Exonic
908839923 1:68269294-68269316 AATCTCTCACTGTTGCTCACTGG + Intergenic
911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG + Intergenic
911690710 1:100830732-100830754 CACCCCTCCCTGCTGCTGACAGG + Intergenic
912450771 1:109766233-109766255 AGTGACTTCCCGCTGCTCACGGG + Intronic
912519214 1:110233869-110233891 CCTCCCTCCCTGCTCCTCCCTGG + Exonic
912717232 1:111990879-111990901 AGTCCCTCCCTGAAGCCCATGGG + Intergenic
914935206 1:151973076-151973098 ACTCCCTCCCTCTTGCTGACTGG + Intergenic
914985353 1:152451450-152451472 AGGCGCTCCCTGCTGGCCACGGG + Intergenic
916107513 1:161442131-161442153 AGTCGCTCGCTGCTGCTCAGCGG - Intergenic
916109097 1:161449549-161449571 AGTCGCTCGCTGCTGCTCAGCGG - Intergenic
916110685 1:161456930-161456952 AGTCGCTCGCTGCTGCTCAGCGG - Intergenic
916112270 1:161464340-161464362 AGTCGCTCGCTGCTGCTCAGCGG - Intergenic
916113857 1:161471721-161471743 AGTCGCTCGCTGCTGCTCAGCGG - Intergenic
917523694 1:175768718-175768740 ATGCCCTCCCTGCTCCTCTCAGG - Intergenic
918249094 1:182685672-182685694 TGTCCTTCCCTGCTGCACTCTGG + Intergenic
918437635 1:184533073-184533095 AGTGGCTTCCTGCTGCTCCCGGG + Intronic
919444343 1:197683087-197683109 AGTCCCCTCCTGCTGCTTCCTGG - Intronic
919782373 1:201229211-201229233 CCTCCAGCCCTGCTGCTCACAGG - Intergenic
921188911 1:212692901-212692923 AGCCACTGCCTGCTGCTCCCTGG - Intronic
921365239 1:214367579-214367601 GGTCCCTCCATGGTGGTCACAGG + Intronic
921925692 1:220708394-220708416 AGCCCCTCCCTTCTTCTCAGAGG - Intergenic
922573450 1:226646927-226646949 AGCCCCTGGCTTCTGCTCACTGG + Intronic
924028692 1:239865540-239865562 TGTCCCTCTCTGCTTCTGACAGG - Intronic
1066063682 10:31746332-31746354 AGCCCCTGCCTGCTCCTGACTGG - Intergenic
1067456080 10:46420207-46420229 AGTCCAGCCCAGCTACTCACCGG + Intergenic
1067524824 10:47031882-47031904 TGCTCCTCCCTGCTGCTCCCAGG - Intergenic
1067631119 10:47964432-47964454 AGTCCAGCCCAGCTACTCACCGG - Intergenic
1069369005 10:67724130-67724152 AGTCCCTCACCCCTGCTCCCTGG + Intergenic
1069713599 10:70506716-70506738 GTGCCCTCCCTGCTGCTCAGAGG - Intronic
1069909056 10:71748827-71748849 CGTCCCTCCCTGCTGCTGCTGGG - Exonic
1069955015 10:72044663-72044685 AGTCCCTGCCCGCTGCTGAAGGG + Intergenic
1070577046 10:77687227-77687249 AGTCCCCTCCTGCTGGGCACTGG + Intergenic
1070748647 10:78950898-78950920 AAGACCTTCCTGCTGCTCACAGG + Intergenic
1070889634 10:79933194-79933216 AGTCCCTCTCTGTGGCTCAAAGG + Intergenic
1071497810 10:86180700-86180722 AGGCGCTGCCTGCAGCTCACAGG + Intronic
1071576988 10:86734714-86734736 TGTCCCTTCCTGATGCTCCCTGG - Exonic
1071675952 10:87656428-87656450 ACTCCCTTCCTGCCGCCCACTGG - Intergenic
