ID: 1168873079

View in Genome Browser
Species Human (GRCh38)
Location 20:1147516-1147538
Sequence ATTGAGGAGGAGAAAGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1582
Summary {0: 1, 1: 1, 2: 10, 3: 147, 4: 1423}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168873079_1168873086 16 Left 1168873079 20:1147516-1147538 CCATCCCCTTTCTCCTCCTCAAT 0: 1
1: 1
2: 10
3: 147
4: 1423
Right 1168873086 20:1147555-1147577 AGATCTATTTCACAAGAGTAAGG 0: 1
1: 0
2: 0
3: 13
4: 183
1168873079_1168873087 27 Left 1168873079 20:1147516-1147538 CCATCCCCTTTCTCCTCCTCAAT 0: 1
1: 1
2: 10
3: 147
4: 1423
Right 1168873087 20:1147566-1147588 ACAAGAGTAAGGCACTGAACTGG 0: 1
1: 0
2: 2
3: 18
4: 222
1168873079_1168873084 -8 Left 1168873079 20:1147516-1147538 CCATCCCCTTTCTCCTCCTCAAT 0: 1
1: 1
2: 10
3: 147
4: 1423
Right 1168873084 20:1147531-1147553 TCCTCAATTAAGTCTTTCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168873079 Original CRISPR ATTGAGGAGGAGAAAGGGGA TGG (reversed) Intronic
900031185 1:374078-374100 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900031200 1:374127-374149 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900051754 1:602327-602349 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900544531 1:3221048-3221070 AGTGAGGTGGAGAGGGGGGACGG + Intronic
900753015 1:4411563-4411585 GAAGAGGAGGAGGAAGGGGAGGG - Intergenic
901026333 1:6280544-6280566 CATGAGGAGGAGAAAGGCCAAGG + Intronic
901243603 1:7710719-7710741 ATAGAGGAGGAGAGTGGGGTGGG - Intronic
901261129 1:7871872-7871894 ATTGAGGAGGCCCAAGGAGAGGG - Intergenic
901988424 1:13093293-13093315 ATTGAGCAATAGAATGGGGAAGG + Intergenic
901993388 1:13133474-13133496 ATTGAGCAATAGAATGGGGAAGG - Intergenic
902780965 1:18704860-18704882 ATTGAGGCATAGAAAGGGGAAGG - Intronic
902793938 1:18788026-18788048 AGAGAGGAAGAGAAGGGGGAGGG + Intergenic
902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG + Exonic
902971324 1:20054067-20054089 ATGGAGGAGGACCAAGTGGAGGG - Intronic
903431922 1:23310832-23310854 GAAGAGGAGGAGGAAGGGGAGGG - Exonic
903432321 1:23315828-23315850 ATTGAGAATAATAAAGGGGATGG - Intronic
903656227 1:24950325-24950347 CATGGGGAGGAGAAAGGGGTTGG - Intronic
903672719 1:25046072-25046094 ATTGAGGAGGTGACAGCGGGTGG + Intergenic
903818845 1:26085474-26085496 ATAGAAGGGGAGAACGGGGAGGG - Intergenic
904280469 1:29415055-29415077 ATTGAGGCCCAGAAAGGGCAAGG - Intergenic
904348510 1:29889849-29889871 AAGGAGCAGGAGAAATGGGAAGG + Intergenic
904352632 1:29918873-29918895 GATGAGGAGGAGTCAGGGGAAGG + Intergenic
904464774 1:30701316-30701338 CTTCAGGAGGAGGAAGGGGAGGG - Intergenic
904573430 1:31484976-31484998 ATGGAGGTGGGGATAGGGGAGGG + Intergenic
904920139 1:34000982-34001004 GGGGAGAAGGAGAAAGGGGAAGG + Intronic
905205134 1:36339138-36339160 ATTGAGGAGAGGGAGGGGGAGGG + Intergenic
906077997 1:43066352-43066374 ACTGAGGCTTAGAAAGGGGAAGG - Intergenic
906175683 1:43770209-43770231 AGTGAGGAGAGGAGAGGGGAGGG + Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906537556 1:46560097-46560119 AGTGAGGAGGGGAAATGGGCAGG + Intronic
906559150 1:46742223-46742245 ATTGTGGAGGAGCAGGAGGATGG + Intergenic
906628713 1:47346825-47346847 AGTGAGGAGGAGAGATGGGGAGG - Intronic
906646301 1:47477988-47478010 ACTGAGGGTCAGAAAGGGGAAGG - Intergenic
906646480 1:47478844-47478866 AGAGAGGAGGAGCAAGAGGAGGG - Intergenic
906784309 1:48600955-48600977 ATAGACGTGGAGAAAGGGAATGG - Intronic
906859300 1:49341871-49341893 AGAGAGGAGGAGAAAGGGGAGGG - Intronic
907106687 1:51889317-51889339 AGTGAGGAGGGGAGAGGTGAGGG + Intergenic
907222158 1:52914974-52914996 TTTGAGGAAAAGAAGGGGGAAGG - Intronic
907271209 1:53292337-53292359 ATTGAGGCCCAGAAAGGGAAAGG + Intronic
907448561 1:54526827-54526849 ATGGAGGAAGGCAAAGGGGAAGG - Intergenic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
907858389 1:58326453-58326475 CTTGAGGAGGAGAAAGATGAAGG + Intronic
908006403 1:59733304-59733326 AGTGAGGAGGAGATGGGGCAGGG - Intronic
908353157 1:63306225-63306247 AATAAGGAGGAGAAGGAGGAAGG + Intergenic
908440843 1:64152294-64152316 CTAGAGGAGAAGAATGGGGAAGG - Intronic
908617386 1:65937314-65937336 ATTGTGGAGGGGAAAGTGGTTGG + Intronic
908721546 1:67131614-67131636 ATGGTGGAACAGAAAGGGGAAGG - Intronic
908845795 1:68323137-68323159 ACTGAGGGGCAGAAAAGGGATGG - Intergenic
909142559 1:71887235-71887257 GAGGAGGAGGAGGAAGGGGAGGG + Intronic
909292798 1:73905259-73905281 ACTGAAGAGGAGAAAGAGGAAGG + Intergenic
909320083 1:74274287-74274309 AAGGAGGAGGAGGAAGAGGAGGG + Intronic
909563241 1:77027618-77027640 GTTGAGGAGAAGGAAAGGGAGGG + Intronic
909686546 1:78355211-78355233 AAGGAGGAGGAGAAAGGGGAGGG - Intronic
910171339 1:84380505-84380527 AGGGAGGAAGAGAAAGGAGAGGG + Intronic
910262718 1:85307645-85307667 ACAGAGGAGGAGAGAGGAGAGGG - Intergenic
910336604 1:86139165-86139187 AGGGAGAAGGAGAAAGGGGGGGG + Intronic
910447484 1:87313366-87313388 ACTAGAGAGGAGAAAGGGGATGG + Intergenic
910503404 1:87921206-87921228 ACTGAGGCTGAGAAAGGTGAAGG + Intergenic
910667617 1:89741741-89741763 GTTGAGGTGGGGAATGGGGAAGG + Intronic
910892069 1:92028872-92028894 GCTGAGGAGGAGAAAGAAGAAGG - Intergenic
910944655 1:92577275-92577297 AGGGAGGAGGAGAAATGGGCAGG - Intronic
910990763 1:93053554-93053576 ATTGAGAAGGTGAAAAAGGAAGG - Intergenic
911036177 1:93550997-93551019 ATAGAGGAGGACAAAGGTGACGG + Exonic
911248902 1:95552554-95552576 TTTGAGAAGATGAAAGGGGACGG - Intergenic
911323566 1:96443181-96443203 AATGAGGAGGAGGAGGAGGAGGG - Intergenic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
912662372 1:111543720-111543742 AAAGAGGAGGAGGAAGAGGAGGG + Intronic
913539440 1:119804872-119804894 GGTGAGGGGCAGAAAGGGGAGGG - Intronic
913956701 1:143305470-143305492 ATAGAGGAAGGGAACGGGGAAGG + Intergenic
913980744 1:143510195-143510217 ATAGAGGAAGGGAACGGGGAAGG - Intergenic
914075106 1:144336625-144336647 ATAGAGGAAGGGAACGGGGAAGG - Intergenic
914104072 1:144629871-144629893 ATAGAGGAAGGGAACGGGGAAGG + Intergenic
914121095 1:144783192-144783214 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
914331829 1:146679359-146679381 AGTGAGGATGGGAAAGGAGAGGG - Intergenic
914441816 1:147714364-147714386 CTTGAGTAGGTGAAAGGGGATGG - Intergenic
914691255 1:150030194-150030216 TTTGAGAAGGAGCAAGGTGATGG - Intergenic
914845830 1:151282977-151282999 AGAGGGGAGGAGAGAGGGGACGG - Intronic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
915608595 1:156971826-156971848 GGTGAGGAGGAGAAGGGGGAGGG + Intronic
915842652 1:159228042-159228064 ATAGAGGAAGAGAAAGAGGAGGG - Intergenic
915885436 1:159716558-159716580 ATTGAGGAGGGAACAGGAGATGG - Intergenic
916026663 1:160838951-160838973 TGTGTGGAGGAGAAAGAGGAAGG - Exonic
916086350 1:161272804-161272826 CCTGAGGAGGAGAAGGGTGATGG + Intronic
916101133 1:161394224-161394246 TCTGGGGAGGAGAAAGGGGCTGG - Intergenic
916468789 1:165101467-165101489 CTTAAGGAAGAGACAGGGGAGGG - Intergenic
916484498 1:165246455-165246477 ATTGATGAGGTGGGAGGGGAGGG - Intronic
916567180 1:165991093-165991115 AATGAGGAGGAGAATGAAGAAGG + Intergenic
916924869 1:169507555-169507577 ATTGAGGAGGAGGATGGGGAAGG + Intergenic
917133458 1:171765016-171765038 GCTGAGGAGGGGAAAGGGAATGG + Intergenic
917176070 1:172236923-172236945 ATAGAGGAAGAGGAAGAGGAAGG - Intronic
917448491 1:175126839-175126861 AAGAAGGAGGAGAAATGGGAGGG + Intronic
917903144 1:179563798-179563820 CTTGGGGAGGAAAATGGGGAGGG + Intronic
917930845 1:179821527-179821549 ACTGAGCAGGTGAGAGGGGAAGG + Intergenic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918243112 1:182637336-182637358 AGGTAGGAGGAGAAATGGGAGGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919632830 1:199975629-199975651 ATAGAGGAGGAGTTAGAGGAAGG + Intergenic
919878826 1:201889102-201889124 ATGGGGGCGGAGGAAGGGGAGGG + Intronic
919886548 1:201939097-201939119 AATGATGAAGAGAGAGGGGAAGG - Intronic
920062078 1:203233891-203233913 ATTGAGGGTGAGGAAAGGGAAGG - Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920390260 1:205595648-205595670 ATTGAGGCTCAGAGAGGGGAAGG - Intronic
920965130 1:210694977-210694999 ACTGAGAATGAGAAAGGGAAGGG + Intronic
920971557 1:210747436-210747458 AGTGAGGAAGGGAAAGGGAAGGG + Intronic
921118846 1:212119265-212119287 ATTTAGGATGAGAAGGGGGAAGG + Intergenic
921458167 1:215396582-215396604 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
921472586 1:215567284-215567306 AATGAGGAGGAGGAGGAGGAAGG - Intergenic
921495490 1:215835670-215835692 AAAGAGGAGGAGAGAGGGTAGGG - Intronic
921771936 1:219050611-219050633 AGGGAAGGGGAGAAAGGGGAGGG + Intergenic
922028112 1:221772044-221772066 ATTGAGGCTGATAAAGGGGCTGG - Intergenic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922070052 1:222183458-222183480 ATTGTGGGAGAGAGAGGGGATGG - Intergenic
922207945 1:223465382-223465404 AATGAGGAACAGAAAGGGCAAGG - Intergenic
922341139 1:224656093-224656115 ATTGATCAATAGAAAGGGGAGGG - Intronic
922724984 1:227918455-227918477 AGGGAGGAGGAGGAAGGGGGAGG - Intergenic
922960660 1:229643128-229643150 GTTGAGGAGGAGGAAGAGGAGGG + Intronic
922969942 1:229727766-229727788 ACGGAGGAGGGGAAAGGGGTTGG + Intergenic
923272326 1:232368920-232368942 AAAGAGGAGGAGCAAGAGGAAGG - Intergenic
923300566 1:232636710-232636732 ATTGAGGGAGAGAGATGGGAAGG + Intergenic
923342091 1:233016357-233016379 GGGGAGGAGGAGAAGGGGGAGGG - Intronic
923550360 1:234958614-234958636 ATTGAGGCCCAGAAAGGGGCAGG - Intergenic
923555871 1:234999995-235000017 ACTGAGGAGGAGGAAAGGGATGG - Intergenic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
924003928 1:239586038-239586060 ATGGAAGAGTAGAAAGTGGATGG - Intronic
924010742 1:239662945-239662967 AAGGAAGAGGAGAAAGGAGAAGG - Intronic
924063771 1:240203652-240203674 TTTTAGGAGGAGTATGGGGAGGG + Intronic
924325194 1:242888772-242888794 GATTAGGATGAGAAAGGGGAAGG - Intergenic
924508540 1:244709490-244709512 CCAGTGGAGGAGAAAGGGGAAGG - Intergenic
924649417 1:245911227-245911249 AAGGATGTGGAGAAAGGGGAAGG + Intronic
924668206 1:246095250-246095272 ACTGTCCAGGAGAAAGGGGAAGG + Intronic
1063662757 10:8045289-8045311 AGTGAGCAGGAGAAGGCGGAGGG + Intergenic
1063968776 10:11367159-11367181 AGTTGGGAGGAGAAGGGGGAGGG - Intergenic
1064111633 10:12544666-12544688 ATTACGGAGGAGAAAAGAGATGG + Intronic
1064985739 10:21208134-21208156 ATTGTGGAGGATAAAGGGCTAGG + Intergenic
1065182362 10:23139394-23139416 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1065244604 10:23744430-23744452 ATTGAGGAGGTGTCAGTGGAAGG + Intronic
1065250815 10:23811590-23811612 TGTGAGGATGAGAAAGGGGAAGG + Intronic
1065306862 10:24377373-24377395 ACTGAGGAGGAAGCAGGGGATGG - Intronic
1065363980 10:24917029-24917051 ACTGAGGATGGCAAAGGGGAAGG - Intronic
1065813579 10:29464493-29464515 TTTGAGGAGGAGAAAAAGGTAGG - Intronic
1065867070 10:29923593-29923615 ATTTAGGAAGAGAAAAGGGAAGG - Intergenic
1066081395 10:31934220-31934242 GGGGAGGAGGAGGAAGGGGATGG - Intergenic
1066237118 10:33496246-33496268 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1066357115 10:34695569-34695591 AATGAGGAAGAGGAAGAGGAGGG - Intronic
1066529028 10:36316119-36316141 ATTGAGGAGAATAAGGAGGAGGG - Intergenic
1066660039 10:37729301-37729323 ATTCTGCAGGAGAAGGGGGAGGG - Intergenic
1067205421 10:44208219-44208241 ACTGAGAAAGAGATAGGGGAAGG - Intergenic
1067384252 10:45804240-45804262 ACTGAGGCTGAGAAAGGGGTAGG - Intergenic
1067542900 10:47169044-47169066 GTTGAGGAGAAGGAAGGGGAAGG - Intergenic
1067891944 10:50144810-50144832 ACTGAGGCTGAGAAAGGGGTAGG - Intergenic
1068435735 10:56989022-56989044 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1068744403 10:60513932-60513954 GCTGAGGTGGAGGAAGGGGAAGG - Intronic
1068781905 10:60928636-60928658 AAAGGGGAGTAGAAAGGGGATGG + Intronic
1069202466 10:65638135-65638157 GTTGAGGAGAGAAAAGGGGATGG - Intergenic
1069217685 10:65842511-65842533 ATGGAGCAGGAGAAAGGAGGGGG + Intergenic
1069633398 10:69911191-69911213 ATTGAGAAGGGGCAAGGGGAAGG - Intronic
1070305950 10:75239343-75239365 AATGAGTAGCAAAAAGGGGAGGG - Intergenic
1070386053 10:75925590-75925612 ATTGTGGAGGAAGAAGGTGATGG + Intronic
1070712557 10:78693406-78693428 TTTGACGAGGAGAAAGGGAGGGG - Intergenic
1070831434 10:79420271-79420293 CTTGGGGAGGGGACAGGGGAAGG - Intronic
1072295218 10:94002663-94002685 ATTGAGGGGAAGAAAGGAGAAGG + Intronic
1072687192 10:97544932-97544954 GCTGAGGAGGAGGAAAGGGAGGG + Intronic
1072749786 10:97969437-97969459 AGAGAGGAGGAGAAAGAGAAAGG - Intronic
1072841569 10:98780079-98780101 AGGGAGGAAGAGAGAGGGGAAGG + Intronic
1072958987 10:99912684-99912706 AGAGAGGAAGAGAAAGAGGAGGG - Intronic
1073015443 10:100395460-100395482 GAAGGGGAGGAGAAAGGGGAAGG - Intergenic
1073030802 10:100524145-100524167 AGAGAGAAGGAGAAAGGGGGAGG + Intronic
1073209170 10:101784385-101784407 ATGAAAGAGGAGAAAAGGGAGGG + Intergenic
1073419041 10:103409000-103409022 AATGAGTACGAGAAAGGGGCTGG + Intronic
1073523702 10:104159507-104159529 ATTGAGTAGGTGAGATGGGATGG + Intronic
1073592168 10:104767724-104767746 AGCGAGGAGAGGAAAGGGGAGGG - Intronic
1073679702 10:105689332-105689354 ATAGAGGGAGAGAAAGAGGAAGG - Intergenic
1073892068 10:108113455-108113477 ATTGACAAAGAAAAAGGGGAAGG + Intergenic
1074108817 10:110408427-110408449 ACTGAGGAGGGGAAGGGGGAGGG - Intergenic
1074644979 10:115439193-115439215 ACTGAGGATGAGGAAGAGGAGGG + Intronic
1074691138 10:116005094-116005116 GAGGAGGAGGAGGAAGGGGAAGG - Intergenic
1074968112 10:118511299-118511321 CCTGAGGAGGAGGAAAGGGAGGG + Intergenic
1075091504 10:119446472-119446494 AACGAGGATGAGAAAGGCGAGGG - Intronic
1075683911 10:124350857-124350879 CTGGAGGAGGAGACATGGGAGGG - Intergenic
1076522138 10:131087910-131087932 ATGAAGGAGGAGCGAGGGGAGGG + Intergenic
1076829267 10:132985959-132985981 ATTGGGGAAGAGAAAGGGTAGGG + Intergenic
1076831868 10:132999426-132999448 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831894 10:132999514-132999536 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831920 10:132999602-132999624 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076889262 10:133275948-133275970 ATGGAGGAGGAGAATGGAAACGG - Intronic
