ID: 1168854437

View in Genome Browser
Species Human (GRCh38)
Location 20:998756-998778
Sequence CTGTGCCAGGCTCTGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 982
Summary {0: 1, 1: 3, 2: 22, 3: 138, 4: 818}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168854437 Original CRISPR CTGTGCCAGGCTCTGTGTTG GGG (reversed) Intronic
900097074 1:944133-944155 CCTTCCCAGCCTCTGTGTTGAGG + Exonic
900351676 1:2238024-2238046 CTGTGCCAGGCGCTGGGCTGTGG + Intronic
900526977 1:3134204-3134226 CTGTGGGAGCCTCTGTGTAGAGG - Intronic
900534339 1:3169608-3169630 CTCTGTCAGCCTCTTTGTTGAGG - Intronic
900608123 1:3532836-3532858 CTGTGCCAGGCCCTGGGTTCTGG + Intronic
901215352 1:7551863-7551885 CTGTGCTTGGTTCTGTGCTGAGG - Intronic
901357676 1:8665378-8665400 CTGTGCCAGGCAGTGAGTTAAGG - Intronic
901405360 1:9041445-9041467 GTGTGCCAGGCTCTGTGCTTGGG - Intronic
901438040 1:9261523-9261545 CTGTGCCAGGCAATGTGCAGGGG - Intronic
901739220 1:11331188-11331210 CTGTGCCAGGCTCTGTGTCGAGG + Intergenic
901789633 1:11647539-11647561 TTGTGCCAGACTCTGTGCTCCGG - Intergenic
901839729 1:11946340-11946362 CTCTCCCAGGCTCTGTAGTGTGG - Intronic
902332992 1:15739655-15739677 CTGAGCAAGGCTCTGGGATGTGG - Exonic
902396786 1:16136252-16136274 ATGTGCCAGCCCCTGTGATGGGG - Intronic
902541433 1:17158355-17158377 ATGTGCCAGGCTCTGTGCTGGGG + Intergenic
902612239 1:17603966-17603988 CTGCGCCCTGCTCTGGGTTGAGG + Intronic
902728606 1:18353429-18353451 GTGTGCCAGGCTCTTGGGTGCGG + Intronic
902783278 1:18717681-18717703 TCGTGCCAGGCTTTGTGCTGGGG - Intronic
902837962 1:19058809-19058831 CTGTGCCAGGCACGGGGATGTGG - Intergenic
902870482 1:19311260-19311282 CTATGCCAGGCTTTGACTTGGGG - Intronic
903052082 1:20608948-20608970 GTGTGCCAGCCTCTGTGCTAAGG - Intronic
903188396 1:21642344-21642366 CTGTGCCAGGCCCTGGTTTCAGG + Intronic
903294637 1:22335920-22335942 GGGTGCCAGGCTCTGTGATAAGG + Intergenic
903315741 1:22504381-22504403 GTGTGCCAGGCAGTGTGCTGAGG + Intronic
903357803 1:22758814-22758836 AGGTACCAGGCTCTGTGCTGGGG - Intronic
903547579 1:24136269-24136291 ATGTGCCAGGCACTATGCTGAGG + Intronic
903667110 1:25014769-25014791 CTGGGCCAGACTCTGTGTCAGGG - Intergenic
903789333 1:25881812-25881834 CTGTCCCAGGCTTTGCGGTGGGG + Intergenic
903834406 1:26193602-26193624 GCGTGCCAGGCACTGTGCTGGGG - Intronic
903972269 1:27126697-27126719 ATGTGTCAGGCTCCGTGCTGAGG - Intronic
903989548 1:27256812-27256834 ATGTGCCAGGCATTGTGCTGAGG - Intronic
904052913 1:27651004-27651026 ATGTGCCAGGCCCTGTGCTAGGG + Intergenic
904081818 1:27877041-27877063 GTGTGCCAGGCTCCGTGTGGCGG + Intronic
904316638 1:29670241-29670263 GTGTGCTAGACTCTGTGCTGAGG + Intergenic
904330467 1:29755077-29755099 GTGTACCAGGCACTGTGCTGTGG - Intergenic
904416209 1:30362518-30362540 GTGTGCCAGGCACTGTGCTAAGG + Intergenic
904542274 1:31240887-31240909 ATGTGCCAGGTTCTCTGCTGGGG + Intergenic
904542915 1:31245612-31245634 ATGTGCCAGGCTGGGTGTGGTGG + Intergenic
904822455 1:33255101-33255123 CTGTGCCAGGCACTGTGCTTGGG + Intergenic
904925468 1:34044153-34044175 ATTTGTCAGTCTCTGTGTTGGGG - Intronic
905242144 1:36588262-36588284 GTGTGCCAGGCCCTGAGCTGGGG - Intergenic
905284951 1:36873185-36873207 GAGTGCCAGGCCCTGTGCTGGGG - Intronic
905286078 1:36881222-36881244 CTGTGCCAGGTTCTGTTCTTGGG + Intronic
905318944 1:37101967-37101989 CTATGCCAGGCACTGAGTTAGGG - Intergenic
905479485 1:38251318-38251340 ATGTGCCAGGCTCTGTGTGAGGG + Intergenic
906071891 1:43022941-43022963 ATGTGCCAAGCCCTGTGATGGGG + Intergenic
906436764 1:45803365-45803387 CTGGGCCAAGCTCAGTGCTGGGG - Intronic
906528438 1:46509833-46509855 CTTAGCCAGGCTCTCTGTTCAGG + Intronic
906660634 1:47578940-47578962 CTCTGCCTGGCTCTGGTTTGGGG - Intergenic
906704727 1:47886711-47886733 CACTGCCAGGCCCTGTGTTAGGG + Intronic
907354398 1:53860610-53860632 CTGTGCCAGGCCCTGTGCAGGGG - Intronic
907380380 1:54082465-54082487 CTGTGCTAGGCACTATGCTGGGG + Intronic
907381514 1:54094693-54094715 ATGTGCCAGGCTCTGTGCTTGGG - Intronic
907392789 1:54169142-54169164 CCGTGCCAGGTGCTGTGTTTGGG + Intronic
907395211 1:54184987-54185009 CTGTGCCAGGCACCATGTTGAGG + Intronic
907423336 1:54362394-54362416 CTTTGCCAGGCCCTTTCTTGGGG - Intronic
907526641 1:55057592-55057614 CAGTGCCAGGCTCTGTGCAGGGG + Intronic
907576106 1:55527226-55527248 CTGTGCTAGGCACTGTGCAGAGG - Intergenic
907664673 1:56424428-56424450 CAGTGCTAGGCTCTGTGGTCAGG - Intergenic
907707317 1:56844081-56844103 CTGTGCCAGGCAGTGTGCTGGGG + Intergenic
907834388 1:58095165-58095187 GTGAGCCAGGCTCTGTGCTGGGG - Intronic
907944940 1:59127320-59127342 CAGTGCCAGGCACTGTGCTATGG + Intergenic
908577217 1:65473125-65473147 CTGTGCCAGGGTCTGTGCCAAGG + Intronic
908776811 1:67648645-67648667 CTGTGCCACGCCCTGTGCTGGGG + Intergenic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
908924642 1:69239539-69239561 CTTTGCCAAGCCCAGTGTTGAGG + Intergenic
909949625 1:81704341-81704363 ATGTGCTATGCTCTGTCTTGAGG - Intronic
911121033 1:94296698-94296720 CTCTACCCAGCTCTGTGTTGGGG - Intergenic
912557764 1:110528582-110528604 GTGTGCCAGGCTGGGTGTGGAGG - Intergenic
912858984 1:113196241-113196263 AAGTGCCAGGCTCTGTGCTAGGG - Intergenic
912953301 1:114135443-114135465 CTGTGCCAGGCATGGGGTTGAGG - Intronic
913647331 1:120871014-120871036 CTGTGGCCTGCTCTGTGGTGGGG - Intergenic
914332712 1:146687177-146687199 ATGTGCTAGGCACAGTGTTGGGG + Intergenic
914913063 1:151802110-151802132 CTAGGCCAGGCACTGTGCTGAGG + Exonic
915141340 1:153770495-153770517 ATGAGCCAGGCTCTGGGCTGGGG + Intronic
915291607 1:154887982-154888004 CTGTGCAAGGTTCAGGGTTGGGG - Intergenic
915928541 1:160042678-160042700 ATGTGCCAGGCACTGTGCAGGGG + Intronic
916194965 1:162213989-162214011 CTGTGCCAGGCACTATAATGGGG + Intronic
916419040 1:164619272-164619294 CTCTGCCTGGCTCTGAGTTTAGG - Intronic
916582329 1:166120148-166120170 CTGTGCCAGGTGCTGTGCTGGGG + Intronic
916722283 1:167493476-167493498 CTGTGCCAGGCCCTGTGCTGAGG + Intronic
916743202 1:167663862-167663884 ATGTGCCAGGCACTGTGCTGGGG + Intronic
918438948 1:184546469-184546491 CTGTGCCAGACCCTGTGTTAGGG + Intronic
919078446 1:192840319-192840341 CTGTGTCAGGCACTGGGTTAAGG - Intergenic
919120478 1:193334157-193334179 GTGTGGTAGGCTCAGTGTTGGGG + Intergenic
920275304 1:204800007-204800029 CTGTGCCTGGCTCTGGGCTTGGG + Intergenic
920447511 1:206030006-206030028 CTGTGCTAGGCTCTGAGCTAAGG + Intergenic
920723600 1:208413020-208413042 ATGTGCCAGCCACTGTGTTTGGG - Intergenic
920849564 1:209619378-209619400 AAGTGCCAGGCACTGTGCTGGGG - Intronic
921324125 1:213973703-213973725 TTGTGCTAGGCACAGTGTTGAGG + Intergenic
921527638 1:216237698-216237720 GTGTGCCAGGCTCTGTGATAAGG - Intronic
921598349 1:217079771-217079793 CTGTGCCTGGCTCTGAGAGGAGG - Intronic
921621759 1:217333216-217333238 ATGTGCCAGGTTATGTATTGAGG + Intergenic
922414580 1:225409201-225409223 CTGAGCCAGGGTCTGTGAAGTGG + Intronic
922826889 1:228527803-228527825 CTGTGACTGGCTCTGTGCTGGGG - Intergenic
923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG + Exonic
923114561 1:230922860-230922882 CTGTGCTGTGCTGTGTGTTGGGG - Intronic
923497879 1:234540743-234540765 GAGTGCCAGGCACTGTGCTGGGG - Intergenic
923512173 1:234662046-234662068 CTGTGCCAGGGATTGTGTTAGGG + Intergenic
923520780 1:234733490-234733512 ATGTACCAGGCTCTGTGGTGGGG - Intergenic
924185191 1:241481318-241481340 CTGTGGCAGGCACTGTGCTAGGG - Intergenic
924195796 1:241605547-241605569 ATGTGCCAGGCACTGTGCAGTGG + Intronic
924300612 1:242633833-242633855 CTCTGTCAGGCACTGTGCTGAGG + Intergenic
924306172 1:242691284-242691306 GCGTGCCAGGCTCTGTGCTCTGG - Intergenic
924432495 1:244008861-244008883 CTGTGCCTCCCTCTGTGTTTTGG - Intergenic
924456008 1:244219502-244219524 CAGTGCCAGGCCCAGTGCTGGGG + Intergenic
924588878 1:245384331-245384353 ATATGCCAGGCACTGTGCTGAGG + Intronic
1063369148 10:5509529-5509551 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1063392404 10:5659146-5659168 CTGTGCCAGGCTCCCTGTGGTGG + Intronic
1063474845 10:6318980-6319002 CTGTGCTAGCCTCCGTGTTAGGG - Intergenic
1064438572 10:15332948-15332970 CTCTGGTGGGCTCTGTGTTGAGG - Intronic
1065313704 10:24441252-24441274 CTGTGCCAGGCTGTCTCTGGAGG - Intronic
1065432683 10:25675239-25675261 CTCAGCCAGGCTCTCTGTTTGGG - Intergenic
1065642235 10:27795042-27795064 TTGTTCCAGGCTCTGTATTCTGG + Intergenic
1065705796 10:28470558-28470580 CTGTGCCAGGCTGTGTTCTAAGG - Intergenic
1065843636 10:29726798-29726820 GTTTGCCAGGCCCTGTGCTGAGG - Intronic
1065863887 10:29896447-29896469 ATGTGCTAGGCACTGTGTTGAGG + Intergenic
1067286704 10:44912359-44912381 CAGAGCCAGGATCTGTTTTGGGG + Intronic
1067685093 10:48461945-48461967 CTGTGCCAGGCACTGTATCAGGG - Intronic
1067792710 10:49299930-49299952 CTGTGGCGGGCTTTGTTTTGGGG - Intronic