1072123106 10:92421050-92421072 AGTCCCTGGCTGCTGCTCTGTGG + Intergenic
1072663658 10:97379109-97379131 TCTCCCTCCCTGCTGCTCCAAGG - Intronic
1073724024 10:106209203-106209225 AGTCCCTCACTTCTGCTCCTTGG - Intergenic
1075336653 10:121613595-121613617 TGGCCCTCCCTGGTGCTCCCTGG + Intergenic
1075336660 10:121613615-121613637 TGGCCCTCCCTGATGCTCCCTGG + Intergenic
1075779571 10:125008329-125008351 AGTCACTCCCTGTTCCTGACAGG + Intronic
1075903866 10:126064222-126064244 AGCCACTCACTGCTGCTCTCAGG + Intronic
1076156851 10:128211111-128211133 AGGCTGTCCCTGCTGCTCCCGGG - Intergenic
1076327067 10:129632625-129632647 AGACCCTGCCTGCTGCTCCGGGG + Intronic
1076549409 10:131268048-131268070 AATCCCTCCCTGCCCCCCACAGG - Intronic
1077351357 11:2094674-2094696 AGTCCTTGCCTCCTGCTCCCGGG - Intergenic
1077435509 11:2536930-2536952 AGTCCCTCCCTTTACCTCACAGG + Intronic
1077491183 11:2861767-2861789 AGTCCCGGCCTCCTGCTCCCCGG + Intergenic
1077505911 11:2929862-2929884 AGTCCAGCCCTGCCGCTCTCGGG + Intergenic
1077537097 11:3129618-3129640 AGCCACTCCCTGGTGCTCAGCGG - Intronic
1077955847 11:7019716-7019738 AGTCCTTCCTTGCTGATCAAAGG + Intronic
1078196966 11:9144312-9144334 AGCTCCTCCCTGCTGCTCACAGG + Intronic
1078766027 11:14299471-14299493 AATGGCTCCCTGCTGCTTACAGG + Intronic
1079076459 11:17388096-17388118 AGCCCCTCCCTGGGGGTCACCGG - Exonic
1079112090 11:17610680-17610702 CGTCCCTCCCAGCTCCTCTCTGG + Exonic
1083289101 11:61680162-61680184 AGCCCCTCCCGGCCGCCCACGGG + Intergenic
1083421022 11:62553362-62553384 CCTCCCTCCCTGCTCCCCACTGG - Intronic
1083778851 11:64907718-64907740 AGTCCCGCCCTGCTGGCCCCGGG + Intronic
1083805573 11:65071883-65071905 AGTCCTGCTCTGCTGCTCATAGG + Intronic
1085455266 11:76661878-76661900 AGCTCTGCCCTGCTGCTCACTGG - Intronic
1087006548 11:93477449-93477471 CGGCCATCCCTGCTCCTCACAGG - Intergenic
1087811782 11:102616036-102616058 TGTCCCTCCCTGCTGTGCTCAGG - Intronic
1088807916 11:113368634-113368656 AGTCCCACCTTGCGGCGCACTGG - Intronic
1088851442 11:113706491-113706513 AGCCCCTCCCATCTGCTAACTGG + Intergenic
1091869189 12:3873192-3873214 CGTCCCGCCCGGCTACTCACTGG + Exonic
1092168318 12:6356830-6356852 AGTCCTCCTCTGCTGCTCACTGG - Intronic
1093772051 12:23029709-23029731 AGTCCCTCCTTGCCTCTCCCTGG + Intergenic
1096846776 12:54411806-54411828 AGTCCCTCCCTGAATTTCACTGG + Intronic
1097289881 12:57905715-57905737 AGTTACTGCCTGCTGCCCACAGG + Intergenic
1097767492 12:63542754-63542776 AGTCTCTCCCAGGTGCTCACAGG + Intergenic
1098236744 12:68424833-68424855 ACTCCCTCACTGGTGCTCACGGG + Intergenic
1100352632 12:93798969-93798991 AGTCCCTCCCTCTTCCACACAGG - Intronic
1103921599 12:124402275-124402297 AAGCCCTCCCCCCTGCTCACAGG + Intronic