1077150764 11:1072166-1072188 AAGGAGGAGGAGGAAGGGGAAGG - Intergenic
1077510223 11:2955976-2955998 ATGGAGGAGGAGAAGGGAGGGGG - Intronic
1077719750 11:4616079-4616101 AGGGAGGGGGAGAGAGGGGAAGG - Intergenic
1077806591 11:5596547-5596569 ATGGGGGAGGGGAAGGGGGAAGG - Intronic
1077851120 11:6075209-6075231 ATTGAAGAGTGGAAAGGAGAAGG + Intergenic
1077885626 11:6385524-6385546 ACTTAGTAGGAGAAAGGGAAAGG + Intergenic
1078096382 11:8299788-8299810 GTTGAGGAGGTCAAGGGGGAGGG + Intergenic
1078172685 11:8940730-8940752 ATTCAGGGGGAAAAAAGGGATGG + Intergenic
1078313474 11:10270491-10270513 GCTGAGGAGGAGGAAGAGGAAGG + Intronic
1078391432 11:10938614-10938636 GATGAGGAAGAGGAAGGGGAAGG - Intergenic
1078427558 11:11264274-11264296 ATAGAAGAGGATAAAAGGGAAGG + Intergenic
1078434402 11:11312515-11312537 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
1078811987 11:14777294-14777316 TTTGAGAAGGAGAAAGGGGGTGG + Intronic
1078843778 11:15103622-15103644 TTTGAGTAGTGGAAAGGGGAGGG - Intergenic
1078882581 11:15466644-15466666 ATATAGGAGGAGAAAGTGAAAGG + Intergenic
1078928479 11:15895039-15895061 ACTGAAGAGGAGAAAGGCCATGG - Intergenic
1079055921 11:17207060-17207082 ATTGAGGAGGGAAATGAGGAAGG - Intronic
1079189317 11:18264761-18264783 AGAGGGGAGGAGAGAGGGGAGGG + Intergenic
1079325995 11:19493167-19493189 TAGGAGGAGGAGAGAGGGGAGGG - Intronic
1079455059 11:20629241-20629263 GTTGAGAAGGACAAAGGGGCAGG - Intronic
1079613476 11:22462090-22462112 GATGATGAGGAGAAATGGGAAGG - Intergenic
1080237892 11:30092855-30092877 AGGGAGGAGGAGGGAGGGGAGGG - Intergenic
1080542496 11:33281410-33281432 ATAGAAGAGGAAAAAGTGGATGG - Intronic
1080616960 11:33952948-33952970 ATTGAGTAGGAGGAAGGAAAGGG - Intergenic
1080659506 11:34284669-34284691 AGAGAGGTGGAGAAAGCGGAGGG + Intronic
1080876131 11:36276006-36276028 ACAAAGGAGGATAAAGGGGATGG + Intronic
1081205201 11:40267030-40267052 ATTGAAGAGCAAAAAAGGGAAGG - Intronic
1081294675 11:41370892-41370914 ACTGAGGAAGAGAAAGGAGAAGG - Intronic
1081631027 11:44690075-44690097 AGGGAGGAGGAGGAAAGGGAGGG + Intergenic
1081915262 11:46726506-46726528 GTGGAGGAGGAGACAGGAGATGG + Exonic
1082002865 11:47403341-47403363 ACTGAGATGGCGAAAGGGGAAGG + Intergenic
1082740591 11:56906720-56906742 ACAGAGGAGGAAAAATGGGATGG - Intergenic
1082759408 11:57112627-57112649 GAAGAGGTGGAGAAAGGGGAAGG - Intergenic
1082762088 11:57136891-57136913 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083047407 11:59749265-59749287 AGTGATGAGCAGGAAGGGGACGG - Intronic
1083079874 11:60080177-60080199 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1083254155 11:61486175-61486197 TTTGGGGAGAAGACAGGGGAAGG - Intronic
1083421552 11:62556166-62556188 GGTGAGGAGCAGAAAGGGAAGGG - Intronic
1083476670 11:62919858-62919880 ACTGAGGCTGAGAAAGGGAAAGG - Intronic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1083674743 11:64319057-64319079 GTTTGGGAGGAGAAGGGGGAAGG - Intronic
1083939379 11:65887459-65887481 AAAAAGGAGGGGAAAGGGGAAGG + Intronic
1084571662 11:69963417-69963439 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
1084617251 11:70244791-70244813 ATGGAGGAGGAGGAGAGGGAAGG + Intergenic
1084994334 11:72960731-72960753 GTTGATGTGGAGAAAGGGTATGG + Intronic
1085018256 11:73189343-73189365 ACAGAGGAGGAGAAAAGGGCCGG + Intergenic
1085199659 11:74694117-74694139 CTGGAGGAGGAGATAGAGGAGGG - Intergenic
1085417043 11:76326065-76326087 ATTGAGTGGGGGAGAGGGGATGG + Intergenic
1085944970 11:81258405-81258427 ATTGAGGAGCAGAAAGGATTGGG + Intergenic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086148416 11:83580909-83580931 AATGAGGGAGGGAAAGGGGAGGG - Intronic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1087023998 11:93631968-93631990 TGTGGTGAGGAGAAAGGGGAGGG - Intergenic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1087195642 11:95301792-95301814 AATGAGGAGCAGGGAGGGGAGGG + Intergenic
1087345195 11:96963208-96963230 ATAGGGGAGAAGAAATGGGATGG + Intergenic
1087346185 11:96973769-96973791 ATTGGGAAGAGGAAAGGGGAAGG + Intergenic
1087569634 11:99909038-99909060 ATTCAGCTGGAGAAAGAGGAAGG - Intronic
1087790392 11:102400263-102400285 ATTGAAGAGGGGCAGGGGGAGGG + Intronic
1088180606 11:107104657-107104679 CTGGAGCAGGAGAAAGGGGGAGG + Intergenic
1088415907 11:109588955-109588977 ATAGAGGGAGAGAAAGGGGCAGG + Intergenic
1088417380 11:109604811-109604833 ACTGAGGAAGAGAAATGAGAAGG - Intergenic
1088452449 11:109996956-109996978 ATTAATCAGGACAAAGGGGAAGG + Intergenic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1088978212 11:114834583-114834605 TTTGAGGAAAAAAAAGGGGAAGG + Intergenic
1088998082 11:115021147-115021169 AGGGAGGGGAAGAAAGGGGAAGG - Intergenic
1089019211 11:115194796-115194818 ATTGGGGAGGAGGGTGGGGAAGG + Intronic
1089247493 11:117132930-117132952 ACTGAGGAGGAGGAAAGGAAAGG - Intergenic
1089257299 11:117200620-117200642 ACCCAGGAGGAGGAAGGGGAAGG + Intronic
1089746996 11:120624440-120624462 AAGGAGGAGGCCAAAGGGGATGG - Intronic
1089778424 11:120855929-120855951 AAAGAGGAAGAGAAAGAGGAAGG + Intronic
1089815600 11:121171567-121171589 ATTGAAGAGGACAAATGGAAAGG - Intronic
1089930782 11:122309200-122309222 GTTGAGGAAGAGAAAGGAAATGG + Intergenic
1089976625 11:122737803-122737825 GTTGAGCAGGAGAAACTGGAGGG + Intronic
1089983735 11:122793845-122793867 ATTGAGGGGGAGATAGGGTTTGG + Intronic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090284187 11:125484926-125484948 TGTGAGGAAGAGAAAGGGAAGGG + Intronic
1090339086 11:125999658-125999680 AATGAGAAGGAGAAAGATGATGG - Intronic
1090363455 11:126188553-126188575 TTTCAGGAGGAGAGAAGGGAGGG - Intergenic
1090964114 11:131583294-131583316 ATTGGGGAGGTGGATGGGGAAGG - Intronic
1090990920 11:131816026-131816048 ATAAAGGAGGAGAAAAGAGAAGG - Intronic
1091110714 11:132963665-132963687 ATAGAGGAAGAGAAAAGTGAGGG + Intronic
1091470287 12:720567-720589 ATGGTGGAGGGCAAAGGGGAAGG + Intergenic
1091603092 12:1929806-1929828 GAGGAGGAGGAGGAAGGGGAAGG + Intergenic
1091636285 12:2199334-2199356 ACTGAGGAGGAGGAAGGGGAGGG - Intronic
1091775580 12:3182708-3182730 AGTGAGGGGGAGAAAGTGGGAGG + Intronic
1091813793 12:3421091-3421113 ATGGAGGAGGAGGAGTGGGAGGG - Intronic
1092112016 12:5970676-5970698 ACTGGGGAGGAGAAAGGCAATGG + Intronic
1092139259 12:6171613-6171635 GTTGAGGAGGAGGAGGAGGAAGG + Intergenic
1092266648 12:6986231-6986253 AAGGAGGAGGAGAAAGAGAAAGG - Intronic
1092278769 12:7083132-7083154 GTTGAGGGGGAGAATGGAGAGGG + Intronic
1093084575 12:14852460-14852482 AAGGAGGAGGAGGAGGGGGAGGG - Intronic
1093241794 12:16685973-16685995 ATTGAGGAAGGGAAGGAGGAGGG - Intergenic
1093648856 12:21620174-21620196 ATTGAGGATGAGAGAGGAGTGGG - Intergenic
1093798412 12:23341514-23341536 ACTAAAGGGGAGAAAGGGGAGGG + Intergenic
1093905847 12:24691116-24691138 ACTTGGGGGGAGAAAGGGGAGGG + Intergenic
1094234393 12:28146899-28146921 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1094260359 12:28490150-28490172 AATTAGGATGAGAAAGGGGCAGG - Intronic
1094789908 12:33900543-33900565 ATATAGGAGGAGAAAGGAGAAGG - Intergenic
1094791827 12:33924224-33924246 CTTGATGAGGAGTAATGGGAGGG - Intergenic
1095290377 12:40472817-40472839 AGGGAGGAGGAGGAAGAGGAGGG - Intronic
1095296137 12:40529824-40529846 GAGGAGGAGGAGAAAGGAGAAGG - Intronic
1095466899 12:42497194-42497216 AAGGAGGAGGAGAAAGATGAGGG + Intronic
1095837490 12:46654484-46654506 ATAAAGCAGGAGAAAAGGGAAGG - Intergenic
1095940814 12:47725558-47725580 TTTCAGGAAGAAAAAGGGGAGGG + Intronic
1096553398 12:52388951-52388973 CTGGTGGAGGTGAAAGGGGAAGG + Intergenic
1096562511 12:52447041-52447063 ATTGATGAGAAGAAAAGTGAGGG + Exonic
1096575325 12:52549172-52549194 ATTCAGGAAGAGCAAGGTGAAGG - Intronic
1096592279 12:52668260-52668282 ATTGAGGATGAGAGAAGTGAGGG - Intergenic
1096648978 12:53052780-53052802 AATGAGGAGGAGGAAGGGTGGGG + Intronic
1096682164 12:53263188-53263210 AATGAGGAGGAGGAAGAGGAAGG + Intergenic
1096777756 12:53974323-53974345 GTGGAGGGGGAGAAAGGGGAGGG + Intronic
1096836389 12:54353818-54353840 GTGGAGGAGGTGAATGGGGAAGG + Intergenic
1097088750 12:56488465-56488487 ATTGAGGCGGGGAAAGGGTAAGG + Intergenic
1097158308 12:57028431-57028453 CTTGAGGAGGAAAAAGGGCATGG + Intronic
1097548070 12:61029857-61029879 AAAGAGGAGGAGGAAGAGGAAGG - Intergenic
1097611381 12:61825474-61825496 TTTGAGGAGGAGAAAGGTAAGGG + Intronic
1097929752 12:65170245-65170267 GTGGAGGACGAGGAAGGGGAGGG + Exonic
1097973119 12:65656559-65656581 AGGGAGGAGGAGAAAAGGAAGGG - Intergenic
1098009384 12:66034160-66034182 AGGGAAGAGGAGGAAGGGGATGG + Intergenic
1098084094 12:66822828-66822850 ACGGGGGAGGAGAAAGGGAAAGG + Intergenic
1098558956 12:71851173-71851195 ATAGAGCAGGAGGAAGGGGGAGG + Intronic
1098685683 12:73417053-73417075 GTTGAGGATGAGAAGGTGGAGGG + Intergenic
1098715104 12:73820723-73820745 ATTTAGGAGGGGCCAGGGGATGG - Intergenic
1098850850 12:75594265-75594287 GGTGAGGAGGAGAAAGGCAATGG - Intergenic
1099812000 12:87595086-87595108 ATTGAAGAGGGGAAGAGGGACGG - Intergenic
1099959182 12:89380414-89380436 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1100003139 12:89861366-89861388 GAAGAGGAGGAGAAAGAGGAGGG + Intergenic
1100193554 12:92218867-92218889 CTTGAGGATGAGCAAGGAGAAGG + Intergenic
1100273960 12:93054028-93054050 ATTGAAGAAGAGAAAGGGAAAGG - Intergenic
1100710343 12:97249422-97249444 ATTGTGCAAGAGAAAGGGGGTGG - Intergenic
1100731674 12:97477726-97477748 AATGAGGAAGAGAAAGGATAAGG + Intergenic
1100760230 12:97798963-97798985 AATTAGGAGGAGAAACAGGAAGG + Intergenic
1100766744 12:97874600-97874622 GCTGAGGAGGAGAAAGAGGAAGG - Intergenic
1101467899 12:104966566-104966588 AGTGGGGAGGGGCAAGGGGAAGG + Intergenic
1101471877 12:105005046-105005068 GTTGAGGAGGAGGAAGCAGAGGG + Intronic
1101723495 12:107371004-107371026 AGGGAGGAGGAGAAGGGGGGTGG - Intronic
1101799530 12:108008739-108008761 TCTGGGGAGGAGAGAGGGGAGGG - Intergenic
1101830562 12:108253340-108253362 AATGAAGGAGAGAAAGGGGAAGG - Intergenic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1102133084 12:110548864-110548886 TTTGAGGAGGCAAAAGAGGAGGG - Intronic
1102162292 12:110779278-110779300 CTAGAGGAGGGGAAAAGGGAGGG + Intergenic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102437615 12:112937702-112937724 ATTTTGGAGGAGAAGGAGGAAGG - Intergenic
1102655632 12:114480356-114480378 GAGGAGGAGGAGGAAGGGGAGGG + Intergenic
1102658822 12:114506917-114506939 ACTGAGCAGGGGAAAGGAGAGGG + Intergenic
1102939079 12:116922823-116922845 CTTGACTAGGAAAAAGGGGATGG + Intronic
1103231141 12:119331444-119331466 GTTGTGAAGGATAAAGGGGAAGG - Intergenic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103661828 12:122526489-122526511 TTTGCGGTGGAGAAAGGGGCTGG - Intronic
1103743610 12:123107566-123107588 CTTGTGGAGGAGAGAGGAGAAGG + Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1104001695 12:124864177-124864199 AAGGGGTAGGAGAAAGGGGAAGG - Intronic
1104419102 12:128620454-128620476 ATCAAGGAGGAGTAAGGGGATGG + Intronic
1105008634 12:132739116-132739138 AGTGAGGAGGAGGGAGAGGATGG + Intronic
1105272999 13:18895138-18895160 GTTGAGTAGGCGAAAGGTGATGG - Intergenic
1105901063 13:24753547-24753569 GTTGAGGAAGAGAGAGGAGATGG + Intergenic
1106037485 13:26057305-26057327 AGTGGAGAGGAGAAAGGGGAGGG - Intergenic
1106161896 13:27208661-27208683 AAAGAGGAGGAGAAAGAGAAAGG + Intergenic
1106220020 13:27738685-27738707 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1106243029 13:27925271-27925293 GAGGAGGAGGAGGAAGGGGAGGG - Exonic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106243111 13:27925574-27925596 AAAGAGGAGGAGGAAGAGGAGGG - Exonic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106359999 13:29022284-29022306 AGTGAGGAGGAGCATGAGGATGG + Intronic
1106386186 13:29288421-29288443 TTTGAGGAATGGAAAGGGGAAGG + Intronic
1106408753 13:29496550-29496572 GTGGAGGAGGAGATAGGGGAAGG + Intronic
1106778115 13:33027904-33027926 ATTGTGAAGGATAAAGGGGAAGG + Intronic
1106899248 13:34337646-34337668 AAAGAGCAGGAGAAAGAGGAGGG + Intergenic
1106899257 13:34337735-34337757 AAAGAGGAAGAGAAAGGGAAGGG + Intergenic
1107148555 13:37086200-37086222 GGTGAGAAGGAGAAAGAGGAGGG + Intergenic
1107250693 13:38357846-38357868 ACTGAGGAGAAGGAAGAGGAAGG + Intronic
1107502415 13:40993816-40993838 ATTGAGGGGGAGTAAGCAGAGGG + Intronic
1107590108 13:41894931-41894953 CATGAGGAGGAAAAAGGAGATGG + Intronic
1107829572 13:44362422-44362444 GTTCAGGAGGAGGAAGAGGAAGG - Intergenic
1107996050 13:45862177-45862199 AAAGAGGGAGAGAAAGGGGAAGG + Intergenic
1108068715 13:46605543-46605565 AATGAGGTGGAGGAAGGGGTAGG - Intronic
1108207107 13:48101458-48101480 ATTGAGAAAGAGGAAGGGAAAGG - Intergenic
1108238269 13:48432076-48432098 ATTTAGGAGGAAAAAGGGGGTGG + Intronic
1108419890 13:50237939-50237961 AATGAGATGTAGAAAGGGGATGG + Intronic
1108546215 13:51497334-51497356 AGTGAGGAGGAGCAAGGAGAGGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1108961065 13:56230302-56230324 GTTGAGGAGGACAAAGAAGAGGG + Intergenic
1109014395 13:56991232-56991254 ATAGAGAAGGAGAAAGGAGGTGG + Intergenic
1109181577 13:59220072-59220094 AGGGAGGAGGAAAAGGGGGAAGG + Intergenic
1109488886 13:63068560-63068582 ATGGAGGAAGGCAAAGGGGAAGG - Intergenic
1110268086 13:73561838-73561860 ATTTATGAGGACAAAGGAGATGG - Intergenic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1110384426 13:74892209-74892231 ATTGAGGAAGAGAAAGTAAATGG - Intergenic
1110519222 13:76455797-76455819 AAAGAGGAGGAGGATGGGGAGGG + Intergenic
1110583774 13:77163347-77163369 ATTAAGTGGGAGAAAAGGGATGG + Intronic
1110945560 13:81411345-81411367 AATGGGGAGGAGGAAGAGGAAGG - Intergenic
1111265686 13:85809242-85809264 ATTGTGGAGTAGAAAGGAGATGG - Intergenic
1111347515 13:86978617-86978639 TTTGAGGAGGAGGAAGGTCAAGG - Intergenic
1111876379 13:93902215-93902237 GCTGAGGAGGGGAGAGGGGAAGG - Intronic