1067803572 10:49377228-49377250 CTGCACCAGACTCTGTGCTGGGG + Intronic
1067848128 10:49738896-49738918 CTGGGCCAGGCTGGGTGTGGGGG - Intronic
1068000767 10:51331462-51331484 CTGTGGCAGACCCAGTGTTGGGG + Intronic
1068410940 10:56653627-56653649 CTGTGGCAAGCCCAGTGTTGGGG - Intergenic
1069708898 10:70476748-70476770 ACGTGCCAGGCACTGTGCTGTGG + Intergenic
1070532243 10:77347166-77347188 CTGTATCAGGCTCTGTGCTAGGG - Intronic
1070646448 10:78205252-78205274 CTCTGCCAGGCTCTATGCTGTGG - Intergenic
1070778551 10:79124447-79124469 CTGTGACAGGCAGTTTGTTGTGG - Intronic
1071503183 10:86217880-86217902 CTGAGGCAGGCTCTGTGGTGTGG - Intronic
1071685631 10:87752434-87752456 CTGTGCCAGGCACTATGCTGAGG + Exonic
1071780223 10:88836307-88836329 ATGTGCCAGGCACTATGTTATGG - Intronic
1071794747 10:88991933-88991955 CTATGCCTGGCACTTTGTTGGGG - Intronic
1072003975 10:91224397-91224419 GTGTGTCAGGCACTGTGCTGGGG + Intronic
1072421425 10:95292791-95292813 CTATGCCAAGCACTGTGCTGGGG - Intergenic
1072668078 10:97408994-97409016 CTGTGCCAGGCACTGGGCTAAGG - Intronic
1072962806 10:99944616-99944638 ATGTGCCAGGCACTGTGCTAAGG - Intronic
1073189669 10:101642467-101642489 CTGTGGCAGGCTCTGCATAGTGG - Intronic
1074121332 10:110496402-110496424 GTGGGCCAGGCTTTGTTTTGGGG - Intergenic
1074445572 10:113518635-113518657 CTGAGCCAGGCCCTGTGCTGAGG + Intergenic
1074510423 10:114106966-114106988 TTGTGCCTGGCACTGTGTTAGGG + Intergenic
1074703220 10:116110271-116110293 CTGTGCCAGGCACTGGGCTATGG + Intronic
1074987849 10:118673166-118673188 CTGTGCCAGGCCATGTGTTATGG + Intergenic
1075068371 10:119304738-119304760 CTGTGCCTGTCTCTGTCTAGGGG + Intronic
1075539775 10:123302397-123302419 TTGTGCCAGGCACTGTGCTAAGG - Intergenic
1075631553 10:124003734-124003756 CTCTCCCAGGCTCTCTGCTGCGG + Intergenic
1076113549 10:127879824-127879846 ATGTTCCAGGATCTGTGATGAGG + Intronic
1076535386 10:131173804-131173826 CTGTGCCAGGTTCTGTGTAGAGG - Intronic
1076551215 10:131279171-131279193 GTGTGCCAGGCACTGTATCGGGG - Intronic
1077011838 11:382265-382287 CTGTGCCGGGCCCTGTGGGGAGG + Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077245402 11:1534602-1534624 GTGTACCAGGCTCTGTGCTGGGG - Intergenic
1077418082 11:2435127-2435149 ATGTGCCAGGCACTGTGTCAGGG + Intergenic
1077509875 11:2952988-2953010 CTGTGCCAGGTGCTATGTTAAGG + Intronic
1077605792 11:3610846-3610868 TTGTGCCAGGCTCTGTGCTAGGG + Intergenic
1077747016 11:4918035-4918057 ATTTGCCAGGCTCTGTATTAGGG + Intronic
1078059426 11:8033656-8033678 CCGTGCCAGGCCCTGGGTTGGGG - Intronic
1078463281 11:11531481-11531503 CTCTGCCAGGCTCTGTGCCCGGG + Intronic
1078483959 11:11704931-11704953 CTGTGGCAGGCTGTGTGCTACGG - Intergenic
1078535595 11:12170890-12170912 CTGTGCCAAGCCCTGTGCTGGGG - Intronic
1078561503 11:12377278-12377300 TTGCGCCAGGCTGTGTGGTGGGG + Exonic
1078659344 11:13274509-13274531 GTATGCCAGGCACTGTGTTAAGG + Intergenic
1078937486 11:15964615-15964637 ATGTGCCAAGCACTGTGTTGGGG + Intergenic
1079390214 11:20015686-20015708 GTGTGCCAGGCATTGTGCTGGGG - Intronic
1079470050 11:20769537-20769559 CTGTGCCAGGCTCTGTACTGTGG - Intronic
1079621576 11:22562023-22562045 CTGTGCCAGGTACTGTGCTAAGG + Intergenic
1079761705 11:24337722-24337744 CTGTGACTGGCTCTGAGGTGAGG - Intergenic
1080025484 11:27609615-27609637 CTGTGCCAGGCATTGTGCTCAGG + Intergenic
1080546707 11:33326686-33326708 CAGAGCCAGGCTCTGTCTCGGGG - Intronic
1081343122 11:41951651-41951673 ATGTGCCAGGCTCTGTTCTAAGG + Intergenic
1081737550 11:45414491-45414513 AAATGCCAGGCTCTGTGCTGAGG + Intergenic
1081849693 11:46266378-46266400 GTGTGCCAGGCTCAGTGCTGAGG - Intergenic
1081861134 11:46333881-46333903 CTGTGCCAGGCACAGGCTTGTGG + Intronic
1082004245 11:47410890-47410912 CTGTGCCAGGCACTGGGCTGAGG + Intronic
1083152901 11:60804234-60804256 CTGTCCCAGGCTGGGTGTGGTGG - Intergenic
1083357985 11:62081823-62081845 GTGTGCCAGCGGCTGTGTTGTGG + Intergenic
1083669098 11:64290702-64290724 GTGTGCCAGGCTCTGTTTTGAGG + Intergenic
1083713110 11:64560662-64560684 CAGAGCCAGGCACTGTGATGAGG - Intronic
1083740478 11:64708166-64708188 TTGTGCTAGGCTGTGTGTTGGGG - Intronic
1083772512 11:64876338-64876360 CTGTGCCAGGATGTGTAGTGTGG - Intronic
1084433080 11:69122342-69122364 GTGTGCCAGGCACTGGGTAGGGG - Intergenic
1084445535 11:69201515-69201537 TTGTGCCAGGCACTTTGCTGGGG + Intergenic
1084551810 11:69848205-69848227 ATGTGCCAGGCTCTGTGCCAGGG + Intergenic
1084781372 11:71411837-71411859 CTGTTTCAGGTTCTGTGCTGGGG + Intergenic
1084899063 11:72295995-72296017 GTGGGCCAGGATCTGTGGTGGGG + Intronic
1085215107 11:74822886-74822908 GTATGCCAGGCACTGTGTTAGGG + Intronic
1085295077 11:75426911-75426933 GTGTGCCAGGCTCTGTGCTCAGG + Intronic
1085320207 11:75569284-75569306 CAGTGCTGGGCTCTGTGATGGGG + Intronic
1085389077 11:76173038-76173060 TTGTGCCAGGCTCTGCGCTAGGG - Intergenic
1085411911 11:76296469-76296491 CTGTGCCCGGCCCAGTGTTGGGG + Intergenic
1085435499 11:76496281-76496303 CTGTGCAAGAATCTGAGTTGGGG - Exonic
1085479587 11:76810192-76810214 GTGTGCCAGGCCCTGTGACGGGG - Intergenic
1085717164 11:78882465-78882487 TTGTGCCAGGCTTTGTGCTAGGG + Intronic
1085816148 11:79739340-79739362 ATGTGCCAGACCCTGTGCTGGGG - Intergenic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1086350379 11:85937867-85937889 CTGTGTCAGCCTCTGGGTGGGGG + Intergenic
1087415722 11:97853058-97853080 CTGTACCAGCCTCTGTAATGTGG + Intergenic
1087878603 11:103388978-103389000 CTCTGCCAGGCTTTGTTATGAGG + Intronic
1088229510 11:107659591-107659613 CTGTACCAGGCTTTGTGCTGAGG - Intronic
1088540432 11:110908228-110908250 CTGTGCCAGGGTCTGCTTTGGGG - Intergenic
1088813328 11:113406012-113406034 CTGACCCAGGCTCTGGGTAGAGG - Intergenic
1088824604 11:113483233-113483255 CTGTGTCAGGTTCTGTGCTGGGG - Intergenic
1088867901 11:113866273-113866295 CAGAGCCAGACTCTGTCTTGGGG + Intronic
1088882774 11:113984510-113984532 CTGTGCCAGGCCCTGTGCTGGGG - Intronic
1089369996 11:117948577-117948599 CTGTGACAGTCTCTGGGTAGAGG - Intergenic
1089582689 11:119491290-119491312 ATGTTCCAGGCACTGTGCTGAGG + Intergenic
1089787320 11:120917367-120917389 ATGTGCCAGTCACTGTGCTGGGG + Intronic
1089921666 11:122214951-122214973 GTGTGCCAGGCTGTGTGTGATGG + Intergenic
1089932811 11:122331323-122331345 CTGTGCCATGCGATGTGATGTGG - Intergenic
1090410883 11:126508853-126508875 CTATGACAGGCACTGTGCTGAGG - Intronic
1090835593 11:130451161-130451183 CTGTGCCATGCTCTTTTTTTTGG + Intronic
1091056058 11:132420282-132420304 CTGCTCCAGGCCCTGTGTAGGGG + Exonic
1091109054 11:132948397-132948419 TTCTGGCAGGCTCTGTGTTACGG + Intronic
1091284359 11:134399790-134399812 CTGTGCCAGGCTCCATGCTGTGG - Intronic
1091412201 12:250853-250875 CTGCGCCAGGCCCTGTTTTTAGG - Intronic
1091593126 12:1857165-1857187 CAGTGCTAGGATCTGTGCTGTGG + Intronic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1091998448 12:5013990-5014012 CTGTGCCATGGTGTGTGATGGGG - Intergenic
1092008406 12:5088502-5088524 CTGTGGCTGGATCTGTGATGTGG + Intergenic
1092026915 12:5248380-5248402 CTGTGCCAGGCTGGCTGTGGAGG + Intergenic
1092289751 12:7152681-7152703 ATGTGCCAGGCACTGTGCTCGGG + Intronic
1092524931 12:9303993-9304015 CTGTGACAGACTCTGTGTATTGG - Intergenic
1092542336 12:9427825-9427847 CTGTGACAGACTCTGTGTATTGG + Intergenic
1092833297 12:12465313-12465335 CTGTCCCTGGCTCTATGTTCTGG - Intronic
1092917773 12:13203650-13203672 CTGTGCCAGGCACAGAGTGGGGG - Intronic
1093494780 12:19743701-19743723 CTGTGCCAGGAACTGTGATAAGG + Intergenic
1094033650 12:26043081-26043103 CTGTGCCAGCCACTATGCTGAGG + Intronic
1094510677 12:31094608-31094630 CTGTGACAGACTCTGTGTATTGG - Exonic
1095397744 12:41779901-41779923 CTGTGCCAGGCACTGCGTCACGG - Intergenic
1095736799 12:45566441-45566463 CTGTGCCAGGCATTGTGTTAAGG + Intergenic
1096240962 12:49960195-49960217 CTGTGCCAGGCACTGTGCTAAGG + Intergenic
1096444287 12:51674750-51674772 CTGTACCAGCCACTGTGTTAAGG + Intronic
1096500129 12:52059745-52059767 CTGTGCCTGGCTCATTGCTGGGG + Intergenic
1096733130 12:53630603-53630625 CTGTGCCAAGCTGTGTTTTGTGG + Intergenic
1096864458 12:54553782-54553804 CAGTTCCAGGCTCTGTCCTGAGG - Intronic
1097181155 12:57172803-57172825 GTGTGCCAGGCGCTGTCCTGGGG - Intronic
1098143949 12:67479664-67479686 ATGTGCCAGGCAATGTTTTGAGG + Intergenic
1098595244 12:72266642-72266664 CAGTGCCAGGCACTGTGCTAGGG - Intronic
1099122292 12:78706364-78706386 CTGTTACAGGCTCCATGTTGGGG - Intergenic
1099968749 12:89478517-89478539 CAGTGCCAGGCACTGTGTCTGGG - Intronic
1100587968 12:95996877-95996899 CTATGCCAGGTGTTGTGTTGAGG - Intergenic
1100888043 12:99094128-99094150 ATGTGCCAGGCACTGGGCTGTGG + Intronic
1101234165 12:102771461-102771483 ATGTGCCAGACTCTGTGCTAAGG + Intergenic
1101252705 12:102951266-102951288 CGGGGCCAGGCTCTGTGCTCCGG - Intronic
