ID: 1168863051

View in Genome Browser
Species Human (GRCh38)
Location 20:1059896-1059918
Sequence TGGCCCAAGCTAAGGTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168863048_1168863051 -8 Left 1168863048 20:1059881-1059903 CCTGGTGGATCAGGGTGGCCCAA No data
Right 1168863051 20:1059896-1059918 TGGCCCAAGCTAAGGTCTGGAGG No data
1168863041_1168863051 12 Left 1168863041 20:1059861-1059883 CCACAGTTAGGGAGACCTGTCCT No data
Right 1168863051 20:1059896-1059918 TGGCCCAAGCTAAGGTCTGGAGG No data
1168863046_1168863051 -3 Left 1168863046 20:1059876-1059898 CCTGTCCTGGTGGATCAGGGTGG No data
Right 1168863051 20:1059896-1059918 TGGCCCAAGCTAAGGTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168863051 Original CRISPR TGGCCCAAGCTAAGGTCTGG AGG Intergenic