1111994467 13:95150763-95150785 AGTGTGTTGGAGAAAGGGGAGGG - Intronic
1112487792 13:99835439-99835461 ATGGAGGAAGAGAGAGTGGAGGG + Intronic
1112674149 13:101678863-101678885 TTTGGGGAGGAGAAAGGAGTAGG - Intronic
1112692528 13:101913803-101913825 ATTATGGAGGAGAGAGGGGTGGG - Intronic
1113179782 13:107612078-107612100 AGTGGGGGGGAGAGAGGGGAGGG + Intronic
1113243141 13:108362390-108362412 ACTGAGGCAGAGAAAGGTGAAGG - Intergenic
1113257968 13:108528577-108528599 GGAGAGGAGGGGAAAGGGGAGGG - Intergenic
1113291995 13:108917325-108917347 ATTTAACAGGAGGAAGGGGAAGG + Intronic
1113524513 13:110964335-110964357 ACGAAGGAGGAGAAAGGGGGTGG - Intergenic
1113539400 13:111094882-111094904 ATTGAGGAGGGGACAGCGCACGG - Intergenic
1113556462 13:111239560-111239582 ATTGAGGTGGAGAAAAGCCAAGG - Intronic
1113614488 13:111671025-111671047 AGGGAGGAGGGGACAGGGGACGG - Intronic
1113619956 13:111755939-111755961 AGGGAGGAGGGGACAGGGGACGG - Intergenic
1113811886 13:113147674-113147696 AGTGGGGAGGAGGACGGGGAGGG + Intronic
1114127288 14:19743704-19743726 ACAGAGGAGCAGGAAGGGGAGGG - Intronic
1114258536 14:21021974-21021996 ACTGGGGAGGAGGAAAGGGAGGG - Intronic
1114364242 14:22010019-22010041 GATGAGGAGGAGAAGGAGGAAGG + Intergenic
1114546731 14:23508493-23508515 ATAGAGGAGGGTAAAGGGGTTGG + Intronic
1114633944 14:24177112-24177134 AGAGAGGAAGAGCAAGGGGAGGG - Intronic
1114832630 14:26163772-26163794 AAAGAGGAGGGGAAAGGGAAAGG - Intergenic
1114875355 14:26710529-26710551 ATTGAGGAAGGGAAAGGAGGAGG + Intergenic
1115094539 14:29618970-29618992 AATGAGGAGGAGGAAGGGGGAGG + Intronic
1115195009 14:30788147-30788169 ATGGATGGGGAGAAAAGGGAAGG + Intergenic
1115423237 14:33222280-33222302 CTTCAGGAGGAAATAGGGGAAGG + Intronic
1115506136 14:34095951-34095973 AGAGAGGATGAGAGAGGGGAAGG - Intronic
1115659130 14:35474595-35474617 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116798129 14:49413584-49413606 CCTGAGGAGGTGAAAGGGGCAGG - Intergenic
1116806857 14:49502038-49502060 AGTTAGGAATAGAAAGGGGAAGG + Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117099680 14:52333581-52333603 ATAGAGGAGGGCAAAGGGAATGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117252703 14:53952577-53952599 ATTGAGGGGGTGAAAAGGGGTGG + Intronic
1117334126 14:54742321-54742343 ATAGAGGAGGAGAAATAGAATGG + Intronic
1117401133 14:55359088-55359110 AGTGAGCAGGATGAAGGGGAGGG + Intronic
1117581048 14:57152086-57152108 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
1118033370 14:61839877-61839899 ATTGTGGAGGGGAAAGGGGGAGG + Intergenic
1118171860 14:63395952-63395974 GAAGAGGAGGAGAAGGGGGAGGG + Intronic
1118388175 14:65274076-65274098 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1118503112 14:66381905-66381927 ATGGAGGAGATGAAAGGGTATGG + Intergenic
1118712568 14:68534449-68534471 ATAAAGGAGGAGAAAGGGTTTGG + Intronic
1118736601 14:68705624-68705646 ATTGATGGGGAGAATGGGGAAGG - Intronic
1118767750 14:68921559-68921581 AAAGAGGAGGAGGAAGAGGAAGG + Intronic
1118860073 14:69656109-69656131 ATGGAGGAAGAGGAAGAGGAAGG - Intronic
1118866723 14:69710213-69710235 ATGGAAGAGGAGGAAGAGGAGGG - Intronic
1119022949 14:71130355-71130377 AATGAAGAGGTGAGAGGGGAGGG + Intergenic
1119067417 14:71542685-71542707 AGGGAGGAGGAGAAGGGAGAAGG - Intronic
1119168518 14:72515260-72515282 CTGGAGGAAGAGGAAGGGGAGGG - Intronic
1119483955 14:74976297-74976319 AGAGAGGAGGAGCAAGGGGAAGG - Intergenic
1119532746 14:75374302-75374324 AGTGGGGAGGAGGAAGGGGGAGG + Intergenic
1119631668 14:76237482-76237504 AGGCAGGAGCAGAAAGGGGAAGG - Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120217898 14:81700157-81700179 ATGGCGGAAGACAAAGGGGAAGG - Intergenic
1120306762 14:82780818-82780840 AAGGAGGAGGAGAAGGGAGAAGG - Intergenic
1120333643 14:83125704-83125726 AAAGAAGAGGAGGAAGGGGAGGG - Intergenic
1120736651 14:88060552-88060574 TTTAAGAAGGAAAAAGGGGAGGG - Intergenic
1120895416 14:89527053-89527075 GGAGAGGAGGAGGAAGGGGAAGG + Intronic
1120969681 14:90197021-90197043 AATTAGGAGGAGAAAGAGGGTGG - Intergenic
1121051686 14:90823035-90823057 ATTCAGAACGAGAGAGGGGAAGG + Intergenic
1121069043 14:90999498-90999520 AATGGGGAGGAGGAGGGGGAGGG + Intronic
1121085860 14:91145626-91145648 TGTGAGGAGGAGGAGGGGGATGG - Intronic
1121119700 14:91368954-91368976 AGGAAGGAGGAGAAAGGAGATGG - Intronic
1121144207 14:91569434-91569456 AAGGAGGAGGAAAAAGAGGAAGG - Intergenic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121518024 14:94566640-94566662 CTTGAGAAGGAGAGAGGAGATGG - Intronic
1121669601 14:95698078-95698100 TTTCAGGAAGAGAAAGGAGAAGG - Intergenic
1121689800 14:95869322-95869344 GGTGTGGAGGTGAAAGGGGAAGG + Intergenic
1121919087 14:97863930-97863952 ACTGAGGAGGAGAATCAGGATGG + Intergenic
1122448250 14:101783205-101783227 AGAGAGGGGGAGAAAGGGGGGGG - Intronic
1122462353 14:101905959-101905981 AGTGGGGAGGAGACAGGTGATGG - Intronic
1122532690 14:102439859-102439881 ATGGAGGAGGAGAGAGGAAAGGG - Intronic
1123570744 15:21605343-21605365 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123606857 15:22040696-22040718 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1124363814 15:29057343-29057365 AATGAGTAGAAGAGAGGGGAGGG - Intronic
1124701147 15:31913355-31913377 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1125353167 15:38788998-38789020 GAGGTGGAGGAGAAAGGGGAGGG - Intergenic
1125697496 15:41651654-41651676 AATGGGGAGGAGAAGGGGGAAGG - Intronic
1125782532 15:42282684-42282706 ATTAAGGAGCAGATTGGGGAAGG - Intronic
1125800140 15:42438498-42438520 ATAGAATAGGAGAATGGGGAGGG - Intronic
1125934185 15:43620351-43620373 TTTGAGGGAGAGAATGGGGAAGG - Intergenic
1125947289 15:43719817-43719839 TTTGAGGGAGAGAATGGGGAAGG - Intergenic
1126240226 15:46433410-46433432 ATTTAGGAGGAAAAATTGGAAGG + Intergenic
1126333955 15:47565728-47565750 ATAGAGTTGGAGAAAAGGGAAGG - Intronic
1126488639 15:49211676-49211698 ATGGTGGAAGACAAAGGGGAAGG + Intronic
1126570195 15:50142453-50142475 TTTGGGGAGGAGGAAGTGGATGG - Intronic
1126662196 15:51044158-51044180 ATAGAGGCAGAGAAAGGAGAGGG + Intergenic
1126678715 15:51183993-51184015 AGTGTGGAGGGGAAAGGGCATGG + Intergenic
1126915111 15:53457716-53457738 GCTGAGGAGGTGAAAGAGGAAGG + Intergenic
1127109897 15:55657384-55657406 ATTCAGATGGAGAAAGGTGAAGG + Intronic
1127260632 15:57324060-57324082 AGGGAGGAGGAGAAAGGAAAAGG + Intergenic
1127265452 15:57357210-57357232 GCTGAGGAGGAGAAAGAAGAGGG - Intergenic
1127555757 15:60085789-60085811 ATTGAGGAAGAGAAAACTGATGG - Intergenic
1127589457 15:60409337-60409359 GTTTTGGAAGAGAAAGGGGATGG - Intergenic
1127657694 15:61071434-61071456 AGAGGGGAGGAGAGAGGGGAGGG + Intronic
1127657708 15:61071478-61071500 AGAGGGGAGGAGAGAGGGGAAGG + Intronic
1127820701 15:62653203-62653225 ATTGAAGAAAAGAAAGAGGAAGG + Exonic
1127868859 15:63053618-63053640 ATTCAGGAGGTCAAAGGGGGAGG - Intronic
1128304164 15:66587049-66587071 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1128304189 15:66587127-66587149 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1129145885 15:73646811-73646833 ATGGAGGAGGGGGAGGGGGAGGG + Intergenic
1129182356 15:73885285-73885307 ACTGAAGTGGAGAAGGGGGATGG + Intronic
1129791117 15:78341186-78341208 TTTGAGGAGGAGACCGTGGACGG + Exonic
1130628940 15:85545823-85545845 ATATAGGAAAAGAAAGGGGAAGG - Intronic
1130662920 15:85844769-85844791 TTTCAGGAAGAGAAAGGGAAGGG + Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130959930 15:88652629-88652651 AGGGAGGAGGAGGAAAGGGAGGG - Intronic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131048146 15:89329116-89329138 GAGGAGGAGGAGAAAAGGGAAGG + Intronic
1131084737 15:89566770-89566792 TTTGAGGAGGCCATAGGGGAAGG - Intergenic
1131541738 15:93280406-93280428 ACGGAGGAGGCGAAGGGGGAGGG + Intergenic
1131620441 15:94062476-94062498 AGTGAGAAGTAGAAAGGGAAAGG + Intergenic
1131687089 15:94779761-94779783 AAAGAGGAGGAGAAAGGGAGAGG + Intergenic
1131901113 15:97088690-97088712 AAGGAGGAGGAGGAAGAGGAAGG - Intergenic
1131927131 15:97397314-97397336 ATTCAGGAGAAGAAAGTGCAAGG + Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1202979097 15_KI270727v1_random:332466-332488 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1132486228 16:192952-192974 CTTGAGGAGGAGAGAGGAGAGGG - Exonic
1132602304 16:778769-778791 AGAGAGGAGGAGACAGGGGCAGG + Intronic
1132759519 16:1501959-1501981 CTTGGGGAGGAGAGAGGGGCTGG + Intronic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133304454 16:4800801-4800823 AAAGAGGTGAAGAAAGGGGAAGG + Intronic
1133330171 16:4967990-4968012 ATAGAGAGGGAGAAAGGGAAGGG - Intronic
1133392823 16:5423000-5423022 AGGAAGGAGGAGAAAGGAGAGGG + Intergenic
1133392845 16:5423063-5423085 AAAGAGGAGGAGGAAGGAGAGGG + Intergenic
1133563520 16:6971395-6971417 TTTGGGGAGCAGAAAGGGAAGGG + Intronic
1133844982 16:9445125-9445147 ATTGAGGAACAGGTAGGGGAAGG + Intergenic
1134250727 16:12572070-12572092 ATCTAGGAAGAGGAAGGGGAGGG + Exonic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134449396 16:14354218-14354240 AGGGAGGAGGAGGAAGGGGGAGG + Intergenic
1134615891 16:15650687-15650709 AAGGAAGAGGAGAAAGAGGATGG - Intronic
1134657306 16:15956803-15956825 AAGGAGGAGGAGGAAGGGGAGGG + Intronic
1134718959 16:16370590-16370612 AGAGAGATGGAGAAAGGGGAGGG - Intergenic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1135147753 16:19977813-19977835 ACTGAGGAGGAGGAAGAGGAGGG - Intergenic
1135175225 16:20221853-20221875 ATAGAGGAGGAGAAGAGAGAGGG - Intergenic
1135192886 16:20369111-20369133 TTTGAGGAGGAGAAGGGAGATGG - Intronic
1135516287 16:23138422-23138444 AGTGATGATGAGAGAGGGGAAGG - Intronic
1135727537 16:24868790-24868812 AAGGAGGAGGAGAAGGGTGAAGG - Intronic
1135795382 16:25436408-25436430 AGTGATGAGGAGGAAGAGGATGG - Intergenic
1136051921 16:27657224-27657246 ATTGAGAAGGAAAAAGTGGGAGG + Intronic
1136452418 16:30360905-30360927 ATAGTGCAGGAGCAAGGGGAGGG - Intronic
1136511304 16:30739572-30739594 GGTGAGGAGGAGGAAGGGGATGG + Exonic
1136555650 16:31006355-31006377 AGGGAGGATGAGAAAGGGGCAGG - Intronic
1137521214 16:49196882-49196904 ACTGAGGAGCAGAGAGGGAAAGG - Intergenic
1137738685 16:50743091-50743113 ATTGAGGAGAAGAAGGTGGCAGG - Intronic
1137764931 16:50970788-50970810 ATTGAGGACTGGGAAGGGGAAGG + Intergenic
1137776419 16:51058421-51058443 ATCCAGGAGCAGAATGGGGAGGG + Intergenic
1138153941 16:54685787-54685809 AAGGAGGAGGAGAAAGGGAAGGG - Intergenic
1138418370 16:56884329-56884351 ATTGGGAGGGATAAAGGGGAGGG - Intronic
1138579411 16:57930558-57930580 AAGGAGGAGGGGAAGGGGGAGGG + Intronic
1139322159 16:66123614-66123636 GTTGAGAGGGAGGAAGGGGAGGG + Intergenic
1139597476 16:67966808-67966830 TAAGAGGAGGAGAAAGAGGAAGG + Intronic
1140001723 16:71031545-71031567 AGTGAGGATGGGAAAGGAGAGGG + Intronic
1140332719 16:74073324-74073346 ATGGAGGGGAAGAGAGGGGAAGG - Intergenic
1140383538 16:74512656-74512678 AATGGGGATGAGAAAGGTGAAGG + Intronic
1140655187 16:77132464-77132486 GGGGAGGAGGAGGAAGGGGAGGG - Intergenic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141053911 16:80798407-80798429 GAGGAGGAGGAGGAAGGGGAGGG - Intronic
1141053915 16:80798413-80798435 ACTGAGGAGGAGGAGGAGGAAGG - Intronic
1141381094 16:83577651-83577673 GCTGAGGAGGAGAAAGGGGTAGG + Intronic
1141599084 16:85114399-85114421 TTGGAGGAGGGGAAAGGGCAGGG - Intergenic
1141816503 16:86413721-86413743 ATTGAGCTTGAGAAAGGAGAAGG + Intergenic
1141891796 16:86930983-86931005 GAGGAGGGGGAGAAAGGGGAGGG - Intergenic
1141963419 16:87424782-87424804 ATTGAGATGGACAGAGGGGATGG + Intronic
1142164314 16:88577583-88577605 GATGATGAGGAGAAAGGCGAAGG + Exonic
1142207513 16:88791180-88791202 ATGGAGGGGAAGAGAGGGGAGGG + Intergenic
1142254339 16:89006739-89006761 ATAGAGGGGGAGGGAGGGGAGGG - Intergenic
1142254364 16:89006800-89006822 ATAGAGGGGGAGGGAGGGGAGGG - Intergenic
1142254389 16:89006859-89006881 ATGGAGGGGGAGGGAGGGGAGGG - Intergenic
1142489376 17:268206-268228 GATGAGGAGGAGGAAGAGGAGGG - Intronic
1142758591 17:2030030-2030052 ATAAAGGAGGAGATAGGGGCGGG - Intergenic
1142779479 17:2169843-2169865 ACTGAAGAGTAGAAGGGGGAAGG + Intronic
1143224206 17:5286850-5286872 ACAGAGCAGGAGAAAGGGAAGGG + Intronic
1143246331 17:5488605-5488627 AACGAGGAGGGGAAAAGGGAGGG + Intronic
1143472682 17:7185731-7185753 ATTGAGGAGGAGAGAGCTGGGGG - Intergenic
1143565242 17:7717029-7717051 AGAGAGGAGGCGAGAGGGGAGGG - Intergenic
1143660197 17:8319874-8319896 CTTTGGGAGGTGAAAGGGGACGG - Intronic
1143755089 17:9061191-9061213 CTGGTGGAGGAGGAAGGGGAGGG + Intronic
1143836326 17:9695772-9695794 ACTGAGGAAGAGGAAGGGGAGGG - Intronic
1143957980 17:10689159-10689181 ATTGGGGAGGGAAAAAGGGAGGG + Intronic
1144201324 17:12944806-12944828 GAAGAGGAGGAGAAAGGAGAAGG - Intronic
1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG + Intergenic
1144300508 17:13919329-13919351 AGTGAGAAGGGGAAGGGGGAAGG - Intergenic
1144409297 17:14985002-14985024 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1144580441 17:16456083-16456105 GAGGAGGAGGAGGAAGGGGAGGG + Intronic
1144766720 17:17737262-17737284 CTTGAGGAGGCAATAGGGGAGGG + Intronic
1144871787 17:18376538-18376560 CTTGAGGGGGAGCCAGGGGATGG - Intergenic
1145018162 17:19412160-19412182 ATTGAGGCCCAGAGAGGGGAAGG + Intronic
1145779192 17:27550825-27550847 CTTGAGAAGGAGGATGGGGAGGG + Intronic
1145967452 17:28930084-28930106 ATTGAGCTGGAGAAAGAAGAGGG - Intronic
1146176334 17:30668283-30668305 GGGGAGGAGGAGAGAGGGGATGG + Intergenic
1146221993 17:31032052-31032074 TTTGAAGAGGAAAAAGGGGTTGG - Intergenic
1146260152 17:31415657-31415679 ACTGAGGCCGAGAGAGGGGAAGG + Intronic
1146316425 17:31810765-31810787 ATTGAGGCTGAGAGAGGGTAAGG - Intergenic
1146349794 17:32084397-32084419 GGGGAGGAGGAGAGAGGGGATGG + Intergenic
1146494626 17:33310505-33310527 ATTGACGAGGACAAAGGTTAGGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146674153 17:34761340-34761362 GTTGAAGAGGAGAAAGGGAGAGG + Intergenic
1147013748 17:37473542-37473564 AGTGGGGCAGAGAAAGGGGAGGG - Intronic
