ID: 1168868535

View in Genome Browser
Species Human (GRCh38)
Location 20:1109311-1109333
Sequence ACACACAGACTGCCCCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168868528_1168868535 -7 Left 1168868528 20:1109295-1109317 CCCCACCACCCTACATACACACA No data
Right 1168868535 20:1109311-1109333 ACACACAGACTGCCCCAGGATGG No data
1168868526_1168868535 -5 Left 1168868526 20:1109293-1109315 CCCCCCACCACCCTACATACACA No data
Right 1168868535 20:1109311-1109333 ACACACAGACTGCCCCAGGATGG No data
1168868530_1168868535 -9 Left 1168868530 20:1109297-1109319 CCACCACCCTACATACACACAGA No data
Right 1168868535 20:1109311-1109333 ACACACAGACTGCCCCAGGATGG No data
1168868527_1168868535 -6 Left 1168868527 20:1109294-1109316 CCCCCACCACCCTACATACACAC No data
Right 1168868535 20:1109311-1109333 ACACACAGACTGCCCCAGGATGG No data
1168868529_1168868535 -8 Left 1168868529 20:1109296-1109318 CCCACCACCCTACATACACACAG No data
Right 1168868535 20:1109311-1109333 ACACACAGACTGCCCCAGGATGG No data
1168868525_1168868535 6 Left 1168868525 20:1109282-1109304 CCTCTGCAGGTCCCCCCACCACC No data
Right 1168868535 20:1109311-1109333 ACACACAGACTGCCCCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168868535 Original CRISPR ACACACAGACTGCCCCAGGA TGG Intergenic
No off target data available for this crispr