1104067799 12:125319710-125319732 AGTGGCTCCCTTCTGATCACTGG - Intronic
1105303471 13:19154237-19154259 AGTCCCACCCAGCTGCTGCCTGG - Intergenic
1105596819 13:21846848-21846870 AGTGCCTGCCTGCTGCTCTGGGG + Intergenic
1105759796 13:23503360-23503382 AGTCCCTCCCTCCTGCCCCATGG + Intergenic
1105882679 13:24617744-24617766 GGGCCCTGCCTGCTCCTCACAGG + Intergenic
1106106175 13:26735369-26735391 AGCCCCTGCCTCCAGCTCACTGG + Intergenic
1107446378 13:40473387-40473409 AGGCCCTGACTGCTGATCACAGG - Intergenic
1110284126 13:73730191-73730213 ACTGCCTCTGTGCTGCTCACTGG + Intronic
1112356182 13:98676408-98676430 AGTCCCACCCAGCTACTAACAGG - Intergenic
1112438425 13:99408151-99408173 CGTCCTTTCCTGCTGGTCACTGG + Intergenic
1113787438 13:113010016-113010038 ACCCCGTCCCTGGTGCTCACTGG - Intronic
1114538060 14:23435619-23435641 TGTCTTTCCCTGCTGCTCTCAGG - Exonic
1119899131 14:78244874-78244896 TGTGCCTCCCTGCTTCTCCCTGG - Intronic
1121212969 14:92222922-92222944 AATGCCTCACTGCTGCTCAGAGG - Intergenic
1121941748 14:98077348-98077370 ATTCCTTCTCTGCTGCCCACAGG + Intergenic
1122636201 14:103130833-103130855 AGCCCATCTCTGCTGCTCCCAGG - Intronic
1122666613 14:103334439-103334461 AGCCCCTCCCCGCTGCTCGGCGG + Exonic
1122873328 14:104651273-104651295 AGTCCTGCCCTGCGGCCCACAGG - Intergenic
1123007667 14:105332258-105332280 AGCCCCTCCCAGCCCCTCACTGG + Intronic
1124352751 15:28969892-28969914 AGGCACTGCCAGCTGCTCACAGG + Intronic
1126841125 15:52718392-52718414 ATCCACTCCCTGCAGCTCACTGG + Intergenic
1127014275 15:54665795-54665817 AGTACCTGCCTGCTGCCCAGAGG + Intergenic
1128307616 15:66610253-66610275 AGTGCCTCTGTGCTGCTCAGGGG + Intronic
1128762531 15:70227167-70227189 ACCCCCACCCTGCTGCCCACAGG - Intergenic
1128841040 15:70852264-70852286 AAGCCCTTCCTGCTGCCCACTGG - Intronic
1129523748 15:76201356-76201378 ATTCCCTCCCTGCTCCTCTCAGG + Intronic
1131293033 15:91123780-91123802 AGTCTCTCCTTGCTCCTCTCTGG - Intronic
1131527799 15:93166489-93166511 AATCCCACCCTGCTGCTCGCTGG - Intergenic
1132694460 16:1195712-1195734 AGACCCTCCCTCCTGGGCACAGG + Intronic
1133033477 16:3022416-3022438 ACTCCCTCCCTCCAGCTCAGGGG - Intergenic
1135017182 16:18933651-18933673 GGACCCTCCCTGCTGGTCCCTGG + Intergenic
1136671456 16:31862291-31862313 AGCCACTCCCTCCTGCTCTCTGG + Intergenic
1137052658 16:35726871-35726893 AGTGACTCCCGGCTGCCCACAGG - Intergenic
1137873333 16:51971803-51971825 ATTCCCCACCTCCTGCTCACTGG + Intergenic
1138066120 16:53942978-53943000 AGTGCCTCCCTGCTTCTCCCTGG - Intronic
1138339309 16:56278379-56278401 ACTCCTTTCCTGCTCCTCACAGG - Intronic
1139286915 16:65823613-65823635 AGCTCCTCTCTGCTGCTCACTGG + Intergenic