1101598613 12:106189204-106189226 CTGTGCCAGGCACTGTCTCAGGG + Intergenic
1101817858 12:108159543-108159565 ATGTGCCAGACTCTGTGTGCTGG - Intronic
1101836802 12:108301538-108301560 ATGTGCCAGGCACTGAGCTGGGG - Intronic
1101845228 12:108358177-108358199 ATGTGCCAGGCACTGGGCTGGGG + Intergenic
1101886262 12:108665715-108665737 GTGTGTCTGGCTCTGTGCTGAGG - Intronic
1102234482 12:111285726-111285748 CAGTGCCTGCCTCCGTGTTGTGG + Intronic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1102801261 12:115736450-115736472 TTGTCCCAGGCTCTGTGCTAGGG + Intergenic
1102859753 12:116325559-116325581 GTGTGCCAGGCCCTGTGCTAAGG + Intergenic
1102989078 12:117301946-117301968 CTGTGCCAGGCCCTGTAGAGTGG + Intronic
1103137410 12:118519491-118519513 ATGTGCCAGGCACTGGGTAGGGG - Intergenic
1103530652 12:121599080-121599102 CTTTGCTAGGCTGAGTGTTGGGG + Intergenic
1103885149 12:124194923-124194945 ATGTGCCAGGCACTGTTTTAGGG - Intronic
1104530977 12:129570939-129570961 CTGTCCCTGGCTATGTGCTGGGG - Intronic
1104589026 12:130069617-130069639 CTGGGCTGGGCTCTGTGCTGAGG + Intergenic
1105213442 13:18271239-18271261 CAGTGCCAGGCTCTAGGCTGGGG - Intergenic
1105356307 13:19663192-19663214 CACTGCCAGGCACTGTGCTGGGG + Intronic
1105746718 13:23383897-23383919 CTGTGCCAGGCACTGGGGTTGGG - Intronic
1105966461 13:25388954-25388976 TTGGGCCAAGCTCTGTGGTGTGG + Intronic
1106454436 13:29914508-29914530 ATGTGCCAGGCTCTATGTTAAGG + Intergenic
1107114136 13:36728200-36728222 CTGTACCAGGCACTGTGTCAGGG - Intergenic
1107169450 13:37322589-37322611 CTGTGCCAGTCTCTGTGGGAGGG + Intergenic
1107197305 13:37667942-37667964 CTGTGTCAGGCACTGTCTTCGGG + Intronic
1107326113 13:39244768-39244790 GTGTGCAAGGCCCTGTGTTAGGG - Intergenic
1107834435 13:44402182-44402204 CTGTGCCAGGCCCTGTTTTAAGG + Intergenic
1107984324 13:45762003-45762025 GTGTGCCAAACCCTGTGTTGGGG + Intergenic
1109120013 13:58443540-58443562 GTGTGCCAGGCTCTGTTATAGGG + Intergenic
1109626684 13:64983234-64983256 CTGTGAGAGACTCTGTGGTGAGG - Intergenic
1110047114 13:70844601-70844623 TTGTGCCTGGCTGTGTGTAGTGG - Intergenic
1110380805 13:74848392-74848414 CTGAGCCAGCCTCTGGGTTGGGG - Intergenic
1112036293 13:95499742-95499764 CAGTGCCTGGGTCAGTGTTGGGG - Intronic
1112433943 13:99377157-99377179 GTGTGTCAGGCTCTGTGTTGGGG + Intronic
1112678298 13:101730838-101730860 CTGACTCAGGCTCTGTGGTGAGG + Intronic
1112999632 13:105619012-105619034 CTTTCCCAAGCTTTGTGTTGGGG + Intergenic
1114253964 14:20986022-20986044 ATGTGCCACACTCTGTGTTAAGG - Intergenic
1114599948 14:23947119-23947141 CTCTGCCAGGCTTTGTTTTCAGG - Intergenic
1116235707 14:42276458-42276480 CTGTGCCACTCTCTGAGTTTTGG - Intergenic
1116654022 14:47628384-47628406 CTGTGCCAGGCCTTGAGTTTAGG - Intronic
1117717748 14:58598204-58598226 CTGTTCCAAGCACTGTGCTGAGG - Intergenic
1117718012 14:58600417-58600439 GCCTGCCAGGCTATGTGTTGTGG - Intergenic
1117863766 14:60122751-60122773 CTGTGCCAGGCACTGTTTCAGGG - Intronic
1117867151 14:60161812-60161834 ATGTGCCGGCCTCTGTGCTGGGG - Intronic
1119347783 14:73940691-73940713 CTGTGCCAGGCACAGTGTTAAGG - Intronic
1119537439 14:75413934-75413956 GTGTGCCAGGCACTGTGTGGGGG + Intergenic
1119552384 14:75524326-75524348 ATGTGCCAGGCATTGTGCTGGGG + Intronic
1119616041 14:76099700-76099722 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1120840761 14:89083040-89083062 CTGTGGCAGGCTCTGGGAGGGGG + Intergenic
1121059400 14:90891182-90891204 CTGTGCCAGGCCCTGGGGTAGGG - Intronic
1121419152 14:93800205-93800227 CTGTGCCAGGCTGTGGGTACTGG + Intergenic
1121438988 14:93937019-93937041 CTGTGCCAGGCACAGTGAAGTGG - Intronic
1121521908 14:94591881-94591903 CTGCCCCAGGCACTGTGCTGGGG - Intronic
1121693911 14:95897124-95897146 TTGTGCCAGGCACTGTTCTGGGG + Intergenic
1122030849 14:98910636-98910658 CTGTACCAGACCTTGTGTTGGGG - Intergenic
1122295671 14:100704412-100704434 TTGCGCCAGGCACTGTGCTGTGG - Intergenic
1122322126 14:100861504-100861526 CTGAGCAAGGCTCTGTGTGTAGG + Intergenic
1122482126 14:102054146-102054168 CTGTGCCCAGCACTGCGTTGAGG - Intergenic
1124372532 15:29111714-29111736 CTGTGACAGCCTCTGTGTCTAGG - Intronic
1124390415 15:29250644-29250666 CAGTGCAGGGCTCTGTGTGGGGG - Intronic
1124504877 15:30264083-30264105 CAGTGCCAGGCCCTGTGCTGAGG + Intergenic
1124636448 15:31367759-31367781 ACGTGCCAGGCGCTGTGCTGAGG + Intronic
1124738675 15:32274552-32274574 CAGTGCCAGGCCCTGTGCTGAGG - Intergenic
1124988586 15:34648095-34648117 ATGTGCCAGGCACTGTGTTAGGG - Intergenic
1125117741 15:36115167-36115189 CTGTGCCAGGCAATGTTATGTGG - Intergenic
1125542651 15:40479221-40479243 CTGTGCCAGCCTCAGCCTTGGGG + Intergenic
1125980544 15:43996316-43996338 CTGGGACAGGCCCAGTGTTGAGG + Intronic
1126070334 15:44860370-44860392 ATGTGCCAGGCACTGGGCTGAGG - Intergenic
1126087701 15:45024747-45024769 ATGTGCCAGGCACTGGGCTGAGG + Intronic
1126135197 15:45383076-45383098 CTGTGTCAGGCACTGTGCTAGGG - Intronic
1126376878 15:48005876-48005898 GTGTGCCAGGCACTGTGCTAGGG - Intergenic
1126529583 15:49698474-49698496 CTGTATTAGGCTCTGTTTTGGGG + Intergenic
1128183681 15:65626122-65626144 CTCTGCCAGGCACTGTGCTGGGG + Intronic
1128672048 15:69581045-69581067 CTGTGCCAGGCTGGGTGAAGAGG + Intergenic
1128751711 15:70154812-70154834 CTGTGCCGGGCTCTGGGCTCTGG + Intergenic
1129156356 15:73720693-73720715 CTGTGCCCGGCTCTGGGCTTGGG - Intergenic
1129315403 15:74740050-74740072 CTCTGCGAGTCTCTGTGTTCTGG - Intergenic
1129542582 15:76363033-76363055 CTGTGGCAGGCACAGTGCTGGGG - Intronic
1130060815 15:80568717-80568739 CTGTGCCAGGTTGCCTGTTGAGG - Intronic
1130519149 15:84649032-84649054 CTGTGTCAGGCGCAGTGTTTAGG + Intronic
1130555024 15:84916571-84916593 CTGGGCCAGGCTTTGGCTTGGGG - Intronic
1130842658 15:87716055-87716077 CATTGCCAGACTCTGTGCTGGGG - Intergenic
1131090183 15:89618618-89618640 ATGTGCCAGGCACTGTGTGTTGG - Intronic
1131090752 15:89623174-89623196 ATGTGCCAGGCACTGTGTGTTGG - Intronic
1131160493 15:90102076-90102098 CCGTGCCAGGCGCTGGGGTGGGG - Intronic
1131224000 15:90608701-90608723 CTGTGCCGGGCACTGTGCTAGGG - Intronic
1131384675 15:91994180-91994202 GTGTGCCAGGCTTTGTTTTAAGG + Intronic
1131576188 15:93593760-93593782 CTGTGACCGGCTCTGAGTGGAGG - Intergenic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1131960870 15:97789032-97789054 CTATGCCAGGCTTTGTGCTGAGG - Intergenic
1132110484 15:99099154-99099176 CTGGGCCAGGCACAGTGGTGTGG - Intronic
1132621687 16:870869-870891 CCCTGCCAGGCTCCGTGGTGCGG - Exonic
1132761728 16:1511801-1511823 ATGTGCCAGGCGCTGTGCTGGGG + Intronic
1132814972 16:1821368-1821390 CTTCCCCAGCCTCTGTGTTGGGG - Intronic
1133147536 16:3800997-3801019 CTGTGCCAGGCTCTGTGTTCAGG + Intronic
1133171343 16:3984347-3984369 CGGGGCCTGGCTCTGTGCTGGGG + Intronic
1133317483 16:4893466-4893488 CTGGACCAGGGTCTGTGCTGTGG - Intronic
1133332390 16:4982551-4982573 CAGCCCCAGGCTCTGTGCTGGGG - Intronic
1133590360 16:7236927-7236949 ATCTGCCTGCCTCTGTGTTGTGG + Intronic
1133962139 16:10503768-10503790 CTGCGCCTGGCTGTGTGTTTTGG - Intergenic
1134824803 16:17275853-17275875 CTGTGGCAGGGTGTGTGTGGGGG - Intronic
1134907421 16:17992486-17992508 TTGTGCCAGGCACTGTGCTCAGG - Intergenic
1135503992 16:23020522-23020544 CTTTGCCACTCTCTGTGTTCAGG - Intergenic
1135745654 16:25014790-25014812 CTGTGCCGAGCGCTGTGCTGTGG - Intronic
1135756944 16:25106660-25106682 CTGTGCCGAGCGCTGTGCTGTGG - Intergenic
1135992216 16:27224949-27224971 GTGTGTGAGGCTCCGTGTTGGGG - Intergenic
1136515744 16:30767179-30767201 CTGAGCCAGGCTCTGTTCTAGGG + Intronic
1136569713 16:31089291-31089313 GTGTGCCAGGCTGAGTGGTGAGG + Intronic
1137308412 16:47229075-47229097 ATGTGTCAGGCACTGTGCTGGGG + Intronic
1137522628 16:49208085-49208107 TTGTGCCAGGCACTGTGCTGAGG + Intergenic
1137606526 16:49790370-49790392 CTGAGCCAGGCACTGTGCTGGGG + Intronic
1137769538 16:51004834-51004856 ATGTGCCAGGCACTGTTTTAGGG - Intergenic
1138607570 16:58098746-58098768 CTGTGCCAGGCACTGTCCTGGGG + Intergenic
1139294602 16:65889432-65889454 ATGTGCTAGGCACTGTGTTAGGG - Intergenic
1139389582 16:66598247-66598269 ATGTGACAGGCTCTGGGCTGGGG + Intergenic
1139391418 16:66608225-66608247 CTGAGCCAGGCCCTGTGGTCAGG - Intronic
1139460102 16:67115193-67115215 CTGTGCCAGGCACAGTGATTGGG + Intronic
1140000902 16:71024064-71024086 ATGTGCTAGGCACAGTGTTGGGG - Intronic
1140477921 16:75248283-75248305 ATGTGCGAGGCTCTGTGCTGGGG - Intronic
1140967502 16:79981166-79981188 CTGCGCCAGGCTCTGTGCTGGGG + Intergenic
1141185512 16:81784246-81784268 CTATGCCAGGCACTGAGGTGGGG - Intronic
1141269556 16:82526529-82526551 CTGTGCTTGGCCCTGTGCTGAGG + Intergenic
1141346686 16:83253034-83253056 CTGTGCCAGGTGCTGTGCTAAGG - Intronic
1141737373 16:85862527-85862549 CAGTGGCAGGCCCTGTCTTGGGG + Intergenic
