ID: 1168868528

View in Genome Browser
Species Human (GRCh38)
Location 20:1109295-1109317
Sequence TGTGTGTATGTAGGGTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168868528_1168868536 -6 Left 1168868528 20:1109295-1109317 CCCCACCACCCTACATACACACA No data
Right 1168868536 20:1109312-1109334 CACACAGACTGCCCCAGGATGGG No data
1168868528_1168868537 -3 Left 1168868528 20:1109295-1109317 CCCCACCACCCTACATACACACA No data
Right 1168868537 20:1109315-1109337 ACAGACTGCCCCAGGATGGGAGG No data
1168868528_1168868541 16 Left 1168868528 20:1109295-1109317 CCCCACCACCCTACATACACACA No data
Right 1168868541 20:1109334-1109356 GAGGCAGCTGTGATCACTGCTGG No data
1168868528_1168868535 -7 Left 1168868528 20:1109295-1109317 CCCCACCACCCTACATACACACA No data
Right 1168868535 20:1109311-1109333 ACACACAGACTGCCCCAGGATGG No data
1168868528_1168868542 19 Left 1168868528 20:1109295-1109317 CCCCACCACCCTACATACACACA No data
Right 1168868542 20:1109337-1109359 GCAGCTGTGATCACTGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168868528 Original CRISPR TGTGTGTATGTAGGGTGGTG GGG (reversed) Intergenic
No off target data available for this crispr