1147168466 17:38605323-38605345 GGTGAGGAGAAGAAGGGGGATGG - Intronic
1147458519 17:40553705-40553727 AGGGAGGAGGGGAGAGGGGACGG + Intergenic
1147710917 17:42463991-42464013 GCTGAGGAGGAGGAAGGGGAGGG + Intronic
1147765267 17:42830792-42830814 ATTGAGAAAGTCAAAGGGGATGG + Intronic
1148062425 17:44846086-44846108 CTTGATGAGGAGAACGGAGATGG - Intergenic
1148179647 17:45595043-45595065 GAGGAAGAGGAGAAAGGGGAAGG + Intergenic
1148206710 17:45784190-45784212 AGGGAGGGGGAGGAAGGGGAGGG + Intergenic
1148269257 17:46250858-46250880 GAGGAAGAGGAGAAAGGGGAAGG - Intergenic
1148403964 17:47395031-47395053 ATGGATTAGGAGAAAGCGGAGGG - Intronic
1148559359 17:48597197-48597219 AGGGAGGAGGAATAAGGGGAAGG - Intronic
1148573060 17:48685968-48685990 GTGGAGGAGGAGGAAGAGGATGG + Intergenic
1148786279 17:50147735-50147757 CTTCAGGAGGGGAAAGGGGTTGG + Intronic
1148963699 17:51416406-51416428 ATTGAGATGGAAAAATGGGATGG + Intergenic
1149103051 17:52928834-52928856 AATTAGGAGGAGAAGGAGGATGG + Intergenic
1149341667 17:55693032-55693054 AGTGTGGAGGAGAACAGGGAAGG + Intergenic
1149553079 17:57554447-57554469 GCTGAGGAGGAGAGGGGGGATGG - Intronic
1149786393 17:59438980-59439002 ATTTGGGAGGAGAAAGGGTGTGG + Intergenic
1150146242 17:62772017-62772039 ATTGAGGAAGTGAAATGGAAAGG + Intronic
1150264578 17:63824070-63824092 ATTGAAGAGGTGAAAGGAGCTGG - Exonic
1150339792 17:64357237-64357259 ACCCAGGAGGAGAATGGGGATGG - Intronic
1150453897 17:65291892-65291914 ATTGGGGAGGGGAAAGGCTAGGG - Intergenic
1150833291 17:68542182-68542204 AGAGAGGAGGAGTAAGTGGAGGG + Intronic
1151121678 17:71799805-71799827 ATTAATGAGGAGGAAGCGGAAGG - Intergenic
1151167803 17:72219896-72219918 TTTGGGGAGGGGAGAGGGGAGGG - Intergenic
1151278051 17:73050796-73050818 ATGGGGGAGGTGAAAGGGAAGGG + Intronic
1151351383 17:73534080-73534102 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1151423682 17:74015797-74015819 CTGGAGGTGGAGAAAGTGGAAGG + Intergenic
1151749503 17:76028527-76028549 CTTGAGGGGGAGCCAGGGGATGG + Intergenic
1151815876 17:76471167-76471189 AGGTAGGAGGAGAAAGAGGAAGG + Exonic
1152008496 17:77696846-77696868 AAGGAGGAGGAGAAGGGAGAGGG - Intergenic
1152227386 17:79098742-79098764 ACTGAGGAGGGGTAAGGGGCTGG - Intronic
1152370161 17:79882677-79882699 ATTGAGGAGGAGGAGGAGGAGGG - Intergenic
1152462436 17:80448650-80448672 AGGGAGGAGGAGAAGAGGGAAGG - Intergenic
1152594304 17:81230757-81230779 ATTGATGAGGAGGAAGAAGAGGG - Intronic
1152774416 17:82191570-82191592 GTTGAGGAGGAGGCAGAGGATGG - Intronic
1152864844 17:82716545-82716567 ATTGAGGGGCGGGAAGGGGAGGG - Intergenic
1152948453 17:83211586-83211608 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1152948468 17:83211635-83211657 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1153230300 18:2928702-2928724 AGTGAGCAAGAGAGAGGGGAGGG + Intronic
1153950494 18:10054126-10054148 ATGGAGGAGCAGGTAGGGGAGGG + Intergenic
1153985649 18:10348633-10348655 AGTGAGGAGTGGGAAGGGGAGGG + Intergenic
1153991135 18:10401740-10401762 AGCGGGGAGGAGAAAGGGGAAGG + Intergenic
1154050392 18:10950709-10950731 AGGGAAGAGGAGGAAGGGGAAGG - Intronic
1154082019 18:11266984-11267006 ATGAAGGAGGAGAGAGGTGAAGG + Intergenic
1154373158 18:13784762-13784784 GCTGAGGAGGAGGAAGTGGAGGG - Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155279844 18:24228301-24228323 ATAGAGGAGGAGTAAGGAGGGGG - Intronic
1155294356 18:24371674-24371696 AGTGAAGAGTAGAATGGGGAGGG - Intronic
1155385834 18:25276208-25276230 GTGGAGGGGGAGGAAGGGGAAGG - Intronic
1155515161 18:26617080-26617102 AGTAAGGAAGAGAAAGGGGTGGG + Intronic
1155626049 18:27835672-27835694 AGGGAGTAGGAGATAGGGGATGG - Intergenic
1156149607 18:34225349-34225371 AGAGAGGGGGAGAAAGGAGATGG - Intergenic
1156398196 18:36717945-36717967 GATGATGAGGAGAAGGGGGATGG + Exonic
1156723924 18:40104570-40104592 AATAAGGAGGAGAAGGGGAAGGG + Intergenic
1157030489 18:43900966-43900988 AAGGAAGAGGAGGAAGGGGAGGG - Intergenic
1157129524 18:44992443-44992465 ATAGTTGAGGAGCAAGGGGAAGG + Intronic
1157279744 18:46338528-46338550 GTTGAGGTGGGGAAGGGGGAAGG + Intronic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG + Intergenic
1157445520 18:47743760-47743782 GCTGAGGAGGAGGAAGAGGAAGG - Intergenic
1158221082 18:55151405-55151427 ATTAAGGGGGAAAAGGGGGAAGG + Intergenic
1158334567 18:56401934-56401956 ATTTAGGAGGAGGAAGAGAAGGG + Intergenic
1158381730 18:56938052-56938074 ACTGAGGGGGAGGAAGTGGAGGG + Intronic
1158490964 18:57909457-57909479 TGTGAGAAAGAGAAAGGGGAAGG - Intergenic
1158610434 18:58935299-58935321 AGGGAGGAGGAGTAAGGGGGAGG - Intronic
1158669262 18:59460234-59460256 ATCCAGGAGGAGAGAAGGGAGGG - Intronic
1158831098 18:61279712-61279734 TTTTAGGAGGAGAAATGGAAAGG - Intergenic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159127685 18:64244273-64244295 TTTGAGGAAGAGAAAGGGATTGG + Intergenic
1159181799 18:64916858-64916880 GTTGTTGAGGGGAAAGGGGAAGG + Intergenic
1159306466 18:66649812-66649834 ATTAAATAGGAGAAAGGTGATGG + Intergenic
1159517671 18:69478395-69478417 AAGGAGGAGAAGGAAGGGGAGGG - Intronic
1159563121 18:70016977-70016999 AGTGAGGAGGAGGAAAGAGAAGG + Intronic
1159633572 18:70778861-70778883 TCTGGGGAGGAGAAAGGGGTTGG - Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1159834625 18:73324116-73324138 ACTGAGAAGGAGGAAGAGGAAGG - Intergenic
1160017829 18:75157901-75157923 ATTGGGTATGAGAAGGGGGAGGG - Intergenic
1160283772 18:77519073-77519095 ATAGGAGAGGAGAATGGGGAGGG - Intergenic
1160527102 18:79544483-79544505 GGTGAGGAGCAGAGAGGGGAAGG - Intergenic
1160553009 18:79707101-79707123 AGTGAGGAGGAGCATGTGGAAGG + Intronic
1160701824 19:511237-511259 AGGGAGGAGGAGGAAGAGGAAGG - Intronic
1160819711 19:1052344-1052366 CTTGAGGAGGAGGAGGGGGAGGG + Intronic
1160975343 19:1790095-1790117 AGTGGGGAGGAGAAGGGGCAGGG - Intronic
1161033756 19:2072624-2072646 ATTGAGGAAGAGAGAGGGCTGGG + Exonic
1161370539 19:3908653-3908675 AAGGAGGAGAAGAAAGGGGAAGG - Intronic
1161398700 19:4058421-4058443 AGGGAGGGGGAGAAAGGGGTGGG - Intronic
1161403794 19:4080919-4080941 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1161410110 19:4112386-4112408 CATGAGGAGGAGATGGGGGAGGG + Intronic
1161480947 19:4510439-4510461 AATGCGGAGGAGCAAGGTGAGGG - Exonic
1161853508 19:6751113-6751135 ATGGAAGAAGACAAAGGGGACGG + Exonic
1161908409 19:7174751-7174773 AGAGAGAAAGAGAAAGGGGAGGG + Intronic
1161958514 19:7509465-7509487 TCTGAGGATGAGAATGGGGAAGG + Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162068231 19:8138358-8138380 GGTGAGGAGGGGACAGGGGAGGG - Intronic
1162104564 19:8362545-8362567 AATGAGGGAGAGAAAGAGGAAGG + Intronic
1162339213 19:10081761-10081783 AAGGAGGAGGAGGAAGGAGAAGG + Intergenic
1162340337 19:10087779-10087801 ATTGGGGAGGAGAGAGAGGCAGG + Intronic
1162836801 19:13325054-13325076 GAAGAGGAGGAGGAAGGGGAAGG - Intronic
1163163912 19:15482321-15482343 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
1163171187 19:15532344-15532366 GTGGAGGAGGAGGAGGGGGATGG - Intronic
1163295203 19:16407279-16407301 AGTGGGGAGAAGAAAGGGAAGGG - Intronic
1163501832 19:17680659-17680681 GAAGAGGAGGAGAAAGGAGAGGG - Intronic
1163518423 19:17778638-17778660 GACGAGGAGGAGAAAGGGGAGGG - Exonic
1163632566 19:18424862-18424884 AGGGAGGGGGAGAATGGGGAAGG + Intronic
1163827810 19:19533431-19533453 AGGAAGGAGGAGAAAGGCGAGGG - Intronic
1164211935 19:23106183-23106205 AAGGAGGAGGAGAAAAGGAAGGG + Intronic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1164951485 19:32340709-32340731 GAAGAGGAGGAGAAAGGGCAGGG - Intergenic
1165100546 19:33436151-33436173 ATGGAGGAAGAGGAAGGAGAGGG + Intronic
1165580660 19:36860412-36860434 ATAGATGAGGAGAAAGGGTAGGG - Intronic
1165742132 19:38210812-38210834 AGAAAGGAGGAGAAGGGGGATGG - Intergenic
1166250360 19:41565270-41565292 AGTGGGGAGGAGAAGGGGGTGGG + Intronic
1166343085 19:42150342-42150364 ATGGATGAGGAGGAAGAGGAGGG + Intronic
1166960290 19:46492917-46492939 AAAGAGGAGGAGGAGGGGGAGGG - Exonic
1166978787 19:46620815-46620837 TTTGTGGAGCAGAAAGGGGCTGG + Exonic
1166992453 19:46700814-46700836 AGTGAGGAGGAGGAAGGCGAGGG - Exonic
1167197643 19:48041710-48041732 ATGGAGGAGGAGAGAGAGAATGG - Intronic
1167298046 19:48663363-48663385 ATTTAAGATGAGAAAGTGGAAGG + Intronic
1167383301 19:49150591-49150613 ACTGGGCAGGAAAAAGGGGAGGG - Exonic
1167384379 19:49155482-49155504 ATTTAGCTGGAGAGAGGGGAGGG - Intergenic
1167482274 19:49740249-49740271 ATTGCGGAGGGCAAAGGGTAGGG + Intronic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1167520442 19:49951570-49951592 GTTGAGGAGGAGAGATAGGAGGG + Intronic
1167695163 19:51010814-51010836 TGTGAGCAGGAGAAAGTGGAAGG - Intergenic
1167775643 19:51553004-51553026 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1167821720 19:51934396-51934418 ATGGAGGAGAGGAAAGGGGGTGG - Intronic
1168069344 19:53941272-53941294 ATTTAGGGGGATAAAGGGGGAGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
1168562169 19:57393664-57393686 ATAGAGGAGAGGAGAGGGGAGGG + Intronic
1168657670 19:58142826-58142848 AGGGAGAAGGAGAAAGGGGTTGG - Intronic
1168694327 19:58396210-58396232 GAGGAGGAGGAGGAAGGGGACGG + Exonic
924968581 2:101345-101367 ATGGAGGAGGAGGAAAGGGAGGG - Intergenic
925150576 2:1612110-1612132 TTAGAGGAGGAGAAGTGGGAAGG - Intergenic
925299438 2:2800161-2800183 ATGGAGGAAGGGAAAGAGGAAGG + Intergenic
925685233 2:6464504-6464526 ATTGAAGAGCTGAAAGGAGATGG + Intergenic
925755531 2:7128342-7128364 AAAGGGGAGGGGAAAGGGGAGGG - Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
925919428 2:8628763-8628785 CTTGTGGAAGAGAAAGCGGAGGG + Intergenic
925927599 2:8681696-8681718 ATGGGGGAGGGGAAGGGGGAGGG - Intronic
926072517 2:9909658-9909680 AGTGACGGGAAGAAAGGGGATGG + Intronic
926432376 2:12801393-12801415 ATGGAGGATGAGAGAAGGGAGGG + Intergenic
926546892 2:14252676-14252698 AAGGAGGAGGAGTAAGAGGAAGG - Intergenic
926750235 2:16193116-16193138 ATTGAGGCTGAGAGAGGGAAAGG - Intergenic
926759902 2:16269100-16269122 ATTGAAGAAGAGGAAGGGGTGGG + Intergenic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
927367187 2:22311352-22311374 ATGGAAGGGGAAAAAGGGGAAGG - Intergenic
927441428 2:23121040-23121062 ATTGAAGAGGGGCAAGGGAATGG - Intergenic
927466752 2:23342463-23342485 ATTGAATTGGAGAAAGGAGAAGG + Intergenic
927803572 2:26123961-26123983 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
927844582 2:26464862-26464884 ATTGAGGACGAGAACGGTAATGG - Exonic
928143501 2:28751492-28751514 AGTGAAGTAGAGAAAGGGGAAGG + Intergenic
929161422 2:38836321-38836343 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
929246742 2:39710463-39710485 AGGAAGGAGAAGAAAGGGGAGGG + Intronic
929461844 2:42107863-42107885 CTTGAGTAGGTGAAAGGGGCAGG - Intergenic
930208238 2:48609536-48609558 AATGAGTAGGAGACAGAGGAAGG - Intronic
930360388 2:50370668-50370690 GTTAAGGAGTAGAAAGGGAAAGG + Intronic
930571092 2:53088153-53088175 GTGGAGGAGAAGTAAGGGGAGGG + Intergenic
930672681 2:54167992-54168014 ATTGGGATGGAGAAATGGGATGG - Intronic
930798533 2:55419354-55419376 CTGGAGGAGGAGGAAGGGAAAGG + Exonic
930945703 2:57072322-57072344 ATTGAGGAGAAGGAAGAGGAGGG - Intergenic
930978190 2:57489936-57489958 ATTGAGGTGGAGAAAATGAAGGG + Intergenic
931111492 2:59115876-59115898 AATGTGGAGGAAAAGGGGGATGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931627453 2:64269832-64269854 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
931837690 2:66116454-66116476 ATTCTGGAGGAGAAAGAGGTTGG - Intergenic
932030640 2:68180705-68180727 AATGTGGTGGAGAAAGGGAAGGG - Exonic
932110601 2:68995613-68995635 TTTGAGGGGCTGAAAGGGGATGG + Intergenic
932457723 2:71860229-71860251 ACTGAAGGAGAGAAAGGGGACGG + Intergenic
932805962 2:74783693-74783715 AATAAGGAGGAAAAAGGAGAAGG + Intergenic
933197860 2:79412780-79412802 ATTGAGAAGGAGAAACTGGATGG + Intronic
933367986 2:81378873-81378895 TTTGAGGAGGAGGAAGAAGAGGG - Intergenic
933407783 2:81883321-81883343 ATTAAGTAGGAGAAAGGGATAGG + Intergenic
933685821 2:85140465-85140487 ATGGAGGAAAAGAAAGGGGGAGG - Intronic
933759162 2:85662362-85662384 ATGGAGGTGGAGGGAGGGGAGGG - Intronic
934581991 2:95450088-95450110 GTAGAGGAGGAGAGCGGGGAAGG + Intergenic
934597459 2:95626626-95626648 GTAGAGGAGGAGAGCGGGGAAGG - Intergenic
934652373 2:96099888-96099910 GGGGAGGAGGAGAAAGGGGAGGG + Intergenic
934652389 2:96099942-96099964 GGTGAGAAGGAGAAAGAGGAAGG + Intergenic
934765528 2:96878162-96878184 GTTGAGGAGGAAAAGGAGGATGG + Intronic
934842430 2:97636370-97636392 GTAGAGGAGGAGAGCGGGGAAGG + Intergenic
935277094 2:101484355-101484377 ATTGTGGAGAGGAAAGGGCAGGG - Intergenic
935308355 2:101759545-101759567 AATGGGGAGGGGAGAGGGGAGGG - Intronic
935308361 2:101759557-101759579 AGAGAGGAGGGGAATGGGGAGGG - Intronic
935308371 2:101759581-101759603 AATGGGGAGGTGAATGGGGAGGG - Intronic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
935803382 2:106722619-106722641 GAGGAGGAGGAGAAATGGGAGGG + Intergenic
936268893 2:111033181-111033203 ATGGAGGAGGAGCGAGGAGAGGG + Intronic
936345962 2:111675281-111675303 ATTGAGGAGCAGAAAGTTGTTGG + Intergenic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
936663607 2:114569679-114569701 AATGAGGAAGAGAAAGTGGGTGG + Intronic
937141056 2:119600818-119600840 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
937186206 2:120045806-120045828 ATTGAGGGGGGGACGGGGGAGGG - Intronic
937212747 2:120286973-120286995 ATTATGTAGGAGAAAGGGAAGGG - Intronic
937412752 2:121690593-121690615 ATGGGGGAGGAGTAAGGGGAGGG - Intergenic
937457372 2:122054223-122054245 CTAGAGGAGGCGAAAGGAGAAGG - Intergenic
937487059 2:122326272-122326294 CTGGAGGAAAAGAAAGGGGAAGG + Intergenic
937814067 2:126231680-126231702 CTTGAGGAGGAGGAAAGAGAAGG - Intergenic
938122635 2:128644731-128644753 GTAGAGAGGGAGAAAGGGGAAGG - Intergenic
938262964 2:129908440-129908462 ATTGAGGATGAGAGAGAGGAAGG - Intergenic
938380196 2:130832148-130832170 TTTGAGGAGGAGAAGGGAGGAGG - Intergenic
938394105 2:130929348-130929370 ATGGAGGAAGAGAAACTGGATGG - Intronic
