ID: 1168868537

View in Genome Browser
Species Human (GRCh38)
Location 20:1109315-1109337
Sequence ACAGACTGCCCCAGGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168868530_1168868537 -5 Left 1168868530 20:1109297-1109319 CCACCACCCTACATACACACAGA No data
Right 1168868537 20:1109315-1109337 ACAGACTGCCCCAGGATGGGAGG No data
1168868528_1168868537 -3 Left 1168868528 20:1109295-1109317 CCCCACCACCCTACATACACACA No data
Right 1168868537 20:1109315-1109337 ACAGACTGCCCCAGGATGGGAGG No data
1168868531_1168868537 -8 Left 1168868531 20:1109300-1109322 CCACCCTACATACACACAGACTG No data
Right 1168868537 20:1109315-1109337 ACAGACTGCCCCAGGATGGGAGG No data
1168868525_1168868537 10 Left 1168868525 20:1109282-1109304 CCTCTGCAGGTCCCCCCACCACC No data
Right 1168868537 20:1109315-1109337 ACAGACTGCCCCAGGATGGGAGG No data
1168868526_1168868537 -1 Left 1168868526 20:1109293-1109315 CCCCCCACCACCCTACATACACA No data
Right 1168868537 20:1109315-1109337 ACAGACTGCCCCAGGATGGGAGG No data
1168868527_1168868537 -2 Left 1168868527 20:1109294-1109316 CCCCCACCACCCTACATACACAC No data
Right 1168868537 20:1109315-1109337 ACAGACTGCCCCAGGATGGGAGG No data
1168868529_1168868537 -4 Left 1168868529 20:1109296-1109318 CCCACCACCCTACATACACACAG No data
Right 1168868537 20:1109315-1109337 ACAGACTGCCCCAGGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168868537 Original CRISPR ACAGACTGCCCCAGGATGGG AGG Intergenic
No off target data available for this crispr