1141843619 16:86591646-86591668 ATGTGTCAAGCTCTGTGCTGAGG + Intergenic
1141855710 16:86680124-86680146 CTGTGGCAGGCACTATTTTGGGG - Intergenic
1142029196 16:87829974-87829996 CTGCGCCAGGTTCTGTGTATAGG - Intergenic
1142179952 16:88663517-88663539 CTGTGTGAGGCGCTGTGCTGGGG + Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142611801 17:1112578-1112600 CAGAGCCAGACTCTGTCTTGAGG + Intronic
1142807415 17:2378800-2378822 CTGAGCCAGGCTCTGTGTCATGG + Intronic
1142882023 17:2889352-2889374 CAGTGCCAGGCCCTGTGCTGGGG + Intronic
1142984823 17:3689423-3689445 CTGGGCCTGGCTCTGTGACGAGG - Intronic
1143100884 17:4504084-4504106 CTAAGCCAGGCCCTGTCTTGTGG + Intronic
1143271246 17:5676603-5676625 TTGTGCCAGGCATTGTGTTAAGG + Intergenic
1143425748 17:6835987-6836009 ATGTGCCAGGCACTGTGCTTGGG + Intergenic
1143974665 17:10821082-10821104 CTGTGCCAGACCCTGTGCTGGGG - Intergenic
1144029896 17:11310222-11310244 GTGTGCCAGGCACTGTTTTAGGG + Intronic
1144050363 17:11492756-11492778 CTGTGCTAGGGTCTGAGTTCAGG - Intronic
1144707068 17:17376630-17376652 CTGCACCAGGCTCTGTGCTAGGG - Intergenic
1144771322 17:17761190-17761212 ATGTGCCAGTCCCTGTGCTGAGG - Intronic
1144794357 17:17881094-17881116 CTGTCCCTGTCTCTGTGCTGAGG - Intronic
1144839479 17:18176952-18176974 ATGTGCCAGGCGCTGAGTTATGG - Intronic
1145302194 17:21648518-21648540 CTGTGCAAGGTTCGGGGTTGAGG - Intergenic
1145348121 17:22054798-22054820 CTGTGCAAGGTTCGGGGTTGAGG + Intergenic
1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG + Intergenic
1145913370 17:28555551-28555573 CTGCCTGAGGCTCTGTGTTGAGG - Intronic
1146481529 17:33208770-33208792 ATGTGCCAGGCCCTGTTCTGAGG - Intronic
1146552952 17:33797919-33797941 CTGAGCCAGCCTATGTGTGGGGG - Intronic
1146624953 17:34428068-34428090 CTAAGCCTGTCTCTGTGTTGAGG + Intergenic
1146635188 17:34498840-34498862 TTGTGCCAGGCATTGTGCTGTGG - Intergenic
1146638675 17:34524398-34524420 TTGTGCCAGACATTGTGTTGGGG - Intergenic
1146683753 17:34826686-34826708 CTGGGCTGTGCTCTGTGTTGTGG - Intergenic
1146820343 17:35979633-35979655 GTGTGCCAGGCTCTGAGTTAAGG - Intronic
1147561408 17:41511567-41511589 CTGGGCCAGACTCTGGCTTGGGG - Intergenic
1147962792 17:44177971-44177993 CTGTGCTAGGCTCTCTGGGGTGG + Intronic
1147981483 17:44277231-44277253 CTTTGCCAGGCTCTGTGCCTAGG - Intergenic
1147988065 17:44317912-44317934 CTGTGCCAGGCACCGTGCTGGGG - Intronic
1148150483 17:45394099-45394121 CTGTGCCAGGTGCTGTGCTCTGG - Exonic
1148186840 17:45650543-45650565 CTGTGCCAGGCGCTGGGGAGGGG + Intergenic
1148750102 17:49940690-49940712 GTGTGCCAGGCACTGTGCTGAGG + Intergenic
1148901829 17:50884373-50884395 ATGAACCAGGCTCTGTGCTGGGG - Intergenic
1149447607 17:56725711-56725733 CTGTGCCTGGCCCTGTGTTAAGG + Intergenic
1150283083 17:63940648-63940670 CTGTGCCTGGCTCCCTGATGGGG - Exonic
1150716140 17:67574094-67574116 ATGTGCCAGTCACTGTGCTGGGG + Intronic
1151409180 17:73909895-73909917 ATGTGCCAGGTTCTGTGTCCAGG - Intergenic
1151626307 17:75278017-75278039 CTGTACCTGGCTCTGTAATGTGG - Intronic
1151675954 17:75597529-75597551 CTGTGCCAGGAACTGTGCTAAGG + Intergenic
1151994594 17:77600660-77600682 TTGTCTCAGGCTCTGTTTTGGGG + Intergenic
1152095804 17:78270893-78270915 CTGTGCCAGGTTCTGCCCTGAGG - Intergenic
1152335883 17:79700114-79700136 CTGTTCCAGGCCCTCTGCTGGGG - Intergenic
1152782909 17:82234301-82234323 CTGTCCCAGGCACTGTGGTGGGG + Exonic
1152998584 18:431861-431883 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1153370041 18:4305094-4305116 ATGTGCCAGGACCTGTGGTGAGG + Intronic
1153608298 18:6855899-6855921 ACGTGCCTGGCTCTGTGCTGTGG + Intronic
1154304941 18:13223727-13223749 GTGTGCCAGGCTCTGTTCTGAGG + Intronic
1154308052 18:13244697-13244719 CTGTGACAGGGTGTGTCTTGGGG - Intronic
1154333648 18:13449612-13449634 CTGAGCCAGGCTGTCTGCTGTGG + Intronic
1154945433 18:21157616-21157638 CTTACCCAGGCTCTGTTTTGGGG - Intergenic
1155038073 18:22042114-22042136 CTGTGCCAAGCACTGTGCTAGGG - Intergenic
1155095421 18:22550600-22550622 CTGTCCCAGGCACTGTGCTGAGG - Intergenic
1155215053 18:23635870-23635892 CAGAGGCAGGCTCTGTGGTGGGG + Intronic
1155518982 18:26650357-26650379 GTGTGCCAGGCACTGTATTAAGG + Intronic
1156589108 18:38465965-38465987 GTGAGCGAGGCTCTGTGTGGTGG - Intergenic
1157208311 18:45719308-45719330 CCTTGCCATGCTCTTTGTTGAGG - Intergenic
1157280285 18:46342443-46342465 ATGTGCAAGGCTCAGGGTTGGGG - Intronic
1157699885 18:49755538-49755560 ATGTGCCAGGCATTGTGCTGGGG + Intergenic
1158150739 18:54366732-54366754 CTGTGTCTGGCTGTGTGTGGTGG + Intronic
1158791777 18:60788578-60788600 CTGTTTCAGGCTCTATTTTGGGG + Intergenic
1159923754 18:74248557-74248579 GTGAGCCAGGCTATGTGCTGAGG + Intergenic
1160060622 18:75526033-75526055 ATGTGTCAGGCACTGTGCTGGGG + Intergenic
1160723438 19:607432-607454 CTGTGCCAGGCTCTGGGGAGGGG - Intronic
1160941865 19:1623885-1623907 CAGTGCCAGGCCCTGTGTCCTGG - Intronic
1161208145 19:3052881-3052903 GTGTCCCTGCCTCTGTGTTGTGG - Intergenic
1161563490 19:4986570-4986592 CTGTGCCAGGCCAGGTGCTGAGG + Intronic
1161609652 19:5234817-5234839 GTGTGCCAGGTGCTGTGCTGGGG + Intronic
1162553584 19:11372610-11372632 CTGTGCTGGACTCTGTGATGTGG + Intergenic
1162675148 19:12293362-12293384 CTTTTCCAGGCCCTGTGTTATGG - Exonic
1163294841 19:16405346-16405368 CTGCGCTGGGCTCTGTGGTGGGG + Intronic
1163601151 19:18249952-18249974 ATGTGCTGGGCTCTGTGCTGGGG - Intronic
1163604040 19:18264559-18264581 CTGAGCCAGGCCCTGTGTCAGGG - Exonic
1163672659 19:18637638-18637660 CTGTGGGAGGCTCTGGGTGGGGG + Intronic
1164714446 19:30381266-30381288 ATGTGCCAGGCACTGTGCTGGGG + Intronic
1164760596 19:30725698-30725720 AGGTGCCAGGCGCTGTGTTGAGG - Intergenic
1164811666 19:31162198-31162220 GTGGGCCAGGCACTGTGCTGGGG - Intergenic
1165138940 19:33687818-33687840 CAGTGCCTGGGTCCGTGTTGGGG + Intronic
1165328294 19:35126636-35126658 CGGGGCCAGGGTCTGCGTTGGGG + Exonic
1165354131 19:35293412-35293434 CTGTGCCTGTCTGTGTGTTCAGG + Intronic
1165663958 19:37609526-37609548 CAGTGCAAGACTCTGTCTTGGGG + Intronic
1166127168 19:40722085-40722107 GTGTGCCAGGCCATGTGCTGGGG + Intronic
1166561974 19:43738894-43738916 GTGTGCCAGGCCCTGTGCAGGGG - Intronic
1166669996 19:44704009-44704031 CTGGGCCAGGATCTCTGTGGGGG - Exonic
1166730190 19:45054848-45054870 CTGTGCCAGGCTCGGTGCTGGGG - Intronic
1166752747 19:45172482-45172504 CTGTGCCAGGCCCAGGGGTGTGG + Intronic
1166959669 19:46489922-46489944 GCGTGCCAGGCACGGTGTTGGGG + Intronic
1167015713 19:46839691-46839713 CTGTGCCTGGCCCTGTGCTGGGG + Intronic
1167076185 19:47250920-47250942 CAGAGCCAGGCTCTGTGGGGAGG - Intergenic
1167210471 19:48131029-48131051 CTCTGCCAGGGTCTGTGGTCAGG - Intronic
1167671606 19:50856776-50856798 CTCTGCCAGGCTCTGTCTCTCGG + Intronic
1168281651 19:55309037-55309059 AGATGACAGGCTCTGTGTTGGGG + Intronic
925039620 2:721245-721267 CTGTGCAAGGCTCTGATGTGTGG - Intergenic
925443711 2:3909813-3909835 CTGTGCCAGGCCTTGTGATGGGG + Intergenic
925910760 2:8572164-8572186 TTGTCACAGGCTGTGTGTTGGGG - Intergenic
925976111 2:9143254-9143276 GTGTGCCAGGCCCTGTGCTGGGG + Intergenic
926197280 2:10771642-10771664 CAGGGCCAGGCTCTGTGCTGGGG - Intronic
926698532 2:15787179-15787201 CTGGGCCAGGCTTTGTGTGAGGG - Intergenic
926702129 2:15810780-15810802 CTCTGCCGGGCCCTGTGTGGAGG - Intergenic
926710071 2:15872175-15872197 ATGTGGCAGGTTCTGTGCTGAGG + Intergenic
927199353 2:20568727-20568749 ATAGGCCAGGCCCTGTGTTGGGG + Intronic
927248926 2:20981020-20981042 CTCTGCCAGGCTCTGAGATCTGG - Intergenic
927615947 2:24595959-24595981 CTTTGACAGCATCTGTGTTGAGG + Intronic
927962847 2:27251260-27251282 TTGTGCAAGGCACTGTGGTGCGG - Intergenic
928157723 2:28892212-28892234 ATGTGCCAGGCACTGTTTTAGGG - Intergenic
928557093 2:32438297-32438319 CTGTACTATTCTCTGTGTTGTGG - Intronic
928924695 2:36565665-36565687 CTGAGCCTGGCTCTGTTCTGTGG - Intronic
929428655 2:41869142-41869164 CTGTGCCTGTCTGTGTGTAGGGG - Intergenic
929449270 2:42025757-42025779 CTCCTCCAGGCTCTGTTTTGGGG - Intergenic
929632673 2:43480799-43480821 CAGTGCGAGACTCTGTCTTGGGG + Intronic
930154762 2:48094670-48094692 CAGTGCAAGGCTCTTGGTTGGGG - Intergenic
931384167 2:61782277-61782299 CTGTGCCAGTCACTGAGTTTTGG - Intergenic
931872069 2:66472142-66472164 CTGTGCCAGGCTGTGTGTGGTGG - Intronic
932700854 2:73990453-73990475 GTTTGCCAGCCTCTGTGCTGGGG + Intronic
932886630 2:75554718-75554740 GGGTGCCAGGCACTGTGTTAGGG - Intronic
933832066 2:86219056-86219078 CTGGGCCTTGCTCTGTGATGTGG - Intronic
934300882 2:91775505-91775527 CAGTGCCAGGCTCTAGGCTGAGG + Intergenic
934736275 2:96691434-96691456 CTTGGCCAGGCCCTGTGGTGGGG - Intergenic
934856370 2:97732770-97732792 CTCTGCAAGGCTCTGAGGTGTGG + Intronic
934894318 2:98100696-98100718 CTGTGTCAGGCCCTGTATTAGGG + Intronic