1139687217 16:68613489-68613511 TGTCCCTCCCTACCCCTCACTGG + Intergenic
1139847107 16:69929043-69929065 AGTCCCTCACAGCTGATCCCTGG - Intronic
1141455175 16:84136466-84136488 AGTCTCTGGCTGCAGCTCACAGG + Intronic
1141953766 16:87356278-87356300 AGTCTCTCCTTGGTGCTGACAGG - Intronic
1143475840 17:7203593-7203615 AGGCCCACCTTGCTGCTCCCAGG - Exonic
1148199616 17:45741170-45741192 AGTCCCCATCTGCTGCTTACTGG + Intergenic
1148551707 17:48554553-48554575 AGTCCCTGGCTGCTGCTGCCAGG + Intronic
1148588899 17:48800869-48800891 CATCCCTCCCTGCTCCTAACCGG + Intronic
1148806884 17:50268436-50268458 AGTCCCTCCAACCTGCTCATTGG + Intergenic
1149333488 17:55609964-55609986 TGTCCCTCCCTGCTGACCACAGG - Intergenic
1149891010 17:60391058-60391080 AGTCCCGGCCTGCTGCTTATTGG - Intronic
1150377848 17:64696704-64696726 AGTCCCTCCCAGGTGCACCCTGG + Intergenic
1151201343 17:72470039-72470061 AGTCCCACCCAGCTACTTACTGG + Intergenic
1151600113 17:75100814-75100836 CCTCCCTCCCAGCTCCTCACCGG - Exonic
1151785842 17:76274597-76274619 AGTCCCTCTCTCCTGCTTCCAGG + Intronic
1152717196 17:81905836-81905858 AGCCCATCCCTGCTACTCACTGG - Intronic
1153150587 18:2088140-2088162 AGTTCCTCCCTTCTGTGCACTGG - Intergenic
1154360666 18:13657707-13657729 TGTCCCTCCCTCGTGCTCTCAGG - Intergenic
1156498097 18:37538998-37539020 TGCCCCACCCTGCTGCTCTCAGG + Intronic
1157431217 18:47628365-47628387 ATGCTCTCCCTGCTTCTCACAGG - Intergenic
1157584641 18:48793245-48793267 TGCCCCTCCCTGCTTCTCCCTGG - Intronic
1161054083 19:2181217-2181239 GGTGCCTCTCTGCTGCCCACTGG + Intronic
1162805731 19:13137162-13137184 AGGCCCTCCCTGCTGGGCTCTGG - Intronic
1164668412 19:30058649-30058671 AGTTCCTCCCTGCTTCACCCAGG - Intergenic
1164927337 19:32140548-32140570 GGTCCCGGCCTCCTGCTCACTGG + Intergenic
1165487579 19:36104793-36104815 AGTCCGTGCCTGCTGCTGCCCGG - Exonic
1165737010 19:38183296-38183318 AGCTCCTCCCTGCTCCTCGCAGG - Intronic
1165951590 19:39476542-39476564 TTTCCCTCCCTGGTGCTCATTGG + Exonic
1166569348 19:43784040-43784062 AGTTTCTCTCTGCTGTTCACTGG + Intergenic
1166839000 19:45684760-45684782 AGTCTCACCCTGTTGCCCACAGG - Intergenic
1167691153 19:50984148-50984170 AGTCCCTCCTGGCTGCTCTCGGG + Intergenic
1168177482 19:54635445-54635467 AGCCCCTCCCTGCATCTCAGTGG + Intronic
1168342253 19:55631755-55631777 AGTCCCTACCTGCTTCTTCCAGG + Intergenic
925001649 2:407704-407726 AGCCCTTCCTTGCTGCTCACAGG - Intergenic
926331558 2:11829871-11829893 AGGCCCTGCATGCTGCTCCCAGG + Intergenic
927677509 2:25117193-25117215 AGCCCCTGCCTGCGGCTCCCAGG + Intronic
927720169 2:25377379-25377401 AGCCCCTCCCCGCTTCCCACCGG + Exonic
929430329 2:41880868-41880890 AGTCCCACTCTGTTGCTCCCAGG + Intergenic