939018676 2:136932701-136932723 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
939274304 2:139980390-139980412 ACTGAGGAGGAGAGAGATGAGGG + Intergenic
939638648 2:144612669-144612691 GTTGGGGATGAGAGAGGGGAAGG + Intergenic
939696898 2:145337453-145337475 ATTGAAAAGAAGAAAGGAGACGG + Intergenic
939853363 2:147326637-147326659 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
941038253 2:160590654-160590676 AGGGAGGAGGGGAAGGGGGAGGG - Intergenic
941144342 2:161824930-161824952 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
941205395 2:162566153-162566175 TTTGAGGAGGAGGAAAGGGTTGG - Intronic
941274456 2:163473084-163473106 AGTGAGGAGTGGTAAGGGGATGG + Intergenic
942328500 2:174796297-174796319 ATTGACCACCAGAAAGGGGAGGG - Intergenic
942350780 2:175050699-175050721 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
942717062 2:178905062-178905084 TCTGAGGAGGGGAAAGGGAATGG - Intronic
942970821 2:181956021-181956043 GGTGGGGAGGAGATAGGGGAGGG - Intronic
943046454 2:182866989-182867011 AGTGAGGAGGACAGAGGGGTTGG + Exonic
943173320 2:184433089-184433111 GGTGGGGAGGAGATAGGGGAGGG - Intergenic
943199927 2:184809324-184809346 AATGAGTAGGAGAAAGTGAATGG + Intronic
943553941 2:189377715-189377737 GTGAAGGAGGAGAAAGTGGAGGG - Intergenic
943890253 2:193277266-193277288 GAGGAGGAGGAGGAAGGGGAGGG - Intergenic
944253332 2:197599499-197599521 TGTGAGAAGGAGAAAGAGGAAGG + Intronic
944667831 2:201971702-201971724 TCTGAGGAGGAGAATGGGAACGG + Intergenic
944851274 2:203721944-203721966 AGTGAGGTGGAGAGAGGGAAGGG - Intronic
944913348 2:204331995-204332017 ATGGAGATGGAGAAAGGGCAAGG - Intergenic
945109896 2:206352454-206352476 CGAGAGGAGGAGGAAGGGGAAGG - Intergenic
945187222 2:207151386-207151408 ATTGAGGAGGGCAGGGGGGAGGG + Intronic
945188793 2:207166077-207166099 CAGGAGGAGGAGAAAAGGGAGGG - Intronic
945209028 2:207363314-207363336 AATGAAGAGGAGAAAGGGAAAGG + Intergenic
945264938 2:207881772-207881794 AAAGAGTAGGAGAAAGGGAAGGG - Intronic
945297414 2:208184191-208184213 ATTCAGGAGGTGAAGGGGGGCGG - Intronic
945307074 2:208268766-208268788 AAAGAGGAAGAGGAAGGGGAAGG - Intronic
945435344 2:209811020-209811042 TTTAAGAAGGAGAAATGGGATGG + Intronic
945792656 2:214324724-214324746 GTAGAGGAGGAGAAAGGAGGGGG - Intronic
945807146 2:214503458-214503480 ATTGAGGAAGAGAGAGGCAAAGG + Intronic
945876978 2:215288035-215288057 ATTGAGTGGGAAAAAGGAGAAGG + Intergenic
946142890 2:217706593-217706615 AAAGGGGAGGAGGAAGGGGAAGG + Intronic
946587923 2:221211186-221211208 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
946606553 2:221411485-221411507 AGGGAGGAAGAGAAAAGGGAAGG + Intergenic
946635393 2:221719377-221719399 ATTGCAGTGGAGAAAAGGGAGGG - Intergenic
946901166 2:224373256-224373278 AGAAAGAAGGAGAAAGGGGAAGG - Intergenic
947085886 2:226452462-226452484 AAAGAGGAGGAGAAAAGAGAAGG + Intergenic
947578007 2:231292323-231292345 ATTTAGGAGGGGAAAGGGAGAGG - Intronic
947719577 2:232362340-232362362 AGTGAGGAAGAGAGAGAGGAGGG - Intergenic
947830189 2:233134150-233134172 AAGGAGGAGGAGGAAGGAGAGGG + Intronic
947901099 2:233722947-233722969 GAGGAGGAGGAGGAAGGGGAGGG + Intronic
948091780 2:235301718-235301740 GATGAGGGGGAGAAGGGGGAAGG - Intergenic
948308832 2:236970007-236970029 AGTGACGGGGAGAAAGGTGAGGG - Intergenic
948558579 2:238835306-238835328 GAGGAGGAGGAGGAAGGGGAAGG - Intergenic
948829099 2:240588932-240588954 GTAGACGGGGAGAAAGGGGAAGG + Intronic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
948995500 2:241576247-241576269 AGACAGGAGGAGGAAGGGGAGGG - Intergenic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1169044995 20:2528097-2528119 ATGGAGCAGAAGAAAGGGGCAGG + Intergenic
1169178318 20:3539314-3539336 TTTTAGGAGGAGAAAGGGTAGGG + Intronic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169765574 20:9144661-9144683 AAGGAGGAGGAGGAGGGGGAAGG + Intronic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170343974 20:15362930-15362952 AGAGAAGAGGGGAAAGGGGAGGG + Intronic
1170392568 20:15891276-15891298 ATTGAGGAACACAAAGGGAAAGG + Intronic
1170493116 20:16898468-16898490 ATTGAGGAGGAAAGCAGGGATGG + Intergenic
1170580610 20:17696981-17697003 AATGGGGAGGAGAATGTGGAAGG + Intronic
1170602440 20:17851136-17851158 GAGGAGGAGGAGGAAGGGGAGGG + Intergenic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1171141891 20:22750574-22750596 AATGAGGAGGTGAAAGGAAAGGG + Intergenic
1171933538 20:31250933-31250955 GCTGAGGAGGAGAAAAAGGAGGG - Intergenic
1172291491 20:33780286-33780308 AGTGAGGTGGAGAAAGGAGAAGG + Intronic
1172502699 20:35438205-35438227 GTTGTGCAGGAGAAAGGGGGCGG - Intronic
1172589346 20:36106247-36106269 AATGAAGAGGACAAAAGGGAAGG - Intronic
1173183813 20:40824025-40824047 ATTTTGGAGGAGAGAGGGAAGGG - Intergenic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1173456433 20:43206077-43206099 TGTGAGGACGAGAGAGGGGAAGG + Intergenic
1173479978 20:43390753-43390775 ATCGGGGAGGAGAAAGTGCAGGG - Intergenic
1173544031 20:43878698-43878720 ATAGAGAAAGACAAAGGGGAAGG - Intergenic
1173896471 20:46554868-46554890 AGGGAGGAGGAGCATGGGGAGGG - Intergenic
1174027247 20:47588110-47588132 AGTGGGGTGGAGAAAGGGTATGG - Intronic
1174112456 20:48205862-48205884 ACAGAGGAGGAGACAAGGGAAGG - Intergenic
1174118536 20:48244841-48244863 ATGGTGGATGAGAAGGGGGATGG - Intergenic
1174159471 20:48540764-48540786 GTTGAGCAGGAGAAAGAGAAGGG - Intergenic
1175102717 20:56591096-56591118 ACTCAGTAGGTGAAAGGGGATGG + Intergenic
1175134798 20:56815151-56815173 AGAGAGGAGGAGGAGGGGGAGGG + Intergenic
1175281703 20:57808204-57808226 ATTGAGGCTGAGAGAGGGAAAGG - Intergenic
1175460068 20:59145871-59145893 GTTGAGGAGGAGGAGGGTGAGGG - Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175767130 20:61599402-61599424 ATTGTGGGTGAGAAAGGGCAGGG - Intronic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1175992638 20:62797054-62797076 AGCGGTGAGGAGAAAGGGGATGG - Intronic
1176108651 20:63401223-63401245 GTGGAGGAGGAGAGACGGGAGGG - Intergenic
1176877340 21:14145660-14145682 AAGAAGGAGGAGAAAGGGAAGGG + Intronic
1177156943 21:17510374-17510396 ATTTAGGAGGAGGAGGGGGGGGG - Intergenic
1177507230 21:22034750-22034772 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1177986863 21:27986925-27986947 ATTTTGGAGGAAAAAGGAGAAGG - Intergenic
1178087731 21:29129337-29129359 ATTCAGGAAGAGAAAAAGGAAGG - Intronic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178205475 21:30459403-30459425 ATTGAGGAGGAAAATAGGAATGG - Intergenic
1178505266 21:33157439-33157461 AAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178666031 21:34547317-34547339 AGGGAGGGGGAGAAAGGTGAGGG - Intronic
1178708580 21:34894483-34894505 ATTGGGGAGGGGGAAGGGGTAGG + Intronic
1178782618 21:35619256-35619278 ATTGAGAAGAAGAAAGGGTTTGG - Intronic
1178790683 21:35697323-35697345 ATTGAGGGAGAGGAAGGGGAGGG - Intronic
1178792040 21:35709607-35709629 AATGAGGAAGAGAGAGGGTAGGG - Intronic
1179440152 21:41387926-41387948 TGAGAGGAGGAGAAAAGGGAGGG - Intronic
1179487799 21:41722119-41722141 GTTGAGGAGGAAAAGGAGGAGGG - Intergenic
1180104306 21:45607710-45607732 AAGGGGGAGGAGAGAGGGGAGGG + Intergenic
1180261681 21:46674642-46674664 AGGGAGGAGGAGGAAAGGGAGGG + Intergenic
1180301620 22:11040960-11040982 AAGGAGGAGGAGGAAGGGGAAGG + Intergenic
1180657704 22:17437200-17437222 ATTTAGGAGGCCAAGGGGGAAGG - Intronic
1180872092 22:19151899-19151921 ATTGAGGGTGAGAATGGGAAAGG - Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181711861 22:24696182-24696204 GTGGAGGAGGAGAAAGGGGTGGG - Intergenic
1181853339 22:25765589-25765611 ACTGAGGCCAAGAAAGGGGAAGG - Intronic
1182350090 22:29694531-29694553 AATGAGGATGTGCAAGGGGAAGG - Intronic
1182885336 22:33768997-33769019 AGTGAGGAGCAGAGAGGAGAAGG - Intronic
1183245584 22:36690962-36690984 ATGGGAGAGGAGATAGGGGAAGG - Intronic
1183246019 22:36694020-36694042 CTTGAGGAGGAAAAGGGTGATGG - Intronic
1183252443 22:36739677-36739699 ATTGTGGAGTAGGAGGGGGAGGG - Intergenic
1183589297 22:38770473-38770495 ATTGAGGAGAAGACAGGGCTGGG + Intronic
1183731765 22:39622364-39622386 ATTGAGTAGGTGGAGGGGGAGGG + Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184547530 22:45181686-45181708 GTTGGGGAGGAGGAAGGGGAGGG - Intronic
1184919706 22:47597157-47597179 CTTAAGGAGGAGACAGAGGAGGG - Intergenic
949122397 3:402417-402439 AGAGAGTAGCAGAAAGGGGAAGG - Intronic
949631019 3:5926628-5926650 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
949901441 3:8818129-8818151 AATGAGGAGGAGGGAAGGGAAGG - Intronic
950102436 3:10366243-10366265 AGGGCCGAGGAGAAAGGGGAAGG - Intronic
950201993 3:11050978-11051000 ATTGAGGAGGAGGAGGGAAATGG - Intergenic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950374366 3:12557855-12557877 ATTTACGAGGAGAAATGCGACGG + Intronic
950571787 3:13804915-13804937 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
950635783 3:14313506-14313528 ATTGAGGAGGAGAGGAAGGAAGG - Intergenic
950674894 3:14548771-14548793 ACTGAGGTCGAGAGAGGGGAAGG + Intergenic
950692789 3:14673582-14673604 ACTGTGGAGTAGAAAGGAGAAGG + Intergenic
950856845 3:16113741-16113763 ATTCAGAAGGAGACAGGGTATGG - Intergenic
950932169 3:16800905-16800927 AGTGAGGAAGAGAAGGAGGAAGG + Intergenic
951486896 3:23222847-23222869 AAGGATGCGGAGAAAGGGGAAGG - Intronic
951596653 3:24325965-24325987 ATTAAAGAGGAGAAAGGGAGAGG - Intronic
951636656 3:24786259-24786281 ATTCAGGAAGGGATAGGGGAGGG + Intergenic
951719089 3:25679516-25679538 AGTGAGGAGGGGAAAGGGGGAGG + Intergenic
952205255 3:31174933-31174955 ATTGAGGTGGAGGAAAAGGAGGG - Intergenic
952256000 3:31696222-31696244 TTTGAGGAGGTGAGAGGGCATGG - Intronic
952285113 3:31960846-31960868 ATTAAAGAGGATAAAGAGGATGG - Intronic
952509127 3:34036397-34036419 TTGGAGGAGGGGAAAGGGAAGGG + Intergenic
952696456 3:36269941-36269963 ACTCAGGAGGTTAAAGGGGAAGG + Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952726824 3:36595308-36595330 AAGGAGAAGGAGAAAGGGAAGGG - Intergenic
953009128 3:39007511-39007533 TTTTAGGAGGGGAAAGGGGCTGG + Intergenic
953575790 3:44112227-44112249 AGAGAGGAGGAGAATAGGGAGGG + Intergenic
953916383 3:46923450-46923472 AAAGAGGAGGAGGAAGGAGAGGG + Intronic
954000103 3:47549892-47549914 GGGGAGGAGGAGGAAGGGGAAGG - Intergenic
954411843 3:50374311-50374333 GAGGGGGAGGAGAAAGGGGAGGG + Intronic
954443627 3:50535079-50535101 CTTGAGGAGCAGAATGGGGGAGG - Intergenic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
954847586 3:53573321-53573343 AGTGTGGAGGAGTGAGGGGAAGG - Intronic
955349283 3:58182155-58182177 GGGGAGGAGGAGGAAGGGGAGGG + Intergenic
955382549 3:58451463-58451485 GCTGAGGAGGAGGAAGAGGAAGG + Intergenic
955406631 3:58629850-58629872 AGAGAGGAGGAGAAGGAGGATGG + Intergenic
955629090 3:60952656-60952678 TTTCAGGAAGAAAAAGGGGAGGG - Intronic
955794087 3:62617651-62617673 TTTGGGGATGAGAGAGGGGAAGG + Intronic
955855516 3:63268663-63268685 AAGGAGGAGGAGGAAGAGGAGGG + Intronic
956109416 3:65855610-65855632 GATGGGGAGGAGAGAGGGGAGGG + Intronic
956212626 3:66817307-66817329 GAGGAGGAGGAGGAAGGGGAAGG + Intergenic
956227847 3:66979550-66979572 ATTGGGGATGAGGAAGGGGTAGG - Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956704936 3:71991534-71991556 AGGGAGGAAGAGAGAGGGGAGGG + Intergenic
956809985 3:72855537-72855559 AAGGAGGAGGTGAAAGGGAATGG - Intronic
957121413 3:76099195-76099217 ATAGAAGAGGAGAAAAGGAACGG - Intronic
957347856 3:78984926-78984948 TAGGAGGAGGAGAAAGAGGAGGG - Intronic
957462364 3:80537912-80537934 AGGGAGGAAGAGAGAGGGGAGGG + Intergenic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
957839892 3:85654327-85654349 ATTGAGTAGGGAAGAGGGGATGG + Intronic
958196527 3:90247971-90247993 ATTGAGGAGGGTAAACAGGAAGG + Intergenic
958419717 3:93916608-93916630 ATTGAGGAGGGTAAACAGGAAGG + Intronic
958584084 3:96062803-96062825 TAGGAGGAGGAGGAAGGGGAAGG - Intergenic
958706513 3:97663138-97663160 ATGGGGTAGGACAAAGGGGAAGG + Intronic
959110004 3:102111576-102111598 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
959171709 3:102852147-102852169 CTGGAGCAGGAGAAAGGGAATGG - Intergenic
959208347 3:103342512-103342534 AGAGAGAAGGAAAAAGGGGAGGG - Intergenic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959475348 3:106804596-106804618 ATTGAGAGGGAAAAAGGAGAGGG - Intergenic
959505793 3:107155356-107155378 ACTGAGGAGCAGAAAAGGAAAGG + Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959918131 3:111841328-111841350 ATTGAGTAGGAGTAGGAGGAGGG + Intronic
959963814 3:112332219-112332241 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
960218042 3:115066825-115066847 ATTTGGGAGAAGACAGGGGAAGG - Intronic
960370596 3:116833135-116833157 ATTGTTTAGGTGAAAGGGGATGG + Intronic
960527335 3:118724666-118724688 CTTGTGGAGGAGAAGGGAGATGG + Intergenic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
962236471 3:133711593-133711615 CTAGAGGAGCACAAAGGGGAGGG - Intergenic
962467590 3:135674645-135674667 TTTGGAGAAGAGAAAGGGGAGGG - Intergenic
962648678 3:137466012-137466034 ATTGAGGGTGAGAAAGGGTAAGG + Intergenic
962658443 3:137574058-137574080 CTTGAGGAGGAGACAGAAGATGG + Intergenic
962865573 3:139445725-139445747 AGTGCAGAGCAGAAAGGGGAAGG - Intergenic
963405382 3:144856626-144856648 AGTAAAGAGGAGAAGGGGGAGGG - Intergenic
963599687 3:147367831-147367853 ATTCAGGTGGAGAAGAGGGAGGG - Intergenic
963600960 3:147378465-147378487 AAGGAAGAGGAAAAAGGGGAAGG + Intergenic
963652940 3:148006983-148007005 AAGGAGGAAGAGGAAGGGGAAGG - Intergenic
963932699 3:151020603-151020625 AATGAGGAGGGGAGAGGGGCTGG - Intergenic
964012908 3:151912360-151912382 GGTGAGGAGGATGAAGGGGAAGG + Intergenic
964311355 3:155396623-155396645 ACTGAGAAGGAGGAAGAGGAGGG + Intronic
965238539 3:166160920-166160942 GTTGAAGAGGAGAAATGTGATGG + Intergenic
965400626 3:168208571-168208593 ATTGAGCATTAGAAAGGAGAAGG + Intergenic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
966466892 3:180239195-180239217 TATGAGGAGGAGAATGGTGAAGG + Intergenic
