ID: 1168868542

View in Genome Browser
Species Human (GRCh38)
Location 20:1109337-1109359
Sequence GCAGCTGTGATCACTGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168868531_1168868542 14 Left 1168868531 20:1109300-1109322 CCACCCTACATACACACAGACTG No data
Right 1168868542 20:1109337-1109359 GCAGCTGTGATCACTGCTGGTGG No data
1168868532_1168868542 11 Left 1168868532 20:1109303-1109325 CCCTACATACACACAGACTGCCC No data
Right 1168868542 20:1109337-1109359 GCAGCTGTGATCACTGCTGGTGG No data
1168868539_1168868542 -10 Left 1168868539 20:1109324-1109346 CCCAGGATGGGAGGCAGCTGTGA No data
Right 1168868542 20:1109337-1109359 GCAGCTGTGATCACTGCTGGTGG No data
1168868530_1168868542 17 Left 1168868530 20:1109297-1109319 CCACCACCCTACATACACACAGA No data
Right 1168868542 20:1109337-1109359 GCAGCTGTGATCACTGCTGGTGG No data
1168868533_1168868542 10 Left 1168868533 20:1109304-1109326 CCTACATACACACAGACTGCCCC No data
Right 1168868542 20:1109337-1109359 GCAGCTGTGATCACTGCTGGTGG No data
1168868526_1168868542 21 Left 1168868526 20:1109293-1109315 CCCCCCACCACCCTACATACACA No data
Right 1168868542 20:1109337-1109359 GCAGCTGTGATCACTGCTGGTGG No data
1168868538_1168868542 -9 Left 1168868538 20:1109323-1109345 CCCCAGGATGGGAGGCAGCTGTG No data
Right 1168868542 20:1109337-1109359 GCAGCTGTGATCACTGCTGGTGG No data
1168868529_1168868542 18 Left 1168868529 20:1109296-1109318 CCCACCACCCTACATACACACAG No data
Right 1168868542 20:1109337-1109359 GCAGCTGTGATCACTGCTGGTGG No data
1168868528_1168868542 19 Left 1168868528 20:1109295-1109317 CCCCACCACCCTACATACACACA No data
Right 1168868542 20:1109337-1109359 GCAGCTGTGATCACTGCTGGTGG No data
1168868527_1168868542 20 Left 1168868527 20:1109294-1109316 CCCCCACCACCCTACATACACAC No data
Right 1168868542 20:1109337-1109359 GCAGCTGTGATCACTGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168868542 Original CRISPR GCAGCTGTGATCACTGCTGG TGG Intergenic
No off target data available for this crispr