929571206 2:43024282-43024304 TCTTCCTCCCTGCTGCCCACTGG - Intergenic
935207423 2:100908438-100908460 AATCCCTGCCTGCTGCCAACTGG - Intronic
936243837 2:110809651-110809673 AGTCTCTCCCTGCTGTTGATGGG + Intronic
936935722 2:117836666-117836688 CTTCCCTCCCTGCTGCCCCCAGG + Intergenic
937293014 2:120793401-120793423 AGACCCTCCCTGCTGTCCCCAGG + Intronic
937481211 2:122261481-122261503 ACTCCATCTCTGCTGCTGACTGG + Intergenic
938198229 2:129351709-129351731 AGCCACTCCTTGCTTCTCACAGG + Intergenic
938682167 2:133703049-133703071 ACTCCCTCTCTGATGCACACAGG - Intergenic
943576358 2:189635587-189635609 AGTCTCTCCCTGCTCCACTCAGG + Intergenic
946370838 2:219280320-219280342 AGCCCCTCCCTAGGGCTCACTGG - Intronic
946931641 2:224677226-224677248 TGCCCCTCCCTCCTGCTCACAGG + Intergenic
947039895 2:225905326-225905348 AGCCCCTCTCTGCTGGTCATTGG + Intergenic
948030607 2:234814537-234814559 AGTCCCAGCCCGCTGCTCTCTGG + Intergenic
948643547 2:239390008-239390030 AGGCCCTGCCCGCTGCTCCCAGG - Intronic
948809969 2:240469430-240469452 AGTCCCTCTCGGTTCCTCACAGG + Intergenic
948839791 2:240643263-240643285 TCTCCCTCCCTGCTGGACACTGG - Intergenic
948918658 2:241051409-241051431 ACTCCCTCCCTCCTGCACACGGG - Intronic
948934248 2:241151949-241151971 AGACCCTCTCTGCTGCCCTCAGG + Intronic
1168852511 20:986260-986282 AGTCCCTCCCTGCTGCTCACTGG + Intronic
1169067429 20:2701879-2701901 AGCTCCTCCCTCCTGCTCCCAGG - Intronic
1169153106 20:3305974-3305996 AGTTCCTCCATGCTGCTCCCAGG + Intronic
1169155945 20:3329686-3329708 AGCCTCTCACTGCTGGTCACAGG + Intronic
1169909218 20:10633618-10633640 AGAACCACACTGCTGCTCACCGG - Intronic
1170138840 20:13104930-13104952 AGTCCTTCCCTACTTCTCAGAGG + Intronic
1172046176 20:32081965-32081987 AATCCCACCCTGCTGCTTCCTGG + Intronic
1172197623 20:33102930-33102952 AGGCAATCCCTGCTTCTCACAGG + Intronic
1173225843 20:41161998-41162020 GGTCCCTACCTGCTGCCCACTGG - Intronic
1174643499 20:52065756-52065778 AGACCAGCTCTGCTGCTCACTGG - Intronic
1176104933 20:63381486-63381508 AGGCCCTTCCTCCTGCTCTCAGG + Intergenic
1176107035 20:63394277-63394299 ACTTCCTCCCTGCTGCTGGCCGG - Intergenic
1178087918 21:29131146-29131168 AGTCCCTCCCCTCCGCTCAATGG - Intronic
1179007988 21:37531446-37531468 CGTCCTTCCCCGCTGCCCACTGG + Intergenic
1180218582 21:46343099-46343121 AGTCCCTGTCTGCTGATGACAGG - Intronic
1181112291 22:20609280-20609302 ACATCCTCCCTGCAGCTCACGGG + Intergenic
1181164527 22:20976296-20976318 AGACCCTCCCACCTGCTCCCTGG - Exonic
1181830069 22:25553523-25553545 AGCCCCTCTCTGCTCCTCAGAGG + Intergenic
1184264016 22:43337182-43337204 AGCCCAGCTCTGCTGCTCACTGG - Intronic
1184390662 22:44201362-44201384 AGTACCACCCAGCTGCTCAATGG + Intronic