966525212 3:180912588-180912610 AAGGAGGCGGGGAAAGGGGAGGG - Exonic
966592358 3:181696572-181696594 ATTGAGGAAGAAAAAGAGAAAGG - Intergenic
966765052 3:183453677-183453699 AAGGAGGAGGAGAGAGTGGAGGG + Intergenic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
967004613 3:185372305-185372327 AAAAAGGAGGAGGAAGGGGAAGG - Intronic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
967192662 3:186998508-186998530 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
967855235 3:194112430-194112452 ATGGAGGATGTGAATGGGGAAGG - Intergenic
967977970 3:195045962-195045984 GTGGAGGAGGAGAACGGAGAAGG - Intergenic
968131001 3:196192770-196192792 CAGGAGGAGGAGCAAGGGGAAGG + Intergenic
968344954 3:197995091-197995113 ATTGAGCAGGAGGAAGAGGAGGG - Intronic
968356644 3:198113528-198113550 ATTGGAGAGGAGAAAAGAGAGGG + Intergenic
968741734 4:2334750-2334772 AGTGGGGAGGGGGAAGGGGAGGG - Intronic
969156735 4:5217786-5217808 ATTCAGGAAGAGACAGTGGAAGG + Intronic
970432653 4:16002918-16002940 ATTGAAAAGGAGGAAGAGGAGGG + Intronic
970443885 4:16108352-16108374 GTTGGGGAGGAGAAAGGTGTGGG + Intergenic
970590848 4:17559609-17559631 ATGGTGGAGTAGACAGGGGAGGG - Intergenic
970768080 4:19575609-19575631 ATTGAAAAGGGAAAAGGGGAAGG + Intergenic
970916184 4:21338002-21338024 ATGGTGGAGCAGAAAGTGGAAGG - Intronic
971025233 4:22582833-22582855 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
971045587 4:22801734-22801756 ATTGAGGGGAAGGAAGGGAAGGG - Intergenic
971412117 4:26384968-26384990 AGAGGGGAGGAGAGAGGGGAGGG - Intronic
971539941 4:27803410-27803432 TATGGGGAGGAGAAAGGGCAAGG - Intergenic
971586758 4:28414496-28414518 AAGGGGGAGGAGAAAGAGGAAGG - Intergenic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
971769854 4:30882188-30882210 GAAGAGGAGGAGGAAGGGGAGGG - Intronic
971865670 4:32168299-32168321 AAAGAGGAGGAGAAAGAAGAAGG - Intergenic
972166858 4:36297139-36297161 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
972217912 4:36917459-36917481 ATGGAGCAAGAGGAAGGGGAGGG + Intergenic
972348504 4:38213528-38213550 AATGTGGAAGGGAAAGGGGAAGG + Intergenic
972359918 4:38317273-38317295 ATTGAGGAGCAGAAAGGTACAGG - Intergenic
972362687 4:38342998-38343020 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
973267582 4:48226449-48226471 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
973575381 4:52282780-52282802 GCTGAGGAGGAGGAATGGGAGGG - Intergenic
974324071 4:60391471-60391493 ATTAAAGAGGAGACATGGGAGGG + Intergenic
974495768 4:62624594-62624616 ATCAGGTAGGAGAAAGGGGACGG + Intergenic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974707549 4:65541053-65541075 ATTGGAGATGAGAAAGGGGAAGG - Intronic
974841307 4:67302680-67302702 ATGGAGGTGGAGAGAGAGGAAGG + Intergenic
975360210 4:73460925-73460947 AAGGAGGAGGGGAAGGGGGAGGG - Intergenic
975663048 4:76706530-76706552 GCTGAGGAGGAGTAAGAGGATGG + Intronic
975794712 4:77994964-77994986 GTGGAAGAGAAGAAAGGGGAAGG + Intergenic
976087725 4:81423241-81423263 ATTAAAGAGGAGGAAGGGGCCGG - Intergenic
976128413 4:81857825-81857847 TTTCTGGAGGAGAAATGGGAAGG - Intronic
976269516 4:83217158-83217180 TTTCAGGGGGAGAAAGGGGCAGG - Intergenic
976478382 4:85510793-85510815 GAGGAGGAGGAGGAAGGGGAGGG - Intronic
976630399 4:87230277-87230299 CTTGAGGAGGTCAAAGGGAAGGG - Intronic
976777188 4:88719602-88719624 AAGGAGGAGGAGAAAGAGAAGGG - Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
976863423 4:89694265-89694287 ATGGAGGAGGAGTTTGGGGAGGG - Intergenic
976883779 4:89962001-89962023 AATAAGGAGGAGGAAGAGGAAGG + Intergenic
977083201 4:92560156-92560178 AATGTGGAGAAGAAAGGAGAGGG + Intronic
977352286 4:95903885-95903907 GATGAGGAGGAGACTGGGGATGG + Intergenic
977376585 4:96212703-96212725 ATTGAAGAAAAGAAAGAGGAAGG + Intergenic
977675846 4:99745971-99745993 GCTAAGGAGGAGAAATGGGAGGG - Intergenic
978168765 4:105643316-105643338 ATTAAGGAAGAAAAAGAGGAAGG - Intronic
978311957 4:107394521-107394543 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
978487593 4:109273065-109273087 AGGGAGGATGGGAAAGGGGAAGG + Intronic
978560667 4:110030333-110030355 AGTGAGGAGGAGAGTGGGGCCGG + Intergenic
978723436 4:111942092-111942114 AGAGAGGGAGAGAAAGGGGAGGG + Intergenic
979416782 4:120451076-120451098 ATGGAGGAGGAGATAGGTGTGGG + Intergenic
980018917 4:127684624-127684646 AAGGAGGAGGAGGAAGAGGAAGG - Intronic
980264407 4:130496257-130496279 ATTGATTAGGAGAGAAGGGAGGG + Intergenic
980734809 4:136870761-136870783 ATTGAGATGCGGAAAGGGGAGGG + Intergenic
980844912 4:138312811-138312833 GAGGAGGAGGAGAAAGGGGCAGG - Intergenic
980965580 4:139517651-139517673 TTTGAAGAGGAGAAATGGTATGG - Intronic
980992046 4:139746714-139746736 AGAGAGGAGGAGAAGGGGGGAGG - Intronic
981295604 4:143127385-143127407 GAAGAGGAGGAGGAAGGGGAGGG + Intergenic
981379522 4:144056899-144056921 ATTGAGGCAGAGAGAGGAGAAGG + Intergenic
981498716 4:145423119-145423141 GAGGAGGAGAAGAAAGGGGAGGG + Intergenic
981550712 4:145938065-145938087 AGTGAGGAGGGGGAAGGGGAGGG + Intronic
981574543 4:146190905-146190927 ATCGAGAAGGAGAGAGGGAAGGG + Intronic
981658107 4:147135224-147135246 AAAAAGTAGGAGAAAGGGGAAGG - Intergenic
982012047 4:151114977-151114999 ATTGAGGAGGAGAAATTGTCAGG - Intronic
982157119 4:152534896-152534918 ATTGAGGGGGAGAAAGTGGGAGG - Intronic
982253346 4:153429372-153429394 TCTGAGGAGGAAAAGGGGGAGGG - Intergenic
982521668 4:156425007-156425029 GCTGAGGAGGAGGAAGAGGAAGG - Intergenic
982691573 4:158553431-158553453 CCTGAGTAGGAGAGAGGGGATGG + Intronic
982747063 4:159114835-159114857 AGTGAGGGGGTGGAAGGGGAGGG + Intronic
982822818 4:159965735-159965757 ATGCAGGAGAAGAAATGGGAAGG - Intergenic
982948029 4:161651516-161651538 AAGGAAGAGAAGAAAGGGGAAGG + Intronic
982977968 4:162090960-162090982 CATGAGGAGCAGAAAGGTGATGG - Intronic
983661268 4:170132734-170132756 AAAAAGGAGGAGAAACGGGAAGG - Intergenic
983750717 4:171266066-171266088 GAAGAGGAGGAGGAAGGGGAGGG - Intergenic
983759243 4:171384894-171384916 AAAGAAGAGGAGGAAGGGGAAGG - Intergenic
983913872 4:173269722-173269744 GTTGAGGAGGAGGAGGAGGAGGG - Intronic
983990558 4:174114321-174114343 ATTGAGGAGTAGAAAGGAAGAGG + Intergenic
984528084 4:180881271-180881293 ATTGAGAAAGAGAAAAGGGATGG + Intergenic
984536924 4:180987892-180987914 ATTGAGTGGGATAAATGGGAAGG - Intergenic
984703556 4:182833364-182833386 AAGGAGGAGGGGAGAGGGGAAGG - Intergenic
984714752 4:182916156-182916178 ATTATTGAGGAGAAAGGGAAGGG - Intronic
985168476 4:187123223-187123245 ACTGAGGAGGAGGAAGGAGAGGG - Intergenic
985197126 4:187443398-187443420 AGTCAGGAGGGAAAAGGGGAGGG + Intergenic
985658122 5:1142478-1142500 AGTGGGGAGGGGAAAGGGGAGGG - Intergenic
985783130 5:1881231-1881253 AAAGGGGTGGAGAAAGGGGAGGG + Intronic
986141153 5:5031741-5031763 ATTCAGGATGAGAAATGGGTGGG - Intergenic
986167845 5:5291380-5291402 GTTGAGGAGGAGAAGAGGCAGGG + Intronic
986178800 5:5374329-5374351 ATGTGAGAGGAGAAAGGGGATGG + Intergenic
986297319 5:6449756-6449778 ATTGAGGAGCAGACAAGAGAGGG - Intronic
986344984 5:6826646-6826668 GTTGGGGATGAGAGAGGGGAAGG + Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986613878 5:9597110-9597132 ACAGAGGAGGAGGAAGGGGAAGG - Intergenic
986811685 5:11366393-11366415 TTTGAGGAGGAGAAAGGGACAGG + Intronic
986879095 5:12147854-12147876 ATGGAGGAGGAGGGAGGGGGAGG - Intergenic
986984217 5:13481799-13481821 ATTGAAGAGTAGAAAGATGAGGG - Intergenic
987191279 5:15480877-15480899 GTTGAGGAGGAGGATGAGGATGG + Intergenic
987505030 5:18757681-18757703 TCTGAGGAGGAGGAAGAGGAGGG + Intergenic
987510838 5:18836312-18836334 GAGGAGGAGGAGAAAGTGGAGGG - Intergenic
988006492 5:25418476-25418498 CTGGAGCAGGAGGAAGGGGAGGG + Intergenic
988078866 5:26389898-26389920 AGTGGAGAGGAGAAAGTGGAAGG + Intergenic
988781837 5:34529523-34529545 ATCCATGAGGAGCAAGGGGAGGG - Intergenic
989043342 5:37250524-37250546 ATAGAGGAGGAGGAAGAGGAGGG - Intergenic
989122895 5:38021760-38021782 ATAGAGGAGAAGGAAGGGGAAGG - Intergenic
989463047 5:41723596-41723618 ATTGAGGGGGAGAGAGAGAAAGG - Intergenic
989523060 5:42423690-42423712 CTTGGGGAGGAGAGAGGGGGCGG - Intergenic
990179889 5:53149116-53149138 AGAGTGGAGGAGGAAGGGGAGGG - Intergenic
990258623 5:53997660-53997682 ATGAAGGAGGTGAATGGGGAAGG + Intronic
990699822 5:58462181-58462203 ATTAGAGAGGAGAAAGGGAAAGG + Intergenic
990927029 5:61037681-61037703 AGCGAGTAGGGGAAAGGGGATGG - Intronic
991036402 5:62131940-62131962 AGGGAGCAGGAGAAGGGGGATGG - Intergenic
991135078 5:63173443-63173465 GTTGAAGAGGGTAAAGGGGAGGG + Intergenic
991185097 5:63797077-63797099 AATGAGGAGGAGGAGGAGGATGG + Intergenic
991203823 5:64025839-64025861 AGTGGGGAGGAGAAAGGAGTTGG + Intergenic
991416493 5:66397880-66397902 CATGAGAAGGAGAAACGGGAGGG + Intergenic
991562656 5:67970953-67970975 AAGGAGGAGGAGAAAGAGGTAGG + Intergenic
992002046 5:72445303-72445325 ACTGAGGAGGAGCAACAGGAAGG + Intronic
992349684 5:75916299-75916321 GAAGAGGACGAGAAAGGGGAAGG - Intergenic
992349713 5:75916390-75916412 GAGGAGGAGGAGGAAGGGGAAGG - Intergenic
992597604 5:78361192-78361214 GTGGAGGAGGAGAGAGGTGAGGG + Intronic
992699576 5:79328503-79328525 ATGGGAGAGGAGTAAGGGGAGGG + Intergenic
992886892 5:81168191-81168213 CTTAAGGAGGTGAAAAGGGATGG - Intronic
992923178 5:81549259-81549281 ATTGATGAAGAGAAAGATGAAGG - Intronic
993069413 5:83140747-83140769 ATTGAGAAACAGAAAGGGGTGGG - Intronic
993261850 5:85667672-85667694 GAAGAGGAGGAGAAAGGGGAGGG - Intergenic
993374625 5:87135639-87135661 GTTTAGGAGGGGAGAGGGGAGGG + Intergenic
993682752 5:90899780-90899802 ATTGAGGTGGAAAGAGTGGAAGG - Intronic
993716128 5:91277355-91277377 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
993929730 5:93923074-93923096 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
994104086 5:95926230-95926252 GTGGAGGAGTAGGAAGGGGAGGG + Intronic
994332802 5:98527034-98527056 TTTGAGGAGGAGCAAGGAGATGG - Intergenic
994377612 5:99032916-99032938 ATTGATTAGGAGAAAATGGAGGG - Intergenic
994601279 5:101908603-101908625 ACTGTGGAAGAGAAAGGGGAGGG - Intergenic
994721962 5:103390820-103390842 ATTGTGGAGTAGAAAGAGGAAGG - Intergenic
995070438 5:107914785-107914807 ATTGAGTAAGACAAAGTGGAAGG + Intronic
995118222 5:108505952-108505974 AGAGAGGAGGGGAAAGGGAAGGG - Intergenic
995545427 5:113225429-113225451 AGTGAGGTGGGGAAAGTGGAAGG - Intronic
995856773 5:116600847-116600869 AATGGGGATGGGAAAGGGGAGGG + Intergenic
995915956 5:117245167-117245189 AAGGAGGAGGAGAAAGGTGGGGG + Intergenic
996235678 5:121126961-121126983 AAGGAGGAGGGCAAAGGGGAAGG - Intergenic
996423389 5:123286409-123286431 ATTCAGGATGGGAAAGGAGATGG - Intergenic
996464478 5:123783416-123783438 CTTGGGAAGGTGAAAGGGGAGGG + Intergenic
996596823 5:125212881-125212903 ATGAAGGAAGAGAAAAGGGAAGG - Intergenic
997225740 5:132208372-132208394 AGAGAGGAGGAGAAGGGGGAGGG + Intronic
997460580 5:134049387-134049409 ATTGAGGAATAGCAAGGGGTGGG - Intergenic
997506549 5:134422076-134422098 AATAAGGAGGAGAAAAGAGAAGG - Intergenic
997583609 5:135031922-135031944 CCTGAGGAGAAGAAAGTGGAGGG - Intronic
997741159 5:136256213-136256235 ACTGAGGAGGAGCAATGGGAGGG - Intronic
997771763 5:136561613-136561635 AGAGAGGAAGAGAAAGAGGAAGG - Intergenic
997885835 5:137629301-137629323 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
998006414 5:138659852-138659874 AAGGAGAAGGAGAAAGGAGATGG - Intronic
998165800 5:139842875-139842897 AAGGAGGAGGAGAAAGGGTGGGG - Exonic
998300688 5:141016823-141016845 CTTGAGGAGGACCAAGAGGAAGG - Intergenic
998400294 5:141845322-141845344 GTGGAGGAGGAGCAGGGGGAGGG - Intergenic
998535498 5:142926605-142926627 ACTCAGGAGGAGAAAGGAAATGG + Intronic
998809371 5:145950640-145950662 AAGAAGGAGGAGAAAAGGGAGGG + Intronic
999139786 5:149351852-149351874 AATGGGGATGAGAAAGGGGTGGG - Exonic
999149512 5:149417405-149417427 AGAGAGGAAGAGAAAGGGAAAGG - Intergenic
999309417 5:150542319-150542341 ACTGAGGAGGAGGTAGGGCAGGG + Intronic
999324296 5:150633684-150633706 ACTGAGGCAGAGAAAGGGCAAGG - Intronic
999551018 5:152687249-152687271 AGTCAGGTTGAGAAAGGGGATGG + Intergenic
999885030 5:155912799-155912821 ATTTAGGAAGAGAATTGGGATGG - Intronic
999993882 5:157073311-157073333 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1000113844 5:158135133-158135155 AATCTGGAGGAGAGAGGGGATGG + Intergenic
1000113849 5:158135152-158135174 ATGGGGCAGGAGAAAGGAGATGG + Intergenic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000113869 5:158135209-158135231 ATGGGGCAGGAGAAAGGGGATGG + Intergenic
1000152148 5:158513834-158513856 AACGAGGAGGAGAAACAGGAGGG + Intergenic
1000185131 5:158851542-158851564 AGAGGGGAGGAGAGAGGGGAGGG + Intronic
1000717054 5:164657720-164657742 AATGAGGAGGAGAGAGGAGAGGG - Intergenic
1000990682 5:167908469-167908491 AGAGAGGAGAAGAGAGGGGAGGG - Intronic
1000990699 5:167908516-167908538 AGAGAGGAGAAGAGAGGGGAGGG - Intronic
1001044666 5:168362751-168362773 ATGGAGGTGAAGGAAGGGGATGG + Intronic
1001087887 5:168714756-168714778 GAAGGGGAGGAGAAAGGGGAAGG - Intronic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1001333924 5:170782671-170782693 ATGGAGGGGCAGGAAGGGGAGGG - Exonic
1001570199 5:172725774-172725796 AAAAAGGAGGAGAAAGGGGTAGG + Intergenic
1001621816 5:173093113-173093135 ATTTAGGAGCAGGGAGGGGAAGG + Intronic
1001959389 5:175871282-175871304 AAGGTGGAGGAGAGAGGGGAGGG + Intronic
1002423058 5:179159905-179159927 ATTGTGGAGGAAAAAAGGAAGGG - Intronic
1002742620 5:181444741-181444763 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1002742635 5:181444790-181444812 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1003406748 6:5832545-5832567 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1003611113 6:7615812-7615834 TTTGAGCAGGTGAGAGGGGAGGG - Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004000623 6:11593812-11593834 ATTAAGAAGGAGAAATGGGCCGG - Intergenic
1004138783 6:12994631-12994653 ATGGAGGAGGAAAAGGGGAATGG + Intronic
1004815976 6:19312183-19312205 GAAGAGGAGGAGAAACGGGAAGG - Intergenic
1004818354 6:19337080-19337102 AGTGAGGAAGAGAGAGAGGAAGG + Intergenic