935064438 2:99635855-99635877 CTGCCCCAGGCCCTGTGCTGGGG - Intronic
935292246 2:101620533-101620555 CTGGGGAAGGCTCTGTGTGGAGG - Intergenic
935782365 2:106519435-106519457 CTGAACCAGGCCCTGTATTGAGG + Intergenic
935863514 2:107360163-107360185 CTGAGCCAGGCACGGTGCTGTGG - Intergenic
936142008 2:109948593-109948615 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936178696 2:110246541-110246563 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936202682 2:110422891-110422913 CTGTGCCAGGCACTGTGCCAGGG + Intronic
936427643 2:112434450-112434472 GTGTGCCTGGATGTGTGTTGCGG - Intronic
936450366 2:112629347-112629369 CTGTGCCTGGCTCAGAGCTGAGG - Intergenic
936503792 2:113088359-113088381 GTGTGCCTGGCTCTGTGCTAAGG - Intergenic
936944440 2:117917834-117917856 CTCCGCCAGCCTCTGGGTTGGGG - Exonic
937747122 2:125427529-125427551 CTGTGCCATGATGTGGGTTGTGG - Intergenic
937854158 2:126660603-126660625 CTGTGACAGGCCCTGAGTGGGGG - Intronic
938320371 2:130358657-130358679 CTGTGCCACTCTCTGTGCTAAGG - Intronic
938772529 2:134512620-134512642 TTGTGCCAGGCACTGTTCTGGGG + Intronic
938986695 2:136583479-136583501 CTGTGCCAGGCACTGGGCTGTGG + Intergenic
940129981 2:150370090-150370112 ATGTGCCTGGCTGTGTGCTGTGG + Intergenic
940825227 2:158404103-158404125 CTATACCAGGCACTGTGTTAAGG - Intronic
941017731 2:160375828-160375850 CTTCACAAGGCTCTGTGTTGAGG - Intronic
941269729 2:163409950-163409972 TTATGCTAGACTCTGTGTTGTGG - Intergenic
941509718 2:166390580-166390602 ATGTGCCAAGCTCAGTGTTAAGG - Intergenic
941911381 2:170768686-170768708 ATGTGCGAGGCTCTGTGTCAGGG + Intergenic
943247578 2:185474368-185474390 GTGTGCCTGGCTATGTGTAGTGG + Intergenic
943965681 2:194328691-194328713 CTGTGCCTGGCTGTGTGCAGTGG + Intergenic
943990725 2:194687982-194688004 CTATGCCAGGCTAATTGTTGGGG - Intergenic
944678448 2:202053850-202053872 ATGTGCCAGGCTCTGTGCTGGGG - Intergenic
945056347 2:205872710-205872732 CTGTGCCAGGGTCAGGGCTGTGG + Intergenic
946148126 2:217746178-217746200 ATGTGCCAGGCACTGTCCTGTGG - Intronic
946339124 2:219057162-219057184 CTGTGGCAGGCTCTGGACTGTGG + Intronic
946477581 2:220023435-220023457 CTGGGCCAGGCTCTAGGATGTGG + Intergenic
946691263 2:222310234-222310256 CTGTCTCAGTCTCTGTCTTGGGG + Intergenic
946921050 2:224582822-224582844 ATGTGCCAGGCACTGTTCTGGGG - Intronic
947159476 2:227197778-227197800 CTGTGCCAGGCATGGTGGTGAGG + Intronic
947305080 2:228736813-228736835 CTGTGGCAATCTCTGGGTTGGGG - Intergenic
947329846 2:229016849-229016871 CTGGGCCAGGCACTGTATTAAGG - Intronic
947353756 2:229271685-229271707 CTGTGCCTGGCGCTGTGCTAGGG + Intergenic
947617793 2:231569384-231569406 GGGTGCCAGGCTCTGTCCTGAGG - Intergenic
947926230 2:233924991-233925013 CAGTGCCAGTCTCTGAGGTGTGG + Intronic
947967561 2:234294258-234294280 CTGTGCCAGGGGATGAGTTGGGG + Intergenic
948311295 2:236988901-236988923 CTGTTCCAAGTTCTGAGTTGGGG + Intergenic
948756798 2:240164815-240164837 CTGTGCCCAGCCCTGTGCTGGGG - Intergenic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1168966853 20:1903969-1903991 GTGTGTCAGGCCCTGTGCTGAGG - Intronic
1168967872 20:1910189-1910211 CTGTGCCAGGCCCTGAGCTAAGG - Intronic
1168986869 20:2056490-2056512 CTGTGCCAGGCACTGTACTAAGG + Intergenic
1169077222 20:2768589-2768611 CTCTGTAGGGCTCTGTGTTGTGG - Intergenic
1169211803 20:3769942-3769964 TTGTGCTAGGCTCTGTGGAGTGG + Intergenic
1169664122 20:8015591-8015613 GTGTGTCAGGTTCAGTGTTGGGG - Intronic
1170098916 20:12677028-12677050 ATGTGTCTGGCTCTGTGTTAAGG + Intergenic
1170907734 20:20530860-20530882 CTCTGCCAGGCGCTGTGCTGAGG - Intronic
1171113587 20:22505231-22505253 CAGTGCCAGGCTGAGTGTTCTGG + Intergenic
1171294941 20:24009114-24009136 ATGTGCCAGGCTCTGGCCTGTGG + Intergenic
1171337164 20:24395037-24395059 CTGTCTCAGGCTCTGCTTTGGGG - Intergenic
1171558078 20:26096265-26096287 CTGTGCAAGGTTCGGGGTTGAGG + Intergenic
1172145527 20:32755200-32755222 CTGTGCCAGGCACTGTGGTAAGG - Intergenic
1172256626 20:33524164-33524186 ATGTGCCAGGCACTGAGTTAAGG - Intronic
1172287847 20:33753503-33753525 GTGTGCCAGACACTGTGCTGGGG + Intronic
1172291942 20:33783256-33783278 TTGACCCAGGCTCTGTGCTGGGG + Intronic
1172313582 20:33936337-33936359 CTGTGCCAGCGTCTGGGTGGCGG + Intergenic
1172626052 20:36347480-36347502 ATGTGCCAAGCCCTGTGCTGGGG + Intronic
1172807849 20:37625659-37625681 GTGAGCAAGGCTCTGTGTTCTGG - Intergenic
1173025751 20:39305889-39305911 ATGTGCCAGGTACTGTGCTGGGG + Intergenic
1173351422 20:42248923-42248945 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1173923197 20:46761377-46761399 CTGTGCCAGGCTCTGGTGTTGGG - Intergenic
1173953960 20:47016398-47016420 ATGTGCCAGGCTCTATCTCGAGG + Intronic
1174060259 20:47827355-47827377 CTGTGCCAGGCACTGCGCTCAGG - Intergenic
1174071638 20:47904015-47904037 CTGTGCCAGGCACTGCGCTCAGG + Intergenic
1174152411 20:48494620-48494642 CTGTGCCAGGCACTGCGCTCAGG - Intergenic
1174224470 20:48985736-48985758 GTGTGCCAGGCACTGTGCTAAGG + Intronic
1174309110 20:49636606-49636628 CTATGCCAGGCTGAGTGCTGTGG + Intronic
1174523511 20:51153529-51153551 ATGTGCCAAGCACTGTGCTGAGG + Intergenic
1174775698 20:53341313-53341335 TTGTGCCAGACTCTGTGCTAAGG + Intronic
1174929962 20:54802762-54802784 ATGTGCCAGGCATTGTGCTGGGG - Intergenic
1175145147 20:56890256-56890278 CTGAGCCAGCCTCTGAGTCGAGG - Intergenic
1175172190 20:57088589-57088611 CTGTGGCAGCCTCTCTTTTGGGG - Intergenic
1175360048 20:58402600-58402622 CTGTGCTAGGCACTGGGATGTGG - Intronic
1175376088 20:58524954-58524976 CTGTGCCAGGCTCTGGTCTTGGG - Intergenic
1175587872 20:60159853-60159875 ATGTTCCAGGCTCTGTGGTTGGG + Intergenic
1175599818 20:60264207-60264229 CTGTGGCAGGGTATGTGTGGGGG - Intergenic
1175640720 20:60628030-60628052 ATGTGCCAGGCACTGTGCTAAGG - Intergenic
1175755275 20:61525624-61525646 GTGTGCTCGGCTCTGTGCTGCGG + Intronic
1175815704 20:61882189-61882211 CTGTGTCTGGCTTTGTGCTGAGG + Intronic
1175830939 20:61965407-61965429 ATGTGCCAGGCTCTGCGGGGAGG - Intronic
1177043081 21:16136544-16136566 CTATGCCAGGCTCTGTCCTAGGG - Intergenic
1177080109 21:16628499-16628521 ATGTGCTAGGCTCTGTGTAGGGG + Intergenic
1177848688 21:26321269-26321291 CTATGCCAGGCACTGCTTTGTGG + Intergenic
1178461587 21:32807217-32807239 ATGTGCCAGGCCCTGTGCTAAGG - Intronic
1178583632 21:33855760-33855782 TTGTGCCAGGCTCTCTGCAGTGG + Intronic
1178769135 21:35486133-35486155 ATGTGCCAGGCACTATGTTAAGG - Intronic
1178778433 21:35575386-35575408 CTGAACCAGGCTTTCTGTTGTGG - Intronic
1178992861 21:37368604-37368626 AAGTGCCAGGCTCTGTTTTTAGG + Intronic
1179256534 21:39721337-39721359 CTGTGCCAGGTACTTTGTAGGGG - Intergenic
1179543383 21:42099061-42099083 CAGTGCCTGGCTCTGTGTCCTGG - Exonic
1179982203 21:44901419-44901441 CTCTGTCAGGCGCTGTGTGGGGG - Intronic
1180148369 21:45934640-45934662 CTGAGCCAGGCTATGTGCAGGGG + Intronic
1180816274 22:18791639-18791661 CAGTGCCAGGCTCTAGGCTGGGG - Intergenic
1181202463 22:21225971-21225993 CAGTGCCAGGCTCTAGGCTGGGG - Intronic
1181361979 22:22344551-22344573 CTGTCCCAGGCCCTGCCTTGGGG + Intergenic
1181541960 22:23578432-23578454 CAGGGTCAGGCTCTGTGCTGGGG - Intronic
1181699244 22:24610643-24610665 CAGTGCCAGGCTCTAGGCTGGGG + Intronic
1181727908 22:24824366-24824388 CTGTGCCTGGTTCTATGCTGTGG - Intronic
1181750066 22:24983016-24983038 GTGGGCCAGGCTCTGTGCTGGGG + Intronic
1181769401 22:25114351-25114373 GTGTGCCTGGCACTGTGCTGGGG - Intronic
1181914675 22:26270145-26270167 CTGTGCCAGGTTCTATTTTTGGG - Intronic
1182007961 22:26977227-26977249 CTGTGCCAGGCACTGTGATAAGG - Intergenic
1182025352 22:27114023-27114045 ATGTGCCAGGCCCTGTGTTAGGG + Intergenic
1182044804 22:27265968-27265990 CGATGCCAGGCTCTGTTTGGTGG - Intergenic
1182114337 22:27746694-27746716 CTGTGCCTGGCACTGTGCTCAGG + Intergenic
1182861115 22:33560250-33560272 CTGTGCCAGCCACTCTGTTAAGG - Intronic
1182903226 22:33916372-33916394 AGGTGCCATGCTCTGTGTGGAGG - Intronic
1183062650 22:35345557-35345579 CTGTGCCAGGCTGTGGGTGATGG - Intronic
1183221560 22:36517209-36517231 TTGTGCTAGGCTCTTGGTTGTGG - Intronic
1183247962 22:36708606-36708628 CTGTGTCAGGCCCTGTGCTGAGG + Intergenic
1183251979 22:36736844-36736866 TGGTGCCAGGCACTGTGCTGGGG - Intergenic
1183376582 22:37468920-37468942 CTGTGCCAGGCTCTGTAACATGG + Intergenic
1183516739 22:38271261-38271283 ATGTGCCAGGCACTATGCTGGGG - Intronic
1183542982 22:38440649-38440671 CAGTGCCAGTCGCTGTGATGAGG + Intronic
1183563977 22:38599653-38599675 GTGTGCCAGGCGCTGTGCTAAGG + Intronic
1183972389 22:41487455-41487477 CAGTCCCAGACTATGTGTTGTGG - Intronic
1184377492 22:44123902-44123924 CTGTGCCAGGCACTGTGCCAGGG - Intronic
1184472580 22:44704131-44704153 ATGTGCTAAGCACTGTGTTGAGG - Intronic
1184637074 22:45841427-45841449 TTGTGCCAGGCTCCATGTTGAGG + Intronic
