ID: 1168863041

View in Genome Browser
Species Human (GRCh38)
Location 20:1059861-1059883
Sequence AGGACAGGTCTCCCTAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168863041_1168863049 4 Left 1168863041 20:1059861-1059883 CCACAGTTAGGGAGACCTGTCCT No data
Right 1168863049 20:1059888-1059910 GATCAGGGTGGCCCAAGCTAAGG No data
1168863041_1168863047 -8 Left 1168863041 20:1059861-1059883 CCACAGTTAGGGAGACCTGTCCT No data
Right 1168863047 20:1059876-1059898 CCTGTCCTGGTGGATCAGGGTGG No data
1168863041_1168863051 12 Left 1168863041 20:1059861-1059883 CCACAGTTAGGGAGACCTGTCCT No data
Right 1168863051 20:1059896-1059918 TGGCCCAAGCTAAGGTCTGGAGG No data
1168863041_1168863050 9 Left 1168863041 20:1059861-1059883 CCACAGTTAGGGAGACCTGTCCT No data
Right 1168863050 20:1059893-1059915 GGGTGGCCCAAGCTAAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168863041 Original CRISPR AGGACAGGTCTCCCTAACTG TGG (reversed) Intergenic