ID: 1168863047

View in Genome Browser
Species Human (GRCh38)
Location 20:1059876-1059898
Sequence CCTGTCCTGGTGGATCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168863038_1168863047 16 Left 1168863038 20:1059837-1059859 CCAAGCAGTTTAACATAATGGCA No data
Right 1168863047 20:1059876-1059898 CCTGTCCTGGTGGATCAGGGTGG No data
1168863041_1168863047 -8 Left 1168863041 20:1059861-1059883 CCACAGTTAGGGAGACCTGTCCT No data
Right 1168863047 20:1059876-1059898 CCTGTCCTGGTGGATCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168863047 Original CRISPR CCTGTCCTGGTGGATCAGGG TGG Intergenic