1185004510 22:48267853-48267875 CTATGTCAGCGTCTGTGTTGCGG + Intergenic
1185010123 22:48308247-48308269 CTGTGCCAGGCCCTGGGTGAAGG + Intergenic
1185184053 22:49381979-49382001 CTGGGCCAGGCTCTGAGTCAAGG - Intergenic
1185275993 22:49950422-49950444 CTGGGCCAGGCTGTGTTATGGGG + Intergenic
1203224450 22_KI270731v1_random:69442-69464 CAGTGCCAGGCTCTAGGCTGGGG + Intergenic
1203266377 22_KI270734v1_random:17350-17372 CAGTGCCAGGCTCTAGGCTGGGG - Intergenic
949202790 3:1399764-1399786 ATGTGCCAGGCACTGTGCTAGGG + Intronic
949493976 3:4614428-4614450 CTGTGCCAGGATCTGTTTGAAGG + Intronic
949497339 3:4644926-4644948 CTGTGCCAGGCACTAGGTTTAGG - Intronic
949541692 3:5037482-5037504 CTGTGCCAGGCACTATGCTCAGG - Intergenic
949610685 3:5700323-5700345 ATGTGCCAGGTTTTGTGTTAAGG + Intergenic
949838415 3:8293821-8293843 CTGTGCCAGGCATTGTTCTGGGG - Intergenic
950190198 3:10971212-10971234 CTGTACCAGGCTCTAGGCTGGGG - Intergenic
950436568 3:12983803-12983825 TTGTGCCAGGCGCCGTGCTGAGG - Intronic
950442862 3:13019937-13019959 GTCTGCCAGGCTCTGTGAGGCGG + Intronic
950769948 3:15303347-15303369 GTGTGGCAGGCTCTGGGCTGGGG - Intronic
950914884 3:16634295-16634317 GTGTGCCAGGCACTGTGCTAAGG - Intronic
951188009 3:19736307-19736329 CTATTCCAGGCCCTGTGCTGAGG - Intergenic
952206682 3:31187363-31187385 GTATGCCAGGCACTGTGCTGAGG + Intergenic
952311513 3:32194745-32194767 CTGAGCCAGGCTGTGTCATGGGG - Intergenic
952333130 3:32383012-32383034 ATGTGCCAGGCACTGTGCTGAGG + Intergenic
952512293 3:34069594-34069616 ATGTGTCAGGCACTGTGTTGGGG + Intergenic
952555943 3:34531321-34531343 CTGTGCCTGGCACTGCTTTGAGG - Intergenic
952827898 3:37539249-37539271 TTGACCCAGGCTCTGTTTTGGGG - Intronic
952952808 3:38538476-38538498 CTTTGGGAGGCTCTGTGATGGGG + Intronic
953141981 3:40237564-40237586 CTGTGTCAGGCTCTGGGTGGTGG - Intronic
953481502 3:43256125-43256147 CTGTGCCAGGCACTGTGAGGGGG + Intergenic
954037488 3:47859432-47859454 CTGTGCCAGGCCTTGGGCTGTGG - Intronic
954143874 3:48624490-48624512 AGGTGCCAGGCTCTGTGCAGGGG - Intergenic
954576163 3:51677529-51677551 CTGTGTCAGGCTCTGTGAGTGGG + Intronic
954700285 3:52447247-52447269 CTGTGTCAGGCCCTGTGTTGGGG + Intergenic
954796913 3:53166151-53166173 CTGGGCCTGACTCTGGGTTGGGG + Intronic
955102705 3:55867309-55867331 CTGTGCTAGGCACTGTGTGTGGG - Intronic
955198589 3:56829211-56829233 CTGTCCCAGGCTGGGTGTGGTGG - Intronic
955338338 3:58105276-58105298 CTGTGTCAGGCTGGATGTTGGGG + Intronic
955339702 3:58116001-58116023 TAGGGCCAGGCTCTGTGCTGGGG - Intronic
955378070 3:58414658-58414680 CTCTGCCAGGCATTGTGCTGGGG - Intronic
956345797 3:68277058-68277080 ATGTGCCAGGCACTGTGCTAAGG + Intronic
956354221 3:68373106-68373128 ATGTGCCAGGCACTGTGTTAGGG - Intronic
956372554 3:68579305-68579327 CTGTGGTAGTCTCAGTGTTGGGG + Intergenic
956403481 3:68904602-68904624 TTGTCCCAGGCTCTGCTTTGGGG - Intronic
957573184 3:81975342-81975364 CTGTGCCAGGCACTGCGCTTGGG + Intergenic
959905273 3:111704295-111704317 CTGTGACTGGCTCTGAGGTGAGG - Intronic
961007113 3:123412526-123412548 CACTGACAGCCTCTGTGTTGCGG + Intronic
961115217 3:124323456-124323478 GTGGGCCAGGCTCTGTGTTGGGG - Intronic
961475907 3:127146213-127146235 GTGTGCCAGGCCCTATGTTATGG - Intergenic
961507440 3:127379384-127379406 CTGTACCAGGCTCTGGGTTTGGG - Intergenic
961519927 3:127461202-127461224 CTGTGCTAGGCCCTGTGCTGGGG + Intergenic
961621073 3:128225578-128225600 ATGTGCCAGGCACGGTGCTGGGG - Intronic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
961692039 3:128676863-128676885 TTGGGCCAGGCTCTGAGATGTGG - Intronic
962050701 3:131811781-131811803 TTGTGTCAGGCACTGTGTTAAGG + Intronic
962099122 3:132323336-132323358 ATGTTCCAGGCACTGTTTTGGGG + Intronic
962244228 3:133778200-133778222 ATGTGCCAGTTTCTGTGCTGTGG - Intronic
962352215 3:134664346-134664368 GTGTGCCTGGCTGTGTGCTGAGG - Intronic
962629642 3:137263291-137263313 ATGTGCCAGGCTCTGTGTTGGGG - Intergenic
962680428 3:137793923-137793945 TTCTGCCAGGCTCTGGGTTCAGG - Intergenic
962742568 3:138372623-138372645 ATGTGCCAGGCCTGGTGTTGAGG - Intronic
963460735 3:145611492-145611514 CTGTGGCTGGCCCAGTGTTGAGG + Intergenic
963803024 3:149696261-149696283 TGTTGCCAGTCTCTGTGTTGAGG - Intronic
964129952 3:153275929-153275951 CTGGGCCTGGCTGTGTCTTGGGG + Intergenic
964704609 3:159604496-159604518 CTGTGCCAGGCACTGTGCCAGGG + Intronic
965827117 3:172742519-172742541 CTGTGGCAGCCTTGGTGTTGTGG + Intergenic
966431937 3:179841117-179841139 CTGTGCCAAGCAATGGGTTGTGG - Intronic
966669006 3:182506102-182506124 ATGTGAAAGGCTCTGTGGTGGGG - Intergenic
966775199 3:183537579-183537601 CTGGGTCAGGCTCTATTTTGGGG - Intronic
966883971 3:184364643-184364665 CTATGCTAGGCACTGTGCTGAGG - Intronic
966945651 3:184775464-184775486 CTGCCCCAGGCTCTCTGCTGTGG + Intergenic
967088328 3:186113764-186113786 CTGTGCTAGACTCTGTTTAGGGG + Intronic
967229130 3:187320919-187320941 CTGGGTCAGGCTCTGTGTCTGGG + Intergenic
967473381 3:189888924-189888946 CTGTGCCAGGCACTGTGCTAGGG + Intronic
967746406 3:193060665-193060687 CTGTGCCATGCTCAGCGTAGGGG - Intergenic
967888784 3:194350573-194350595 ATGTGCCAGGCGCTGTGTTAAGG - Intronic
967935071 3:194720720-194720742 CTGTGCCAGGCATTGTGCCGAGG - Intergenic
967935794 3:194726381-194726403 CTGTGCCAGACACTGTCCTGGGG - Intergenic
968425301 4:519298-519320 CTGTGCCAGGCGCTGTGCCAGGG - Intronic
968495527 4:913365-913387 CTGTGGCAGGGGCTGTGCTGGGG - Intronic
968501149 4:950663-950685 CTGTCCCAGGCCCTGGGTTTGGG - Intronic
969263159 4:6046425-6046447 CTGTGCCAGGCTCAGAATCGGGG + Intronic
969482287 4:7453166-7453188 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482424 4:7453822-7453844 TGGGGCCAGGCACTGTGTTGGGG + Intronic
969482468 4:7454034-7454056 TGGGGCCAGGCACTGTGTTGGGG + Intronic
969482513 4:7454246-7454268 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482596 4:7454656-7454678 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482705 4:7455197-7455219 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482730 4:7455309-7455331 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482793 4:7455606-7455628 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482835 4:7455804-7455826 TAGGGTCAGGCTCTGTGTTGGGG + Intronic
969586625 4:8097701-8097723 GTGTGCTAGACTCTGTGCTGGGG + Intronic
969722193 4:8898270-8898292 ATGTGCCTGGCTCTGTGCTCTGG - Intergenic
970035617 4:11732277-11732299 CTGTGCCAGGCCCTCGGTTAGGG + Intergenic
970421702 4:15911067-15911089 CTGTGTCAGGTGCTGTGTTCAGG + Intergenic
971098767 4:23438613-23438635 ATGTGCCAGGTTCTATGTTAAGG - Intergenic
972583563 4:40416471-40416493 ATGTGCCAGGCTTTGTGATGGGG - Intergenic
972629138 4:40828521-40828543 CTGTGCCAGGCCATGTTCTGAGG + Intronic
973647876 4:52968200-52968222 GTGTGCCAGGCACTGTGCTAGGG + Intronic
973796739 4:54434839-54434861 AGGTGTAAGGCTCTGTGTTGAGG - Intergenic
974510144 4:62829135-62829157 TTGTGCCTAGCTCTGTATTGTGG + Intergenic
975819147 4:78252379-78252401 CTGTCCCATGCTGTGTGTTAGGG - Exonic
976521990 4:86039406-86039428 CTGTGGCAGGCCCAGTGTTGGGG - Intronic
977247653 4:94652359-94652381 CTCTACCATGCTCTGTGTTATGG + Intronic
977565657 4:98577878-98577900 ATGTGCCGGGCACTGTGCTGAGG - Intronic
977922331 4:102659467-102659489 CTTTGCCAGACTCTGTGTTCTGG + Intronic
978189091 4:105893028-105893050 TTGTGCCAGGCATTGTGCTGGGG + Intronic
978195379 4:105965941-105965963 GTGTGCCAGCCTCTGTGCTAAGG - Intronic
978198727 4:106000139-106000161 GTGTGCCAGGCAATGTGTTAAGG + Intronic
978289433 4:107119553-107119575 CTGTGTTAGGCTCTGTGTGTAGG + Intronic
978418081 4:108500184-108500206 CTCTGACAGGCTCTGATTTGAGG - Intergenic
979592771 4:122499191-122499213 ATGTGCCAGGCACTGGGTTAGGG + Intergenic
980283764 4:130756149-130756171 CTGTGGCAGGCCCAGTGTTGAGG + Intergenic
982110209 4:152046391-152046413 CTGTGTCAGGCTCAGTATTTGGG - Intergenic
984181935 4:176494465-176494487 CTGTGCCAGTCACTGAGTTTTGG + Intergenic
984929477 4:184834104-184834126 AAGTGCCAGGCACTGTATTGGGG - Intergenic
985186153 4:187318056-187318078 GTGTGCCAGCAGCTGTGTTGTGG - Intergenic
985356309 4:189123260-189123282 CTGGGCCAGCCGCTGTGCTGAGG - Intergenic
985747401 5:1655019-1655041 CTGGAACAGGCTCTGTGTGGAGG - Intergenic
985770803 5:1809437-1809459 CGGAGCCGGGCTCTGTGTCGTGG + Intronic
986447278 5:7832345-7832367 CTGAGCCAGGATCTGGGTGGTGG - Intronic
986724568 5:10584679-10584701 CTGTGCCAGGCGCTGTTCTAGGG + Intronic
986741562 5:10710022-10710044 GATTGCCAGGCTCTGTGATGAGG + Intronic
986929122 5:12795749-12795771 CTGTGCCAACCTCTGTGATGGGG - Intergenic
988081050 5:26416120-26416142 CTGTTCCTGGCTGTGTGTAGTGG - Intergenic
988087598 5:26491203-26491225 TTGTGCCAGTCACTGAGTTGTGG - Intergenic
