ID: 1168868534

View in Genome Browser
Species Human (GRCh38)
Location 20:1109307-1109329
Sequence ACATACACACAGACTGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168868526_1168868534 -9 Left 1168868526 20:1109293-1109315 CCCCCCACCACCCTACATACACA No data
Right 1168868534 20:1109307-1109329 ACATACACACAGACTGCCCCAGG No data
1168868525_1168868534 2 Left 1168868525 20:1109282-1109304 CCTCTGCAGGTCCCCCCACCACC No data
Right 1168868534 20:1109307-1109329 ACATACACACAGACTGCCCCAGG No data
1168868527_1168868534 -10 Left 1168868527 20:1109294-1109316 CCCCCACCACCCTACATACACAC No data
Right 1168868534 20:1109307-1109329 ACATACACACAGACTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168868534 Original CRISPR ACATACACACAGACTGCCCC AGG Intergenic
No off target data available for this crispr