1004919982 6:20367228-20367250 ATTGAGGAGAAGAGGAGGGAGGG + Intergenic
1005033021 6:21529082-21529104 ATTGAAAAGGAGAAAGAAGAAGG - Intergenic
1005390769 6:25330907-25330929 TTTGAGGAGGAGGGAGGAGAAGG + Intronic
1005768946 6:29045271-29045293 GTAGAGGAGGAGAAGGAGGAGGG + Intergenic
1005874351 6:29999784-29999806 ATTGAGGAGCAGGAGGGTGAAGG + Intergenic
1006265791 6:32922168-32922190 AGTGAGGAGGATAAAGGGATGGG + Intergenic
1006278707 6:33029016-33029038 ATGGAGAAGGAGAGAGGGGGAGG - Intergenic
1006303750 6:33207333-33207355 GAAGAGGAGGAGGAAGGGGAGGG + Intergenic
1006652437 6:35562814-35562836 CTGGAGAAGGAGAAAGGGAAGGG + Intergenic
1006761285 6:36463881-36463903 ATTGAGAGGGAAAAAGGGGAAGG + Intronic
1006868994 6:37233228-37233250 GTTGAGGATGAGCAAGAGGAAGG - Intronic
1006888485 6:37402445-37402467 GGTAAGGAGCAGAAAGGGGAAGG - Intergenic
1007134478 6:39507952-39507974 GAGGAGGAGGAGGAAGGGGAAGG - Intronic
1007342773 6:41202043-41202065 ATTGAGCAGGAGGAAGTGGAGGG - Intergenic
1007765717 6:44158705-44158727 ACTGAGAAGGAGAAAAGGGAAGG + Intergenic
1007849932 6:44793199-44793221 ATTGAGGATGAAAAAGGAGGGGG + Intergenic
1007919766 6:45596121-45596143 AGTGAGGAGGAGAAAGGAAAGGG + Intronic
1007946506 6:45832035-45832057 ATAGGGGAGGAGAAAGAGGGAGG - Intergenic
1008099528 6:47376517-47376539 AGAGAGGAGTAGAAAGGGCATGG - Intergenic
1008124048 6:47648946-47648968 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1008253515 6:49269200-49269222 ATTGAAGATGTGAAAGGGAAAGG - Intergenic
1008296750 6:49787294-49787316 AGTGAGGAGAAGAAAGGGGCGGG - Intergenic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1008585992 6:52949964-52949986 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
1008853186 6:56049617-56049639 ATTGAGGGGCAAAAAGGAGAGGG - Intergenic
1009056785 6:58345908-58345930 ACTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009397893 6:63222806-63222828 AATGGGGATGAGAAAGGGGGTGG - Intergenic
1009564455 6:65294148-65294170 ATAGAGGAAGAGAAGGGGGCTGG + Intronic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1009859143 6:69303420-69303442 GCTGAGGAGGAGAAAGAAGAGGG - Intronic
1010474939 6:76275783-76275805 ATGGAGGAGGGGAAAGGGAAAGG - Intergenic
1010801060 6:80176168-80176190 TTTAAGGAGGGGAAAGGAGAAGG + Intronic
1011109904 6:83826182-83826204 TTTGAGGAGGCCAAAGTGGAAGG + Intergenic
1011414281 6:87101354-87101376 AAGGAGGCAGAGAAAGGGGAGGG - Intergenic
1011632309 6:89339492-89339514 ATGGGGGAGGAGAGAGGGGAGGG + Intronic
1011712823 6:90071946-90071968 ACTGAGGAGGAGGAAGAAGAGGG + Intronic
1012708996 6:102573522-102573544 TTCGAGGAGGAGAAAGAAGAGGG - Intergenic
1013834994 6:114324051-114324073 ATTCAAGAGGAGGAAGGTGAAGG + Intronic
1013837115 6:114345707-114345729 ATTTGGGAGGAGAAGGTGGAAGG + Intergenic
1014344799 6:120254614-120254636 AAAGAGGAGGAGATGGGGGAGGG + Intergenic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1014796504 6:125731327-125731349 GGGGAGGAGGAGAAATGGGAAGG - Intergenic
1014881081 6:126725400-126725422 ATAAAGGAGGAGAAAGGGGCAGG + Intergenic
1014933245 6:127358543-127358565 ATAGAGGAAGAGAAAGAGAAAGG - Intergenic
1014997520 6:128168712-128168734 ACTGAGGAGGTGGCAGGGGATGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015292171 6:131549700-131549722 GGGGAGGAGGAGAAAGGGAAAGG - Intergenic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015481054 6:133710264-133710286 ATGGAGGAAGAGAGAAGGGAAGG + Intergenic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1016068100 6:139704765-139704787 GTGGAGGAGGTCAAAGGGGAAGG - Intergenic
1016084385 6:139894818-139894840 ATTGGGGAGGGGAATGGTGAGGG + Intergenic
1016326810 6:142912420-142912442 TGTGATGAGGAGAAGGGGGAAGG - Intronic
1017190843 6:151651060-151651082 AAGGAGGAGGAGAAAGAGAATGG - Intergenic
1017328802 6:153171724-153171746 ATCGAGGATGAGAAAGAAGAAGG + Intergenic
1017339615 6:153305369-153305391 AAGGAGGAGGAGAAGGGGAAGGG - Intergenic
1017390530 6:153934205-153934227 ATTGAGTATTAGACAGGGGAAGG - Intergenic
1017847413 6:158271346-158271368 GTTGATGAGGAGGAAGGGCAAGG + Intronic
1018038080 6:159898665-159898687 AGGGAGGAGGAGGAAGAGGAAGG - Intergenic
1018206983 6:161445433-161445455 CATGTGTAGGAGAAAGGGGAGGG - Intronic
1018247695 6:161838607-161838629 ATTAAGGATGAGGAAGAGGAAGG - Intronic
1018861770 6:167715652-167715674 GTGGAGGAGGAGGAAGAGGAGGG + Intergenic
1018940309 6:168305099-168305121 ATTGAGGAAGAGAGAGAGGATGG + Intronic
1018961008 6:168448483-168448505 GATGAGGAGGAGGACGGGGATGG + Intronic
1019247755 6:170720480-170720502 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019247770 6:170720529-170720551 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019854767 7:3593687-3593709 AGTGAGCAGGAGGAAGGGAAGGG - Intronic
1020084444 7:5303002-5303024 ACTGAGGTGGGGACAGGGGAGGG - Exonic
1020462067 7:8437235-8437257 ATTGAAGATGGGAAATGGGAAGG - Intronic
1020750441 7:12134211-12134233 TATGAGCAGGAGAAAGGGGTTGG + Intergenic
1020898902 7:13977639-13977661 ACTTAGGAGGAGAAATGGAAGGG + Intronic
1021171182 7:17399543-17399565 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1021189533 7:17603558-17603580 ATGGAGGAGGAGAAAGGGAAAGG + Intergenic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021602008 7:22373485-22373507 TTTCAGGAAGAAAAAGGGGAGGG - Intergenic
1021697159 7:23286448-23286470 AATGAGCAGGAGACGGGGGAGGG - Intergenic
1022175626 7:27869506-27869528 CATGGGGAGGAGAAGGGGGATGG - Intronic
1022209184 7:28191961-28191983 GCTGGGGAGGAAAAAGGGGAGGG + Intergenic
1022510649 7:30933075-30933097 ACTGAGGCCGAGAAAGGAGAAGG - Intergenic
1022552933 7:31258995-31259017 AGGGATGAGGAGAAAAGGGATGG - Intergenic
1022665930 7:32410442-32410464 GTGGAGGAGGAGGAAGAGGAAGG + Intergenic
1022758058 7:33315610-33315632 AATGGGGAGGATGAAGGGGAGGG + Intronic
1022806686 7:33829579-33829601 ATGGAGAAGGAAAAAGGAGAAGG - Intergenic
1022873885 7:34507904-34507926 GTAGAGAAGGGGAAAGGGGAGGG - Intergenic
1022921819 7:35023350-35023372 CTTGGGGAGGAGAAAGAGAAAGG - Intronic
1023343571 7:39248419-39248441 GCTGAGGAGGGGAAAGGCGATGG - Intronic
1023974929 7:45021701-45021723 GCTGAGGAGGAGAATGGGGCAGG + Intronic
1024130888 7:46352149-46352171 AGAGAGAAAGAGAAAGGGGAGGG + Intergenic
1024171405 7:46791300-46791322 ATGGAGGGGCAGCAAGGGGAAGG + Intergenic
1024450054 7:49529131-49529153 ACTGAGGAGGAGAAAAGAGAGGG + Intergenic
1024736242 7:52307879-52307901 ATTAATGAGGAGAAAGTGGGTGG - Intergenic
1024963013 7:54997132-54997154 ACTCAGCAGGGGAAAGGGGAAGG - Intergenic
1026138065 7:67680731-67680753 ATTGAGTGGGTGAAAGGGAAGGG + Intergenic
1026157867 7:67843053-67843075 AATGAGAAGGACAAAGGAGAAGG + Intergenic
1026254221 7:68696936-68696958 AATGAGGAGGAGACAGGGCATGG - Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026364948 7:69638806-69638828 ATTGAGGAGGAGCAAAGCAAAGG + Intronic
1026638649 7:72105800-72105822 AGGGAGGAGGAGGAGGGGGAGGG + Intronic
1026998303 7:74633997-74634019 ATTAAGCAGGAGAGAGGAGAGGG - Intergenic
1027132246 7:75599325-75599347 CTGGAGGAGGAGAAAGGGGCGGG - Intronic
1027261363 7:76467007-76467029 ATTCAGGAGGCTGAAGGGGATGG - Intronic
1027312746 7:76965116-76965138 ATTCAGGAGGCTGAAGGGGATGG - Intergenic
1027332029 7:77107248-77107270 AATGAGAAGGAGAAGGGGAAGGG - Intergenic
1027645318 7:80790330-80790352 AAGGAGGAGGAGGAAGGAGAAGG + Intronic
1027711139 7:81602759-81602781 ATTTAGGAGGAAGAAGAGGAGGG + Intergenic
1027969910 7:85066292-85066314 AGGGAGGAGGAGAGAAGGGATGG + Intronic
1028070828 7:86448038-86448060 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1028433527 7:90775652-90775674 GAGGAGGAGGAGAAAGGGGGAGG - Intronic
1028503981 7:91551348-91551370 AATGAGGAGTAAAAATGGGAAGG - Intergenic
1028759898 7:94484114-94484136 ATTAAAGAGGAGAGAGGAGAAGG - Intergenic
1028807395 7:95044275-95044297 GTAGAGGAGGAGAAAGTAGAGGG - Intronic
1028888350 7:95959415-95959437 GTTAAGGAGGAGAACGGGGAAGG + Intronic
1029026155 7:97418833-97418855 ATTGGGGAGGTGTAAGGGGTGGG + Intergenic
1029027180 7:97429174-97429196 AATGAGTAGGAGAAAGGGCAAGG + Intergenic
1029046472 7:97634603-97634625 TATGGGGAGGAGAAAGGGGAGGG + Intergenic
1029403745 7:100360709-100360731 AGTGAGGTGGAGAGAGGGAAAGG + Intronic
1029413521 7:100429765-100429787 GTGGCGGAGGAGAAAGGGGTCGG + Exonic
1029783746 7:102764077-102764099 AATGAGAAGGAGAAGGGGAAGGG + Intronic
1029920459 7:104257098-104257120 CTTCAGGAGGAGAAACGGAATGG - Intergenic
1029982291 7:104890391-104890413 AATGCGGGGGAGGAAGGGGATGG - Intronic
1030034449 7:105396695-105396717 AAGGAGGAGGAGGAAGGGGAGGG + Intronic
1030049716 7:105527166-105527188 AGTTTGGTGGAGAAAGGGGAAGG - Intergenic
1030105363 7:105982549-105982571 ACTGAGGGGGAGAAGGGGAAAGG - Intronic
1030214897 7:107034620-107034642 ATTTAGGAGCAGAAAAGAGAAGG - Intergenic
1030299164 7:107957901-107957923 TTTGAGAATGAGAAAGGGTATGG - Intronic
1030558540 7:111056846-111056868 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
1030638236 7:111974414-111974436 ATTGAGGAGAAGCAGTGGGAAGG + Intronic
1031007655 7:116492259-116492281 AAGGAGCAGGAGAAAAGGGAAGG + Intronic
1031165927 7:118226636-118226658 ATGGAGGAGGAGGAAGAAGAGGG + Intronic
1031443116 7:121817382-121817404 ATTGGAGAGGAGAAATAGGATGG + Intergenic
1031508924 7:122624678-122624700 TTTGAGTGGGAGAAAAGGGAGGG + Intronic
1031766714 7:125787266-125787288 ATGGAGGAGGAGTGAGAGGAAGG + Intergenic
1031854629 7:126907299-126907321 AGGGAGGAGGAGGAAGAGGAAGG + Intronic
1031907161 7:127473282-127473304 AATAAGGAGGAGGAAGTGGAAGG + Intergenic
1032011176 7:128349196-128349218 AGTGGGGAAGAGAAATGGGAGGG - Intergenic
1032309777 7:130774362-130774384 GAGGAGGAGGAGAAAAGGGATGG - Intergenic
1032444954 7:131974296-131974318 CTTGAGTAGGAGAGAAGGGATGG - Intergenic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1032523391 7:132562461-132562483 AAGGAGGAGGAGAAAGGAGGAGG - Intronic
1032523810 7:132564209-132564231 GAGGAGGAGGAGAAAGGAGAAGG - Intronic
1032542413 7:132714146-132714168 TTTGAGGGGAGGAAAGGGGATGG + Intronic
1032634568 7:133692794-133692816 AAGGAGGAGGAGAAAGGTTAAGG - Intronic
1032878869 7:136067126-136067148 AAAGAGGAAGAGAAAGGGGGTGG - Intergenic
1033000831 7:137502541-137502563 GGAGAGGAGGAGAAAGGGGAAGG + Intronic
1033350675 7:140559406-140559428 TTTCAGGATGAGAACGGGGAAGG + Intronic
1033446259 7:141424938-141424960 ACTGAGGAATAGAAAGGGCATGG + Intronic
1033472919 7:141665327-141665349 ATAGAGGAGGTGAGCGGGGAGGG + Intronic
1033819336 7:145115209-145115231 ATTAAGGAGGGGAAAGATGATGG - Intergenic
1034086620 7:148328214-148328236 TTTCAGGTGGAGAGAGGGGAAGG + Intronic
1034163617 7:149009865-149009887 CTTGAGGAGGAGAATGGAGAGGG - Intronic
1034190090 7:149207323-149207345 AGTGAGGAGGAGGGAGGGAAAGG - Intronic
1034411709 7:150945552-150945574 ATGGAGGAGGAGGAAGGGGAGGG + Intronic
1034450546 7:151134930-151134952 ATAGGGGAGGTGGAAGGGGACGG + Intronic
1034823580 7:154239400-154239422 GATGAGGAGGAGGAAGAGGAAGG - Intronic
1034922092 7:155091660-155091682 ATTGAGGCTGAGAAGGGGGAAGG + Intergenic
1035023219 7:155810646-155810668 CTTGAGGCCGAGAAAGGCGAGGG - Intronic
1035160337 7:156945188-156945210 TTGGAGGAGGAGGAGGGGGAGGG - Intergenic
1035287720 7:157816854-157816876 AAAGAGGAGGAGAAAGGGAGGGG - Intronic
1035477498 7:159153634-159153656 GAGGAGGAGGGGAAAGGGGAGGG - Intergenic
1035500348 8:87334-87356 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500366 8:87407-87429 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500381 8:87456-87478 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035813066 8:2508714-2508736 AGTGAGGAAGGGAAAGGGGAAGG + Intergenic
1036016705 8:4793456-4793478 GGTGGGGAGGAGAGAGGGGATGG - Intronic
1036122232 8:6031066-6031088 ATTGAGCAGGTTAATGGGGATGG - Intergenic
1036295213 8:7529236-7529258 AAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1036327357 8:7791782-7791804 AAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1036444588 8:8810490-8810512 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
1036538695 8:9680024-9680046 ATTAAGGAAGAGAAGGAGGAGGG + Intronic
1036767687 8:11559084-11559106 ATTGAATAGGAGACAGCGGAGGG - Intronic
1036985461 8:13523955-13523977 ATTAAGTAGGAGAGAGGGGATGG + Intergenic
1037434407 8:18847418-18847440 ATTAAGGCAGAGCAAGGGGAGGG - Intronic
1037497873 8:19458051-19458073 CTTGAGGAGGAGAGAGGAGCTGG - Intronic
1037933664 8:22899673-22899695 GGTGAGGAGGAGAGAGAGGAGGG + Intronic
1038133129 8:24756383-24756405 AGAGAAGAGGAGAAAGGGGAAGG + Intergenic
1038174559 8:25168529-25168551 GTGGAGGAGAAGAAAGGGAAAGG + Intergenic
1038238383 8:25784446-25784468 ATGGAGGAGGAGGAAGGAGGTGG - Intergenic
1038278710 8:26143336-26143358 ATTGATGTGGAGAATGGTGATGG - Intergenic
1038487677 8:27948441-27948463 ATGGAAGAGAAGATAGGGGAAGG - Intronic
1038591470 8:28842207-28842229 ACTGAGGAGGAGGAAGACGAGGG + Intronic
1038882225 8:31627655-31627677 GAGGAGGAGGAGGAAGGGGAAGG - Intergenic
1038902664 8:31861472-31861494 ATTGAAGAGGAACAAGGAGAAGG + Intronic
1039153934 8:34534339-34534361 CTTGATGAGGAGAGAGGAGAAGG - Intergenic
1039166102 8:34681671-34681693 GGGGAGGAGGAGAAAGGGGGAGG + Intergenic
1039176899 8:34818614-34818636 GAAGAGGAGGAGGAAGGGGAGGG - Intergenic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1039408032 8:37329388-37329410 ATTGAGGGTAAGAAAAGGGATGG - Intergenic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1039560390 8:38507939-38507961 AGAGAGGAGAAGAGAGGGGAAGG - Intergenic
1041284841 8:56249564-56249586 GAGGAGGAGGAGGAAGGGGAAGG - Intergenic
1041320987 8:56612271-56612293 AGTGTGGAGGACACAGGGGATGG + Intergenic
1042130429 8:65582486-65582508 AAGAAGGAGGAGAAGGGGGAGGG + Intergenic
1042444580 8:68869223-68869245 AAAGAAGTGGAGAAAGGGGAAGG - Intergenic
1042593187 8:70418099-70418121 ATTAAGAAGTAGAAATGGGAGGG - Intergenic
1043082708 8:75785374-75785396 TAAGAGGAGGAGAAAGAGGAGGG - Intergenic
1043746925 8:83886131-83886153 ACTGAGGAGGAGGAAAAGGAAGG + Intergenic
