ID: 1168863049

View in Genome Browser
Species Human (GRCh38)
Location 20:1059888-1059910
Sequence GATCAGGGTGGCCCAAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168863041_1168863049 4 Left 1168863041 20:1059861-1059883 CCACAGTTAGGGAGACCTGTCCT No data
Right 1168863049 20:1059888-1059910 GATCAGGGTGGCCCAAGCTAAGG No data
1168863038_1168863049 28 Left 1168863038 20:1059837-1059859 CCAAGCAGTTTAACATAATGGCA No data
Right 1168863049 20:1059888-1059910 GATCAGGGTGGCCCAAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168863049 Original CRISPR GATCAGGGTGGCCCAAGCTA AGG Intergenic