1184431504 22:44443777-44443799 AGGCCCACCTTGCTTCTCACTGG - Intergenic
1184504752 22:44893895-44893917 AGCCTCACCCTGCAGCTCACTGG - Intronic
1184857599 22:47154936-47154958 CGTCCTTCCCTGCTGCCCGCTGG + Intronic
949612630 3:5718435-5718457 TTTCCCTTCCTTCTGCTCACTGG - Intergenic
949778840 3:7663180-7663202 ATTCTCTCCCTTCTGCCCACTGG - Intronic
950714337 3:14837041-14837063 TGTCCCTCCCTGCTGCAGTCTGG - Intronic
953059641 3:39416626-39416648 TGTCCCTCCCTGCTCCTCTCAGG + Intergenic
953179854 3:40584975-40584997 AGTGCCTCCCTGCTCCACGCCGG + Intergenic
954552155 3:51490898-51490920 AGTCTCTCTCTGTTGCTCCCAGG - Intronic
954971267 3:54653560-54653582 AGGCCCTCCCTGCAGCTGAAGGG + Intronic
955990638 3:64623361-64623383 AGTACTTCCCTGCTGCTTGCAGG - Intronic
961494113 3:127278451-127278473 TCTCCCTCCCTCCAGCTCACAGG - Intergenic
961668029 3:128505894-128505916 ACTTCCTCCTTGCTGCTCCCTGG - Intergenic
961825842 3:129598623-129598645 AGGCCCTCACTGCTTCTCACAGG + Intronic
962809860 3:138950615-138950637 ACTCCCTCCCGGCCCCTCACAGG + Exonic
968581257 4:1396374-1396396 ACTCACCCCCTGCTGCTCTCCGG - Intergenic
969098155 4:4749732-4749754 AGTCTCTCCCTGCTTATCTCGGG + Intergenic
969738645 4:9008404-9008426 AGACCCTCACGTCTGCTCACTGG + Intergenic
970226271 4:13860514-13860536 AATCACACCCTGCTGCTTACAGG + Intergenic
971422912 4:26490366-26490388 ACTCCCTCCCTGCTCCTCCACGG - Exonic
972461572 4:39308439-39308461 AGTCCCTCTCAGGAGCTCACAGG - Intronic
973789468 4:54364978-54365000 ACTCCCTCACTTCTGCTTACTGG + Intergenic
973993549 4:56435330-56435352 ACCCCCACCCTGTTGCTCACCGG + Exonic
974098722 4:57393903-57393925 AGTCCTTCCCTGCTGCTGCTGGG + Intergenic
974810596 4:66940859-66940881 AGTTTTTCCTTGCTGCTCACAGG - Intergenic
977426544 4:96873797-96873819 AGGCCCAACTTGCTGCTCACTGG - Intergenic
983904948 4:173172269-173172291 AGCCCCTCCCCGCTGCTGGCAGG - Intronic
984925798 4:184805675-184805697 AGCCCCACGCTGCTGCCCACTGG + Intronic
985654209 5:1121620-1121642 TGTCCCTGCCTGCCACTCACTGG - Intergenic
985837717 5:2282646-2282668 GCTCCCTGCCTGCTGTTCACCGG - Intergenic
985867999 5:2530389-2530411 AGTCCCTCCCTGCCATCCACGGG + Intergenic
991125522 5:63065697-63065719 ACTCCGTCCCTGCCACTCACTGG - Intergenic
991418922 5:66421128-66421150 AGTGGCTTCCTGCTGATCACTGG - Intergenic
992778776 5:80109925-80109947 AGTATCTCCCTGTTCCTCACAGG - Intergenic
996088348 5:119326528-119326550 AATGCTTCCCTGCTGCTCAGGGG - Intronic
997410488 5:133687177-133687199 AGTGGCTCCCTGCTGACCACAGG - Intergenic
998256398 5:140591897-140591919 AGTCTCACTCTACTGCTCACTGG - Intronic
999367143 5:151030462-151030484 ACTCCTTCCCTGCTGCTGAGTGG - Exonic
999748698 5:154610608-154610630 ACTCCCTCCCTGCAGCACGCGGG + Intergenic
1002130786 5:177080266-177080288 AGTCCCTCCCTTTCGGTCACAGG + Intronic
1002299342 5:178248545-178248567 TGTCCATCCCTGATGGTCACTGG - Intronic
1003042621 6:2702009-2702031 ACTCCCTCCCCGCTCCTCACTGG - Intronic
1004348971 6:14874406-14874428 AGTCCCCCCCAGCAGCTAACTGG + Intergenic
1004985659 6:21079294-21079316 AGTAGCTCCCTACTGCCCACAGG - Intronic
1006084876 6:31588569-31588591 GGTCCCTCACTGCTGGGCACTGG - Exonic
1006437390 6:34033082-34033104 AGACCCTCCCTGCTGAGCGCAGG - Intronic
1006642432 6:35496311-35496333 AGCCCCTCCCTGCCTCTCAGGGG + Intronic
1006926379 6:37657732-37657754 AGTCCCTACCTGCTCTCCACGGG - Intronic
1007428033 6:41759786-41759808 AGTGGCACACTGCTGCTCACAGG - Intergenic
1007928246 6:45667577-45667599 AGTTCCTCCCTGCTGGCCTCTGG - Intergenic
1011887424 6:92113948-92113970 TGTCACTCCCTGCTTCTCATTGG - Intergenic
1016306644 6:142691682-142691704 TATCCTTTCCTGCTGCTCACTGG + Intergenic
1016740696 6:147525740-147525762 AGTGCCTCCCTAATGCTGACTGG - Intronic
1018670307 6:166171531-166171553 GGCCCCTCCCTGCTGCTCTAGGG + Intergenic
1019854769 7:3593689-3593711 CTTCCCTTCCTCCTGCTCACTGG + Intronic
1019917973 7:4145406-4145428 AGTCCCTCCCTGCTCCCCAGAGG - Intronic
1021921337 7:25488465-25488487 TCTCCCTCCATGCTGCTCAGAGG + Intergenic
1022451144 7:30516558-30516580 AGTCCCACCCAGCTACTCAGGGG + Intronic
1023190101 7:37570991-37571013 TGTCCCTCCCTCCTGCAAACTGG + Intergenic
1023941076 7:44768702-44768724 AGTCCCTCCTTTGTGCTCCCAGG + Exonic
1028601005 7:92600399-92600421 AGACCCTCCCTCCTGCTCCTTGG - Intergenic
1028978901 7:96945071-96945093 ATTCTGTCCCTGCTACTCACTGG - Intergenic
1029488745 7:100858948-100858970 AGTCCCTGCCTGCTGCCTCCTGG + Intronic
1032443391 7:131959683-131959705 AGCCTCTCCTTGCTGTTCACCGG - Intergenic
1032760357 7:134934849-134934871 AGTCTCTCCCTGTTGCCCAGTGG - Intronic
1033742435 7:144285131-144285153 ACTCCTTCCCTGGTTCTCACAGG - Intergenic
1033751467 7:144364483-144364505 ACTCCTTCCCTGGTTCTCACAGG + Exonic
1033924417 7:146440094-146440116 AGTCGCTCTCTGTTGCCCACAGG - Intronic
1034508750 7:151518329-151518351 TGTACCTGCCTGCCGCTCACTGG - Intronic
1036393538 8:8346705-8346727 ATTCACTCTCTGCTGCACACTGG - Intronic
1037620435 8:20558840-20558862 ACACACTCCCTGCTTCTCACTGG - Intergenic
1037856388 8:22374221-22374243 AGTCCCTCCCTGCAGCCAACAGG - Intronic
1038399106 8:27269527-27269549 ATTCCCTCCCTGCTGCACTCAGG + Intergenic
1039100240 8:33933607-33933629 ACTTCCTCCCTGCTCCTCTCAGG - Intergenic
1039176158 8:34808854-34808876 AGTTCCTCCCTGCTCCTGAATGG + Intergenic
1040796092 8:51291414-51291436 ACTCCTTTCCAGCTGCTCACCGG - Intergenic