988367016 5:30313327-30313349 CTGTGCCAGTCACTGAGTTTTGG - Intergenic
988412047 5:30898975-30898997 ATGTGCCAGGCACTGTGGTAGGG + Intergenic
990547526 5:56837720-56837742 TTGTGCCAGGCTTTCTGCTGGGG + Intronic
990943587 5:61228289-61228311 ATGTGCCAGGCACTGTGGTAGGG - Intergenic
991599671 5:68340080-68340102 ATGTGTCAGCCTCTGTGTTGGGG - Intergenic
991665113 5:68991987-68992009 CTGTTCCAGGTTCTGTGCTAAGG + Intergenic
991953481 5:71969814-71969836 CTGTGCCAGGCTGGGCGTGGTGG + Intergenic
992006013 5:72478208-72478230 CTGTGCCAGGCCTTGTGTGGGGG + Intronic
992441288 5:76799865-76799887 ATGTGCCAGGTACTGTGTTACGG + Intergenic
993020417 5:82584748-82584770 CTGTCCCAGCCGCTGTGCTGTGG + Intergenic
993082765 5:83322400-83322422 CTGTGCCAGGCAATATGCTGTGG + Intronic
993371608 5:87099470-87099492 CTGTGTCAGTGTGTGTGTTGAGG - Intergenic
994149397 5:96431553-96431575 TCGTGCCAGGCTCCGTGTTAGGG - Intronic
995275574 5:110274169-110274191 CAGAGCCAGGCTCTGTCTTGGGG - Intergenic
995755245 5:115496475-115496497 ATGTGCCAGGCTCTCTTCTGGGG - Intergenic
995807495 5:116069848-116069870 TTGTGCCAAGCTCTGTGCTAGGG - Intergenic
996589451 5:125129532-125129554 GTGTGCCAAGCTCCGTGCTGGGG + Intergenic
997019981 5:129988579-129988601 ATGTGCTAGGCTCTGTTTTAGGG - Intronic
997369459 5:133348844-133348866 CTGTTCCAGGCTCCATGCTGGGG - Intronic
997443737 5:133926579-133926601 CTGTGCCAGGAACAGTGGTGGGG - Intergenic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
998216431 5:140241398-140241420 AAGTGCCAGGCCCTGTGCTGAGG - Intronic
998426747 5:142035285-142035307 CTGTGCCTGGCTGTGGGTGGGGG + Intergenic
999099316 5:149009528-149009550 CTGTGCCAGGCACTGAGCTAGGG - Intronic
999265856 5:150266485-150266507 CTGTGCCAAGCACTGTGCAGAGG + Intronic
999584814 5:153078574-153078596 ATGTGCCAGGCACTCTGTTAGGG - Intergenic
999743751 5:154576376-154576398 GTGTGCCAGGCACTGGGTTAGGG - Intergenic
1000810143 5:165851358-165851380 CTGTGCCAGGCATTGTTTAGGGG + Intergenic
1001628868 5:173159938-173159960 CTGGGCCAGGCTCTCTTTGGTGG - Exonic
1001781876 5:174375807-174375829 CTGTGCCAGACACTGTGCTAAGG + Intergenic
1001961387 5:175882176-175882198 CTGTGCCTGTGTCTGTGATGGGG + Exonic
1001967497 5:175921532-175921554 TGGTGCCAGGCTCTGTGCTAGGG - Intronic
1001975480 5:175995162-175995184 CAGTGCCACGCTCTGTGCTAGGG - Intronic
1002021738 5:176368006-176368028 ATGTGCCAGGCATTGTGCTGAGG + Intronic
1002241954 5:177848608-177848630 CAGTGCCACGCTCTGTGCTAGGG + Intergenic
1002566621 5:180115848-180115870 CTGTGCCGGGATCAGTGGTGGGG + Intronic
1002685475 5:181005900-181005922 CTGTGTCTGGGTCTGTGGTGTGG - Exonic
1003050093 6:2772431-2772453 GTGTGCCAGGCACTGTGCTGGGG - Intronic
1003513152 6:6798356-6798378 ATGTGCCAGGTTCTGTGCTTGGG + Intergenic
1004250872 6:14022198-14022220 CTTTGCCAGTCTCTGGGTAGAGG + Intergenic
1004362772 6:14985894-14985916 CTGTGCCAGACCCTGCGCTGGGG + Intergenic
1005137733 6:22590258-22590280 CTGTGCAAGGCTCTCAGTTGGGG - Intergenic
1005302159 6:24481584-24481606 CTGAGCCAAACTCTGTGGTGAGG - Intronic
1006029765 6:31170447-31170469 TTGGGCCAGGCTCTGAGGTGTGG - Exonic
1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG + Intronic
1006466504 6:34197732-34197754 TTGTGCCAGGCCCTCTGCTGGGG + Intergenic
1006525488 6:34601226-34601248 ATGCGCCAGGCACTGTGCTGAGG - Intronic
1007111526 6:39315800-39315822 CTGTGCCAGGGTCTGTGCCAGGG - Intronic
1007122732 6:39396735-39396757 ATGTGCCAGGCACTGTGCTGGGG - Intronic
1007164937 6:39822412-39822434 TTGTGCCAGGCTTTGTGCTGGGG + Intronic
1007481232 6:42151456-42151478 CTGTGTCAGGCTCTGTGCTCAGG + Intergenic
1007493419 6:42242279-42242301 ATGTGCCAGGCATTGTGTTAGGG - Intronic
1007523981 6:42474902-42474924 CTGTGCTAGGGTCTGTGATGAGG - Intergenic
1007627967 6:43257190-43257212 CTCTGCCAGGCCCTGGGTTCAGG - Intronic
1007687526 6:43675739-43675761 ATGTGCAAAGCTCTGTGTGGAGG - Intronic
1007746678 6:44047486-44047508 CTGTGCCAGGTGCTGTGCTTGGG - Intergenic
1008013649 6:46493177-46493199 GTGTGCCAGGCACTGTGCTTAGG - Intergenic
1008051448 6:46903854-46903876 CTGTGCTAGTCACTGTGCTGTGG + Intronic
1008323010 6:50141321-50141343 CTGGTCCAGGCTATGGGTTGTGG - Intergenic
1008355718 6:50550571-50550593 CTCTGCCAGGGACTGTGTTTGGG - Intergenic
1009425269 6:63506883-63506905 TTGTCTCAGGCTCTGTTTTGAGG - Intergenic
1009697363 6:67124115-67124137 CAGTGACAGGCTTTTTGTTGAGG - Intergenic
1009857257 6:69280718-69280740 GTGTGCCAGGCATTGTGCTGAGG - Intronic
1011335105 6:86251539-86251561 ATGAGCCAGGCCCTGTGTTGGGG + Intergenic
1011471682 6:87714314-87714336 GTGTGCCAGGCACTGTTCTGAGG + Intergenic
1012814713 6:104008615-104008637 CTGTGCTAGACCCTGTGCTGTGG - Intergenic
1013015962 6:106160844-106160866 CTGTGCCAGGACATGTCTTGTGG + Intergenic
1013033408 6:106358253-106358275 ATGTGCCAGGCCCTGACTTGGGG - Intergenic
1013054827 6:106573542-106573564 ATGTGCCAGGCACTGTTTTAGGG + Intronic
1013419267 6:109951281-109951303 CTTTGCCATGCTCTATGTTGGGG + Intergenic
1014510292 6:122312527-122312549 ATGTGCCAGTCACTGTGTTTAGG - Intergenic
1015386653 6:132632454-132632476 CTGTACCAGGCTCTGTGGCAGGG + Intergenic
1015870342 6:137769840-137769862 ATATGCCAGGCTCTGTGCTGAGG - Intergenic
1015941397 6:138456020-138456042 CTGTGCCAGGCACTGTGCTAAGG + Intronic
1016651244 6:146463464-146463486 ATGTGCCAGACACTGTGCTGAGG - Intergenic
1017892129 6:158647417-158647439 TTGTGTCAGGCTCTGAGCTGGGG + Intergenic
1017945672 6:159094607-159094629 CTGAGCCAGGCTCTGGGCCGCGG - Intergenic
1018569127 6:165188261-165188283 ATGTGCCAGGCACTGGGCTGGGG + Intergenic
1019047525 6:169160333-169160355 CTGGGCCAGGTTCGGTGGTGTGG - Intergenic
1019121279 6:169806703-169806725 CTGTGGAGTGCTCTGTGTTGTGG - Intergenic
1019293420 7:261383-261405 CTGTGCCAGGCTGGGTGCAGCGG + Intergenic
1019664701 7:2245997-2246019 GTGCGACAGGCTCTGTGCTGGGG + Intronic
1020263591 7:6545697-6545719 ATGTGCCAGGCGCTGTGCTTGGG - Intronic
1021088319 7:16450472-16450494 CTGTGCCAGGCTTTGCTTCGTGG - Intergenic
1021402945 7:20230866-20230888 GTGTGCCAGGCACTGTTTTAGGG - Intergenic
1022226866 7:28372006-28372028 GTGTGCCAGGCTCTGTTCTGGGG + Intronic
1022473150 7:30694058-30694080 GTGTGCCAGGCTCTGAACTGGGG - Intronic
1023083449 7:36546874-36546896 CTGTGCCAGGCTCTAGGATATGG - Intronic
1023367270 7:39476214-39476236 TTGGGCCAGGCACTGTTTTGGGG - Intronic
1023938743 7:44757032-44757054 CTGTCCCAGGCACTGTGGGGAGG - Exonic
1024035475 7:45504460-45504482 CTGAGCCTGCCTCTGGGTTGGGG - Intergenic
1024548970 7:50544571-50544593 CTGCCCCAGGCTCTGAGCTGAGG - Intronic
1024983965 7:55180108-55180130 CTGAGCCAGGCTCTGAGATAGGG - Intronic
1025234679 7:57226674-57226696 CTGTGCCAGGTGCTGTGCTCAGG + Intergenic
1025834822 7:65084939-65084961 GTGGCCCAGGCTCTGTGTAGGGG + Intergenic
1025904594 7:65774418-65774440 GTGGCCCAGGCTCTGTGTAGGGG + Intergenic
1026198075 7:68190183-68190205 CTGTGCCAGGCTAATTTTTGTGG + Intergenic
1026223820 7:68423419-68423441 CTATGCCAGGCTATTTCTTGAGG - Intergenic
1026243343 7:68596559-68596581 GTTTGCTAGGCTCTGTGTTAAGG + Intergenic
1026256744 7:68718795-68718817 ATGTGCCAGGCCCTATGTTGAGG - Intergenic
1026535812 7:71237725-71237747 GTGTGCTAAGCTCTGTGCTGGGG - Intronic
1026586765 7:71661836-71661858 CTGTCCTGGGCTCTGTGGTGTGG - Intronic
1027425724 7:78059903-78059925 CTGTGCCTGCCTTTCTGTTGTGG - Intronic
1028141029 7:87274825-87274847 TTCTGCCAGGCTGGGTGTTGTGG + Intergenic
1029104761 7:98166003-98166025 CAGTGCCCGGCCCTGTGCTGGGG + Intronic
1029906778 7:104100711-104100733 CTTGGCCAGGCTCTGTGCAGGGG - Intergenic
1030323635 7:108196154-108196176 TTGTGCCAGACACTGTGCTGGGG - Intronic
1030330347 7:108263687-108263709 GTGAGCCAGGCTCTGTGGAGTGG - Intronic
1030764402 7:113390955-113390977 CTGTGTCAGGCACTGGGTAGAGG + Intergenic
1030876199 7:114816524-114816546 ATGTGCCAGGCACTGTTTTAGGG - Intergenic
1031076178 7:117214844-117214866 TTGTGCCAGGCATTGGGTTGAGG + Intronic
1031934629 7:127724104-127724126 TTGTGCCAGATACTGTGTTGGGG + Intronic
1032336458 7:131029369-131029391 TTGAGCCAGGCTCTGTGATAGGG - Intergenic
1032411455 7:131696067-131696089 CTGTGTCAGGCTCTGTTTTGGGG + Intergenic
1033046036 7:137962804-137962826 TTGTGCCAGGTACTGTGTTCTGG - Intronic
1033271647 7:139937858-139937880 CTGTGCCAGGGGCTGTCTGGAGG + Intronic
1034442390 7:151092579-151092601 CTCTGCCAGGCTCACTGCTGGGG + Intronic
1034452370 7:151143874-151143896 CATTGGCAGGCTCTCTGTTGGGG - Exonic
1034479373 7:151307917-151307939 CTGTGCCAGCCTCTGAGGGGAGG - Intergenic
1034588173 7:152114783-152114805 GTATGCCAGGCTCTGTGTTAGGG + Intronic
1034662210 7:152781432-152781454 ATGTGCCAGGCACTGTGCCGGGG + Intronic
1034692251 7:153023214-153023236 CTGTGCCAGGCACTGTTTAAGGG + Intergenic
1035281817 7:157783372-157783394 ATGTCCCAGGCTGTGTGGTGAGG - Intronic
1035678713 8:1472002-1472024 CTGTGCCAGGCACTACGTTAAGG + Intergenic
1035898966 8:3436451-3436473 GTGTGCCAGGCACTATTTTGAGG - Intronic
1036036325 8:5023349-5023371 CTGTGCCAATCACTGAGTTGTGG + Intergenic
1036163198 8:6407280-6407302 GTGTGCCAGGCGCTGTGCTTAGG + Intronic
1036635810 8:10548836-10548858 GTGTGTCAGGCACTGTGCTGGGG + Intronic
1037487608 8:19363365-19363387 CTGTGCCCGGCCTTATGTTGGGG + Intronic
1037506869 8:19539452-19539474 ATATGCCAGGCCCTGTGCTGAGG - Intronic
1037864610 8:22433273-22433295 GTGTGCCAGGCACTGTGTTAAGG - Intronic
1038662506 8:29509285-29509307 CTATGCCAGAATCTGTGTTTGGG + Intergenic
1038970979 8:32635219-32635241 CTGTGACAGGCATTGTGCTGGGG - Intronic
1039061083 8:33572712-33572734 CTGTGCCAAGCCCTGTGCTCAGG + Intergenic
1039557322 8:38485806-38485828 CAGTGGCAGGGGCTGTGTTGTGG - Intergenic
1039596024 8:38790405-38790427 CTGTTCAAAGCTCTCTGTTGTGG - Intronic
1039785596 8:40831890-40831912 CTGAGCCAGGCCTTGTGCTGAGG + Intronic
1039969166 8:42306957-42306979 CTGTGTCAGGCACTGTGCTCAGG + Intronic
1041138112 8:54782649-54782671 CTGTGCTTGGCTGTGTGGTGTGG + Intergenic
1041361732 8:57061828-57061850 GTGTGCCAGGCACTGTGTTAAGG - Intergenic
1041390459 8:57343122-57343144 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1041890898 8:62867374-62867396 CTGTGCTAGGCACTATGTTGAGG - Intronic
1042795950 8:72663472-72663494 GTGTGCCATGCTGGGTGTTGGGG + Intronic
1043340824 8:79236908-79236930 CTGTGCCTGGCACTGTGCTAGGG + Intergenic
1043750216 8:83925730-83925752 CAGTGCCTGGCTCTGTGCTGTGG - Intergenic
1045329681 8:101144325-101144347 GTGTAACAGACTCTGTGTTGTGG - Intergenic
1045648405 8:104321270-104321292 CTGTGCCTGGCTCTGGGCTTGGG + Intergenic
1046126517 8:109915955-109915977 CTGTGCCAGGCTCTTTTTTGTGG - Intergenic
1047628512 8:126680917-126680939 CTGTGCCAGGGTCTGTGGCATGG - Intergenic
1047697256 8:127416018-127416040 TTGGGCCAGGCTCTGAGGTGTGG + Exonic
1047770589 8:128027290-128027312 GAGTGCCAGGCTCTGTGCTCAGG + Intergenic
1047784721 8:128142602-128142624 TTGTGCCAGGCACTGTGCTTAGG - Intergenic
1047819837 8:128506756-128506778 CTGTGCCAAGCACTATGCTGGGG - Intergenic
1048002843 8:130393737-130393759 CAGAGCGAGACTCTGTGTTGCGG + Intronic
1048062255 8:130932433-130932455 CTGTGGCAGGCCCAGTGTTGGGG + Intronic
1048366825 8:133745601-133745623 CTGTGCCAGGCACCATGCTGAGG - Intergenic
1048426206 8:134326159-134326181 ATGTGCCAGGCACTGTATTTTGG - Intergenic
1049093688 8:140535300-140535322 CTGTGCCAGGCGCTGGGGTGGGG - Intronic
1049245558 8:141560443-141560465 ACGTGCCAGGCTCTGTGCTGAGG + Intergenic
1049261427 8:141641261-141641283 CTATGTCAGGCTCTGTGCTCTGG - Intergenic
1049449824 8:142654664-142654686 CTGTGCCTGACTCTGGGGTGGGG - Intergenic
1049577439 8:143396292-143396314 CTGTTCAGGGCTCTCTGTTGAGG + Intergenic
1049660434 8:143817389-143817411 CTGGGCCAGGGTCAGTGCTGGGG + Exonic
1049746678 8:144266045-144266067 CTGTGCCAGGCCGTGTGCAGGGG - Intronic
1049798306 8:144506395-144506417 CAGTTCCAGGCTGTGAGTTGGGG + Exonic
1049820048 8:144627956-144627978 CTGGGCCAGAGTCTGAGTTGCGG - Intergenic
1050684768 9:8155574-8155596 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1051456565 9:17265518-17265540 CTCTGCCAGGCTTTGGTTTGAGG + Intronic
1052280133 9:26723609-26723631 CTGTGCTGGGCTTTGTGATGGGG + Intergenic
1052750836 9:32488335-32488357 ATGTGTCAGGCTCTGTGCTAAGG - Intronic
1053114825 9:35490917-35490939 ATGTGCCAGGCACCGTGCTGGGG - Intronic
1053268057 9:36730353-36730375 CTGTGCCAGGCACAGGGTTCTGG + Intergenic
1054881808 9:70151843-70151865 GTGTGCCAGGCTCTCAGTTTAGG - Intronic
1055083775 9:72293334-72293356 CTGTGTCAGGCACTGGGTTTAGG + Intergenic
1055503981 9:76929822-76929844 CTGTGCCATGATGTGGGTTGAGG + Intergenic
1055964203 9:81849650-81849672 CTGTGCTGGGCTCTGGGATGCGG + Intergenic
1056105386 9:83341933-83341955 CAGTGACAAGCTCAGTGTTGTGG + Intronic
1056991743 9:91419673-91419695 ATGTGCCAGGCACAGTGTTGAGG - Intronic
1057441851 9:95089162-95089184 CTCTGCCAGGCCCTGGGTGGAGG - Intergenic
1058633058 9:107009081-107009103 CTGGACCAGGTTATGTGTTGTGG - Intronic
1058811569 9:108644582-108644604 AAGAGCCAGGCTCTGTGATGTGG + Intergenic
1059341905 9:113602120-113602142 CTGTGCCTGGCCTTGTGCTGAGG - Intergenic
1059472009 9:114512390-114512412 GTGTGCCAGGCACTGTGTGTGGG + Intergenic
1059762693 9:117354116-117354138 CTGGGACAGGCTATGTGTGGTGG + Intronic
1059954456 9:119501163-119501185 CTTTGCCAGGCACTGTGCTATGG - Intronic
1060016119 9:120087926-120087948 CTGTGCCAGGTACTGTAGTGAGG + Intergenic
1060072940 9:120565924-120565946 CTGTGCCAGGCTCTCTGCCAGGG - Intronic
1060170867 9:121459870-121459892 CTGTGCTAGGCATTGTGTTAGGG - Intergenic
1060215632 9:121736796-121736818 CTGTGCCAGGCTCTGGTTCGAGG + Intronic
1060264110 9:122100344-122100366 CTGTGCTGGGCCCTGTGCTGGGG - Intergenic
1060290052 9:122293727-122293749 ATGTGCCAGGCTCTGTGCTGGGG + Intronic
1060433157 9:123568384-123568406 GTGTGCCAGGCACTGTGCTAGGG - Intronic
1060521625 9:124297322-124297344 ATGTGCCAGGCTCTGTGCTAAGG + Intronic
1060607750 9:124932603-124932625 ATGTGCCAGGCTGTGTTTTAGGG - Intronic
1060652493 9:125340691-125340713 CTATACCAGGCTCTGTATTAAGG + Intronic
1060722376 9:125987580-125987602 CTTTGCAGGGCTCTGTGTCGGGG + Intergenic
1060824416 9:126679814-126679836 CAGAGTCAGGCTCTGTGTAGAGG - Intronic
1060855712 9:126914179-126914201 CTGTGCCAGGCACGGTGAGGTGG - Intergenic
1061017947 9:127993516-127993538 ATGTGCCAGGCCCTGGGTTGGGG - Intergenic
1061087417 9:128407205-128407227 CTGGGTCAGGCTCTGTTCTGAGG + Intergenic
1061192095 9:129087970-129087992 CTGTGCCAGGCTGTGTGCTGGGG + Intronic
1061203275 9:129149212-129149234 ATGTGCCAGGCCCTGAGCTGAGG - Intergenic
1061213603 9:129207566-129207588 CTGTGAGAGTCTTTGTGTTGTGG + Intergenic
1061252180 9:129432854-129432876 GTGTGCCAGGCTCTGTCCAGTGG - Intergenic
1061257735 9:129462364-129462386 ATGTGCAAGGCTCTGTGTGGAGG - Intergenic
1061281628 9:129601011-129601033 CTGTGGCAGGCTCTGTGTTAGGG + Intergenic
1061389859 9:130311443-130311465 GTGTGCCAGGCCCTGTGCTGGGG + Intronic
1061399209 9:130359323-130359345 CTGGGCCTGGCTCGATGTTGGGG - Intronic
1061527382 9:131177890-131177912 ATGTGCCAGGCTCTGTGTTAGGG - Intronic
1061621186 9:131812354-131812376 CTGTGCCAGGATCTGTGCCAAGG - Intergenic
1061707019 9:132461114-132461136 TTGTGCCAGGCACTGTGCGGAGG - Intronic
1062105648 9:134753438-134753460 CTGAGTCAGGCCCTGTGTGGAGG - Intronic
1062206918 9:135342509-135342531 CTGTGCCAGGCTCCTTGGCGGGG - Intergenic
1062289940 9:135789947-135789969 CAGTGCCAGGGCCTGGGTTGTGG - Intronic
1062606476 9:137350878-137350900 CTCTGCCAGGCTCTGCTCTGGGG + Intronic
1187144945 X:16628942-16628964 CTGTGCCAGGCACTGTTCTAAGG + Intronic
1187238738 X:17493523-17493545 ATATGCCAGGCACTGTGCTGGGG - Intronic
1187387447 X:18861423-18861445 CTGTGCGAGACTCTGTCTTGAGG + Intergenic
1187669816 X:21657144-21657166 GTGTGCCAGGCGCTCAGTTGTGG + Exonic
1187786403 X:22892401-22892423 TTGTGCCAGGCATTGTGTTAAGG + Intergenic
1189316101 X:40057650-40057672 CTGTGCCAGGCACTGAGCTAAGG - Intronic
1189897631 X:45672698-45672720 ATGTCCCAGGCTCTTTGTTGGGG - Intergenic
1191666025 X:63703596-63703618 ATGTACCAGGCACTGTGCTGGGG + Intronic
1192054940 X:67763804-67763826 CTGTGCCAGGCCCTGTTTCAGGG + Intergenic
1192331152 X:70176260-70176282 GTTTGCCAGGCACTGTGTTTAGG - Intergenic
1193800738 X:85933052-85933074 CTGTGCCTGGCTTTGAGTTTAGG - Intronic
1194934452 X:99931466-99931488 CTGTGCCAGGCACTATGTTAAGG + Intergenic
1195555356 X:106215281-106215303 TTGTATCAGGCTCTGTTTTGTGG + Intergenic
1195616783 X:106918675-106918697 AGGTGCCAGGCACTGTGCTGAGG - Intronic
1196013814 X:110916272-110916294 CTATGCCAGGCACTGTGCTATGG + Intergenic
1196126688 X:112108947-112108969 CTGTGGCAGGCCCAGTATTGAGG + Intergenic
1197652577 X:129081937-129081959 CTGAGTCAGCCTCTGGGTTGAGG + Intergenic
1197764023 X:130047784-130047806 ATGTGCCAGGCACTGGGTTTAGG + Intronic
1198675405 X:139125689-139125711 CAGTGCCTGGCCCTGTGTTAGGG + Intronic
1198792685 X:140362731-140362753 CTGGACCAGGCTCTGTGGAGGGG - Intergenic
1199296443 X:146164271-146164293 CTGTGCCAGGTTCTGTGCTAAGG - Intergenic
1199681729 X:150229411-150229433 CTGTGCCAAGCCCTGTGCTGAGG - Intergenic
1200017747 X:153179339-153179361 CTGACCCAGGCTCTGTGAGGAGG + Exonic
1200181154 X:154151453-154151475 GCGTGCCAGGCTCTGTGCTAAGG + Intronic
1200186799 X:154188567-154188589 GCGTGCCAGGCTCTGTGCTAAGG + Intergenic
1200192450 X:154225705-154225727 GCGTGCCAGGCTCTGTGCTAAGG + Intronic
1200198205 X:154263509-154263531 GCGTGCCAGGCTCTGTGCTAAGG + Intronic
1200872737 Y:8121126-8121148 CTGTGACAGGGGCTGTGGTGGGG + Intergenic
1201186174 Y:11405175-11405197 CTCTGCCAGGCTCTGTTATCAGG + Intergenic
1202624305 Y:56841778-56841800 CTTTTCCAGGCTCTGTGTATGGG + Intergenic