ID: 1168863038

View in Genome Browser
Species Human (GRCh38)
Location 20:1059837-1059859
Sequence TGCCATTATGTTAAACTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168863038_1168863049 28 Left 1168863038 20:1059837-1059859 CCAAGCAGTTTAACATAATGGCA No data
Right 1168863049 20:1059888-1059910 GATCAGGGTGGCCCAAGCTAAGG No data
1168863038_1168863045 13 Left 1168863038 20:1059837-1059859 CCAAGCAGTTTAACATAATGGCA No data
Right 1168863045 20:1059873-1059895 AGACCTGTCCTGGTGGATCAGGG No data
1168863038_1168863043 6 Left 1168863038 20:1059837-1059859 CCAAGCAGTTTAACATAATGGCA No data
Right 1168863043 20:1059866-1059888 GTTAGGGAGACCTGTCCTGGTGG No data
1168863038_1168863044 12 Left 1168863038 20:1059837-1059859 CCAAGCAGTTTAACATAATGGCA No data
Right 1168863044 20:1059872-1059894 GAGACCTGTCCTGGTGGATCAGG No data
1168863038_1168863042 3 Left 1168863038 20:1059837-1059859 CCAAGCAGTTTAACATAATGGCA No data
Right 1168863042 20:1059863-1059885 ACAGTTAGGGAGACCTGTCCTGG No data
1168863038_1168863047 16 Left 1168863038 20:1059837-1059859 CCAAGCAGTTTAACATAATGGCA No data
Right 1168863047 20:1059876-1059898 CCTGTCCTGGTGGATCAGGGTGG No data
1168863038_1168863040 -10 Left 1168863038 20:1059837-1059859 CCAAGCAGTTTAACATAATGGCA No data
Right 1168863040 20:1059850-1059872 CATAATGGCAACCACAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168863038 Original CRISPR TGCCATTATGTTAAACTGCT TGG (reversed) Intergenic