1042759088 8:72251676-72251698 TCTCCCTCGCTGCAGCTCACAGG + Intergenic
1043514005 8:80979320-80979342 AGTCCCCTCCTGCTGATCCCTGG - Intronic
1046029690 8:108768721-108768743 AGCTCCTACCTGCTGCTCTCAGG + Intronic
1047097338 8:121639736-121639758 AGACCCGCCCTCCTGTTCACAGG + Intronic
1047521793 8:125600583-125600605 AGTCCCTGCCTGCTAGTCCCAGG - Intergenic
1048161780 8:132028105-132028127 AGTCCCAGCCTGCTCGTCACCGG + Intronic
1049262126 8:141645525-141645547 ACTCCCTCCCTGCAGCCTACTGG + Intergenic
1049421661 8:142519291-142519313 AGTCCCTGCCGGCAGCTCATAGG - Intronic
1049728569 8:144163536-144163558 AGTCCCTACCAGCACCTCACTGG - Intronic
1050275948 9:4000631-4000653 AGTGGCCCCCTGCTGCTTACAGG + Intronic
1050428441 9:5536456-5536478 AGTTCCTCCCAGCTGCTGCCTGG - Intronic
1052819823 9:33129707-33129729 TCTCCTTCCCTGCTGCTCCCAGG - Intronic
1052963383 9:34319587-34319609 AGCGGCTCCCTGCTGTTCACTGG + Intronic
1053119018 9:35531285-35531307 AGTGGCTCCCTGCTGCCTACAGG - Intronic
1055223827 9:73970036-73970058 AGTCCTTGCCTTCTGCACACTGG - Intergenic
1057215127 9:93223748-93223770 AGAGCCTCCCTGCTACTCCCAGG - Intronic
1058719653 9:107752093-107752115 AGGCCCTCCCTGCAGGGCACAGG + Intergenic
1059632961 9:116144321-116144343 AGTTCCTCCCTGCCACACACTGG - Intergenic
1059849664 9:118323390-118323412 AGTCCTTCCCTGAGTCTCACAGG - Intergenic
1059958735 9:119544748-119544770 AGTCCCTCTCAGCTCATCACAGG - Intergenic
1061357810 9:130119565-130119587 ATTCCAACTCTGCTGCTCACTGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1061943774 9:133897232-133897254 AGTCTCTTGCTGCTGCTCAAAGG - Intronic
1062407525 9:136403923-136403945 CGTCCCTCCCTGCAGCTCCCTGG + Intronic
1187363941 X:18651453-18651475 GGTCCCTCTCTGCTGCGCTCAGG - Intronic
1187851771 X:23598168-23598190 AATTCCTCCCTGCTGATCAGTGG - Intergenic
1188908643 X:35819378-35819400 AGTCCCTCCCAAGTGCTGACAGG + Intergenic
1189615347 X:42777975-42777997 AGTCCCTCCAGACTGCTGACCGG + Intergenic
1190380330 X:49834424-49834446 AGTGCCTCCGTGATGCTCAAAGG + Intergenic
1192165614 X:68826062-68826084 TATACCTCCCTGCTGCTCATGGG + Intergenic
1192195480 X:69025052-69025074 AGCCCCTCCCTGCCCCTGACTGG - Intergenic
1194580446 X:95665353-95665375 ACTGGCTCCCTGCTGCTCCCGGG - Intergenic
1199724732 X:150568849-150568871 GGTACCTGCCTGCTGCTCCCTGG - Intronic
1199980337 X:152917240-152917262 AGTCCCTCCAGGGAGCTCACCGG + Intronic
1200134746 X:153869463-153869485 AGTCTGTCCCTGCAGCCCACTGG - Intronic
1200230633 X:154442243-154442265 AGTCCCTCACTTCTGGTCAATGG - Exonic
1201771960 Y:17624066-17624088 AGTCCCTGCCAGCTCCCCACAGG - Intergenic
1201829595 Y:18281920-18281942 AGTCCCTGCCAGCTCCCCACAGG + Intergenic