1043783809 8:84371090-84371112 CGTGAGGAGGAGCAAGAGGATGG - Intronic
1043834056 8:85026211-85026233 ATTGGGGAGGAAGAAAGGGAGGG - Intergenic
1044874728 8:96653839-96653861 AGCGAGGAGGTGAAAGGCGAGGG + Intronic
1044878997 8:96702766-96702788 TTACAGAAGGAGAAAGGGGAGGG - Intronic
1044964502 8:97562110-97562132 AGGAAGGAGGAGAAAGGAGAAGG + Intergenic
1045149629 8:99389653-99389675 ACTGAGGAGGAGGAAGAGGAGGG + Intronic
1045294883 8:100864023-100864045 ATGGAGGATGAGGAAGAGGAAGG - Intergenic
1045367637 8:101492133-101492155 GTTGAAGAGAAGAAAGGGGTTGG - Intergenic
1046058544 8:109108253-109108275 ATGGAGAAGGAGAGAGGTGATGG - Intronic
1046173892 8:110549463-110549485 ATTCTGGAAGATAAAGGGGAGGG + Intergenic
1046832893 8:118765748-118765770 ATTGAGTTGGAGAAAGAAGAGGG + Intergenic
1046966832 8:120176863-120176885 AATAAGGAGGAGAAAGTGGGAGG - Intronic
1047250928 8:123181790-123181812 AGTGGGGAAGAGAAACGGGAAGG - Intronic
1048250966 8:132866611-132866633 AAGGAGAAGGAGAAAGGGTAGGG + Intergenic
1048563238 8:135565275-135565297 AATGAAGAGGTGAGAGGGGAGGG + Intronic
1048613533 8:136049910-136049932 ATGGTGGAAGACAAAGGGGAAGG - Intergenic
1048696272 8:137031659-137031681 AATTAGGAGGAGAAGGGGGAGGG - Intergenic
1048755720 8:137735801-137735823 ATTGAATAGGAGATAGGGAATGG - Intergenic
1048948334 8:139471552-139471574 ATGGAGTAGAAGAAAGGGGGAGG + Intergenic
1049121992 8:140747559-140747581 CGGGAGGAGGAGGAAGGGGAGGG + Intronic
1049309830 8:141927983-141928005 ACTGAGGACGGCAAAGGGGAGGG - Intergenic
1049397514 8:142408158-142408180 AATGAGGAGGAGCCAGGAGATGG - Intergenic
1049397707 8:142409282-142409304 AAAGAGAAGGAGAGAGGGGAAGG + Intergenic
1049566505 8:143341854-143341876 AAGGGGGAGGAGAAAGAGGAAGG - Intronic
1049654777 8:143792701-143792723 ATGCAGGAGGAGGAAGGTGAGGG - Exonic
1049729742 8:144170165-144170187 AATGAGGAGGAGAGAGAGGAGGG + Intronic
1049737701 8:144218681-144218703 AGAGGGGAGGAGAGAGGGGAGGG - Intronic
1049871475 8:144981449-144981471 ATTCAGGAGGCCAAAGTGGATGG + Intergenic
1050087471 9:1980900-1980922 ATTGAGTAGGAGGCAGGGCAGGG - Intergenic
1050172444 9:2836029-2836051 ATTGGGGAGGAGGAAGATGAGGG + Intronic
1050779946 9:9320800-9320822 ATTTGGGAGGAGTAATGGGAGGG + Intronic
1050930979 9:11326292-11326314 AATGAAGAGGTGAAAGTGGAAGG - Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051207109 9:14699558-14699580 ATGGAGGAGGATATAGTGGAGGG + Intergenic
1051425514 9:16927897-16927919 GTTGGGAAGGCGAAAGGGGAGGG + Intergenic
1051497872 9:17745107-17745129 ATTGAAGATGAGAAAAGAGAGGG - Intronic
1051522806 9:18009159-18009181 ATTGGGGAGGAGAAAGAGAAAGG - Intergenic
1051541799 9:18228318-18228340 ATTGAGGAGGAGGAAAGGTGGGG + Intergenic
1051567971 9:18522143-18522165 AGGGAGGAGGAGAGAGGGGGTGG + Intronic
1051586283 9:18730565-18730587 AATGAAGAAGAGAAAGGGAATGG - Intronic
1051840461 9:21391957-21391979 AAGCAGGAGGAGGAAGGGGAGGG + Intergenic
1051860114 9:21615138-21615160 ATAGAGGAAGAGGAGGGGGAGGG + Intergenic
1052177591 9:25482819-25482841 AATGGGGAGGTGAGAGGGGAGGG + Intergenic
1052520463 9:29541490-29541512 AGAGAGAAGGAGAAAAGGGAGGG - Intergenic
1052988956 9:34507523-34507545 GAAGAGGAGGAGAAAGAGGAGGG + Intronic
1053041537 9:34877866-34877888 AGGGAGGGGGAGATAGGGGAGGG - Intergenic
1053352708 9:37424136-37424158 ACTGAGCAGGAGAAGGTGGAAGG + Intronic
1053688066 9:40561440-40561462 AGTCAGGAGGAGAAGGGGAAAGG + Intergenic
1053688309 9:40565537-40565559 AGTCAGGAGGAGAAGGGGAAAGG + Intergenic
1053939673 9:43221014-43221036 AGTCAGGAGGAGAAGGGGAAAGG + Intergenic
1054275721 9:63065517-63065539 AGTCAGGAGGAGAAGGGGAAAGG - Intergenic
1054299548 9:63366449-63366471 AGTCAGGAGGAGAAGGGGAAAGG + Intergenic
1054399112 9:64699413-64699435 AGTCAGGAGGAGAAGGGGAAAGG + Intergenic
1054432690 9:65183685-65183707 AGTCAGGAGGAGAAGGGGAAAGG + Intergenic
1054497695 9:65837991-65838013 AGTCAGGAGGAGAAGGGGAAAGG - Intergenic
1055393811 9:75851960-75851982 GTTGGGGGGAAGAAAGGGGAGGG - Intergenic
1055423173 9:76164986-76165008 ATTGAGAAGGAGAAAGGAACTGG - Intronic
1055452967 9:76447346-76447368 ATTAAGGAGGCTAAAGTGGAAGG - Intronic
1055681565 9:78721048-78721070 GCTGAGGAGGAGGATGGGGAGGG + Intergenic
1055737482 9:79347227-79347249 ATTGAGGAGGAGAGAGGGGATGG - Intergenic
1056066647 9:82942402-82942424 TTTTAAGAGGAGAAAGAGGATGG + Intergenic
1056112283 9:83407917-83407939 AAAGAGAAAGAGAAAGGGGAGGG - Intronic
1056145741 9:83727544-83727566 AATTAGGAAGAGAAAGGAGAAGG - Intergenic
1056512828 9:87321869-87321891 ATGGAGTAGGAGGAAGGGGCTGG - Intergenic
1056882333 9:90408202-90408224 TTTGAGGGGTAGAAAGAGGAAGG + Intergenic
1056905227 9:90641658-90641680 TTTGAGGAGGTGGAGGGGGAGGG - Intronic
1057012412 9:91616883-91616905 ATTGAAGCTCAGAAAGGGGAAGG + Intronic
1057226516 9:93296054-93296076 ATAGAGGGGGAGGAAGGTGAGGG - Intronic
1057226526 9:93296081-93296103 ATAGAGGGGGAGGAAGGTGAGGG - Intronic
1057226600 9:93296288-93296310 ATGGAGGGGGAGGAAGGTGAGGG - Intronic
1057226630 9:93296371-93296393 ATGGAGGGGGAGGAAGGTGAGGG - Intronic
1057226641 9:93296398-93296420 ATGGAGGGGGAGGAAGGTGAGGG - Intronic
1057226652 9:93296425-93296447 ATGGAGAAGGAGGAAGGTGAGGG - Intronic
1057226761 9:93296771-93296793 ATGGAGGGGGAGGAAGGTGAGGG - Intronic
1057430018 9:94985143-94985165 AGTGAGGAGGAGAGAGAAGATGG + Intronic
1057726679 9:97573011-97573033 ACTGAGGATGAGAGAAGGGATGG + Intronic
1057936246 9:99241530-99241552 ATTGAGGCCCAGAGAGGGGAAGG + Intergenic
1057936392 9:99242931-99242953 AATGAGGACCAGAAAGGTGAAGG - Intergenic
1057937664 9:99254237-99254259 AACTAGGAGGAGAATGGGGAGGG - Intergenic
1058051036 9:100406835-100406857 AAAGAGGTGGAGAAAGGTGATGG + Intergenic
1058254819 9:102749040-102749062 ATTGAGGAGGGTAAAGGCCATGG + Intergenic
1058352889 9:104047446-104047468 GGTGAGGAAGAGAGAGGGGAGGG + Intergenic
1058561441 9:106233168-106233190 AAGAAGGAGGAGAAAGGAGAAGG - Intergenic
1058875284 9:109238770-109238792 ATTGAGCAGGAGTTAGGGGAAGG + Intronic
1059072427 9:111152831-111152853 AGGGAGGAGGAGGAAGAGGAAGG + Intergenic
1059129625 9:111732763-111732785 AGTGAGGAGGAGAGGTGGGATGG + Intronic
1059423214 9:114205621-114205643 ATGGAACAGGAGGAAGGGGAGGG - Intronic
1059632761 9:116142075-116142097 AAAGAGGAAGGGAAAGGGGAAGG + Intergenic
1059705983 9:116823711-116823733 ACTGAGGATCAGAAAGGTGAGGG + Intronic
1059773144 9:117446819-117446841 ACTGAGGACCAGAAAGGGAAAGG - Intergenic
1059835514 9:118147799-118147821 ATTGAGGTGGAGGTGGGGGAGGG - Intergenic
1060447838 9:123707941-123707963 CTTGAGTAGACGAAAGGGGATGG + Intronic
1060753838 9:126194556-126194578 AGTGAGGAAGGGAGAGGGGAAGG - Intergenic
1060765795 9:126294348-126294370 GTAGAGGAGGAGGAAAGGGAAGG + Intergenic
1060819340 9:126652283-126652305 TCTGAGGAGGAGAAGGGGGGGGG + Intronic
1060978376 9:127778716-127778738 AGCGAGTAAGAGAAAGGGGAAGG - Exonic
1061045498 9:128162871-128162893 ATCCAGGAGGAGAGAAGGGAAGG + Intronic
1061312703 9:129774667-129774689 AGTACGGAGAAGAAAGGGGAGGG + Intergenic
1061320942 9:129829034-129829056 ACTGAGGCTTAGAAAGGGGAAGG + Intronic
1061331316 9:129895924-129895946 ATAGAGGAAGACAAAGGCGATGG - Exonic
1061625969 9:131840867-131840889 AATGAGGAAGGGAAACGGGAAGG + Intergenic
1062115051 9:134804020-134804042 ATTGAAGAGCTGAAAGGGAAGGG - Intronic
1062182093 9:135196296-135196318 AACGAGGAGGGGAAATGGGAAGG - Intergenic
1062182132 9:135196408-135196430 AACGAGGAGGGGAAATGGGAAGG - Intergenic
1062182162 9:135196496-135196518 AATGGGAAGGAGAAATGGGAAGG - Intergenic
1062254432 9:135614409-135614431 ATTGAGGAGGTGCAGGGGGTGGG + Intergenic
1062319901 9:135985810-135985832 ATTCAGGAGGAGCAGGAGGAAGG - Intergenic
1062469704 9:136697007-136697029 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1062638361 9:137503432-137503454 AATGAGGAGGGGGAAGGAGAAGG + Intronic
1062638387 9:137503508-137503530 AAGGAGGAGGAGGAAGGAGAAGG + Intronic
1203608526 Un_KI270748v1:75960-75982 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1185459858 X:328923-328945 AGAGAGGAGGAGGAGGGGGAGGG - Intergenic
1185662053 X:1735650-1735672 AAAGAGGAGGAGGAGGGGGAGGG - Intergenic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185701260 X:2232133-2232155 AGAGAGGAGGAGAAAGAGGAAGG - Intronic
1185819087 X:3184541-3184563 ATAGAGGTGGAGAGAAGGGAGGG + Intergenic
1185872502 X:3675678-3675700 AGGGAGGAGGAGAAAGGAGGAGG - Intronic
1185937874 X:4279541-4279563 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186124712 X:6400912-6400934 GAGGAGGAGGAGGAAGGGGAGGG - Intergenic
1186125547 X:6409943-6409965 CATGAGGAGGAGAAAGAGGTAGG + Intergenic
1186224160 X:7379326-7379348 ATTGAGGTGGAGAGTGGGGAGGG + Intergenic
1186264576 X:7818595-7818617 AAGGAGGAGGAGAAAAGGAAGGG + Intergenic
1186264610 X:7818688-7818710 AGGGAAGAGGAGGAAGGGGAGGG + Intergenic
1186471160 X:9823075-9823097 AAGGAGGAGGAGAAGGGAGAAGG - Intronic
1186565338 X:10656336-10656358 ATTGAAGAGGAGGGAGGAGAAGG - Intronic
1187283289 X:17879371-17879393 AGTGAGGACAAGAAAGGAGAAGG - Intergenic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188005143 X:25011891-25011913 AGTGAGGGGGAGAAAGGGATCGG - Intronic
1188142240 X:26565766-26565788 TTGGAGGTAGAGAAAGGGGAGGG + Intergenic
1188209313 X:27401421-27401443 ATAGAGGAAGAGGAAGGAGAAGG + Intergenic
1189207259 X:39252563-39252585 GAAGAGGAGGAGAAAGGAGAAGG + Intergenic
1189230769 X:39450895-39450917 ATGGAGGAGGGGAGAGTGGAGGG - Intergenic
1189365777 X:40387474-40387496 ATTGAGGAACAGGAAGGAGATGG - Intergenic
1189497345 X:41521045-41521067 AGTGTGGAGGACCAAGGGGACGG - Intronic
1189534599 X:41923507-41923529 CGGGAGGAGGAGAAAGAGGAGGG - Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190073838 X:47300976-47300998 GAGGAGGAGGAAAAAGGGGAAGG + Intergenic
1190198072 X:48336701-48336723 AGGGAGGGGGAGGAAGGGGAGGG + Intergenic
1190720006 X:53139862-53139884 AAGGGGGAGGAGGAAGGGGAAGG + Intergenic
1190726092 X:53191868-53191890 CTTGAGGAGGATAAACTGGAGGG + Intronic
1190795039 X:53733056-53733078 ACTGAGGAGGAGGAAGAAGAGGG - Intergenic
1191778351 X:64842972-64842994 AGTGAGGGGGTGAAAGGGGGAGG - Intergenic
1191841167 X:65514383-65514405 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
1191883301 X:65863652-65863674 ATTGAGGTTTAGAAAGAGGATGG - Intergenic
1192003187 X:67178929-67178951 AATGAGGAGGACACATGGGAGGG + Intergenic
1192100201 X:68256153-68256175 TTTGATCAGGAGCAAGGGGAAGG + Intronic
1192139248 X:68633552-68633574 AGTAGTGAGGAGAAAGGGGAAGG + Intergenic
1192168417 X:68840220-68840242 TCTGAGGAAGGGAAAGGGGAAGG - Exonic
1192353161 X:70373295-70373317 AAGGAGGGGGAGAACGGGGAGGG + Intronic
1192602354 X:72478446-72478468 ATGGAGGAATAGAGAGGGGAGGG - Intronic
1192797459 X:74435887-74435909 TTTGAAGTTGAGAAAGGGGAAGG - Intronic
1192848976 X:74933587-74933609 AATGAGGGGGAGAGATGGGAAGG + Intergenic
1193846540 X:86479030-86479052 GTTGGGGAGCAGAAGGGGGATGG + Intronic
1194268082 X:91779301-91779323 ACCGAGGGGGAGAAAGGGGAAGG - Intronic
1194312594 X:92331349-92331371 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1194467818 X:94255340-94255362 ATTGCGGAGTAGCAAGGGCAGGG - Intergenic
1194864546 X:99049545-99049567 CATGAGCAGGAGAAAGGGAAGGG + Intergenic
1194944590 X:100051919-100051941 TTTGACGAGGTGAAAGAGGAAGG + Intergenic
1195002055 X:100651340-100651362 TTTGAGAACCAGAAAGGGGAGGG + Intronic
1195004823 X:100675530-100675552 ATTGGAGAGGAGAAAGAGGAAGG + Exonic
1195227133 X:102808478-102808500 ATTTAAGAGGAAAAAGAGGATGG - Intergenic
1195272010 X:103241661-103241683 GATGAGGAGGAGGAAGGAGATGG - Intergenic
1195676831 X:107513023-107513045 AGGGAGGAGGGGACAGGGGAGGG + Intergenic
1195696231 X:107669609-107669631 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1195789650 X:108569526-108569548 AAGGAAAAGGAGAAAGGGGAGGG - Intronic
1195873635 X:109514580-109514602 ACTGAGGAGGAGGAAGAGGAAGG + Intergenic
1195940504 X:110163758-110163780 GTTGAGTAGGGGAGAGGGGATGG + Intronic
1196050325 X:111297596-111297618 ACTGTGGAGGAGAAGGAGGAAGG + Exonic
1196237466 X:113299822-113299844 AGAGAGGAGGGGAGAGGGGAGGG - Intergenic
1196251550 X:113465958-113465980 GTTTGGGAAGAGAAAGGGGAGGG + Intergenic
1196351437 X:114735560-114735582 AATTAGGAAGAGAAAGAGGAAGG + Intronic
1196462215 X:115943003-115943025 ATTGGGGAGGAAAGAGGGGAAGG - Intergenic
1196908288 X:120460289-120460311 AACGAGGAGGAGGAAGAGGAGGG + Intronic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1197160121 X:123313547-123313569 AGTGAGAAGGAAAAGGGGGAAGG - Intronic
1197705312 X:129630473-129630495 ATTGAGGTACAGAATGGGGAGGG + Intergenic
1198932886 X:141879463-141879485 AGTGAGGAGGAAAAGGTGGAGGG + Intronic
1199288744 X:146082886-146082908 ATTCAGCAGGAGAGATGGGATGG - Intergenic
1199715748 X:150506330-150506352 GAGGAGGAGGAGGAAGGGGAGGG - Intronic
1199720442 X:150539666-150539688 ATTGGGGAGGAGAAAAGGCAAGG - Intergenic
1199818891 X:151424732-151424754 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1200585284 Y:5000222-5000244 ACAGAGGGGGAGAAAGGGGAAGG - Intronic
1200620857 Y:5445495-5445517 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1201222718 Y:11787788-11787810 GATTAGGATGAGAAAGGGGAAGG - Intergenic
1201300269 Y:12498827-12498849 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1201461693 Y:14232759-14232781 AGGGAGGAGGAGAAAGGAGGAGG - Intergenic
1201461744 Y:14233036-14233058 AATGAGGAGGAGGAGGGGGAGGG - Intergenic
1201474283 Y:14364080-14364102 AAGGAGGAGAAGAAAGGGGCAGG + Intergenic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic
1201607306 Y:15801111-15801133 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1201645533 Y:16225821-16225843 ACTGAGGAGGAAGAAGGGAAAGG + Intergenic
1201657280 Y:16359493-16359515 ACTGAGGAGGAAGAAGGGAAAGG - Intergenic
1201694818 Y:16813002-16813024 ATTTAGGAGGACAAAGAGGGAGG - Intergenic
1201721396 Y:17101688-17101710 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1201739703 Y:17310939-17310961 AAGGAGGAGGAGAAGGGGGGAGG - Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic