ID: 1168874071

View in Genome Browser
Species Human (GRCh38)
Location 20:1158435-1158457
Sequence TTGGGAATTTTCCAGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168874071_1168874078 17 Left 1168874071 20:1158435-1158457 CCAACCAGCTGGAAAATTCCCAA 0: 1
1: 0
2: 0
3: 26
4: 187
Right 1168874078 20:1158475-1158497 ATCTCTGACTCCCAGTCCTGAGG 0: 1
1: 0
2: 2
3: 37
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168874071 Original CRISPR TTGGGAATTTTCCAGCTGGT TGG (reversed) Intronic
900623884 1:3599419-3599441 CTGGTAATTCTCCAGTTGGTTGG - Intronic
901942056 1:12670260-12670282 TGGGGAATTTTCTAGTTGGATGG - Intergenic
903366850 1:22810602-22810624 TTGGGAGTTTCCCAGTGGGTGGG + Intronic
904808507 1:33148047-33148069 TGGGGAATTTTAGAGCTGGAAGG + Intronic
909452620 1:75815283-75815305 CAGGTAATTTTCCAGGTGGTAGG - Intronic
909578616 1:77205864-77205886 GTGGGAATTTTCCTACTTGTAGG - Intronic
914027509 1:143925629-143925651 AAGGGAATTGTTCAGCTGGTTGG - Intergenic
914908610 1:151767017-151767039 TTAGAATTTTTCCATCTGGTTGG + Intronic
917407200 1:174719823-174719845 TTGGGATTTTTGGAGGTGGTAGG + Intronic
919592052 1:199516486-199516508 TTGTTAATTTTCCAGCTGATGGG + Intergenic
920462977 1:206156524-206156546 AAGGGAATTGTTCAGCTGGTTGG - Intergenic
920801811 1:209195291-209195313 GTGGGCATTTTCCAGCTGATGGG + Intergenic
1063687426 10:8250712-8250734 TTGGGAATGTTGGAGCTGGTTGG - Intergenic
1066116152 10:32242146-32242168 TTGTGAATTTTCCAGCTTTTTGG + Intergenic
1069535201 10:69248036-69248058 ATGGGAATTTTCCAGAAGGAAGG + Intronic
1070559751 10:77557298-77557320 ATGGGCATTTTCCATCTGGGAGG + Intronic
1071143735 10:82542814-82542836 TTGGGAAATTTCCAGGTTGAAGG + Intronic
1071682645 10:87721947-87721969 TTGGGAAATTTCCTGTTGTTTGG - Intronic
1072017035 10:91358469-91358491 TTGAGAATTTTCCAGCCTTTAGG + Intergenic
1072152869 10:92697077-92697099 TTGGGAATTTGAGAGCTGGAAGG - Intergenic
1074259534 10:111838168-111838190 TTGGGAGTCTTCAAACTGGTTGG - Intergenic
1075193586 10:120334227-120334249 CTGGGAGTTTTCCAGATGGAGGG + Intergenic
1078079081 11:8191077-8191099 ATGGGAATTTTGGAGCTTGTTGG + Intergenic
1078303912 11:10162896-10162918 TTGGGAAATTTCCAGATGAAAGG - Intronic
1081971588 11:47202668-47202690 CTGGGAAATTTCCATCTAGTGGG + Intergenic
1083083062 11:60113511-60113533 TTGGGAGTCTTCCAGGTAGTAGG + Intergenic
1085972122 11:81605530-81605552 AGGAGAATCTTCCAGCTGGTGGG + Intergenic
1086213753 11:84352195-84352217 TTGGCACTTTTTCAGCTAGTAGG - Intronic
1086621040 11:88887193-88887215 ATGGCAATTTTCCTGCTGATGGG - Intronic
1087432384 11:98070084-98070106 TTGGGACTTTTGCAGCGGGGAGG - Intergenic
1088832233 11:113547303-113547325 TTGGGAATCTTCCCTGTGGTGGG - Intergenic
1089098038 11:115936056-115936078 TGGAGAATTTTCCATCTGGTAGG + Intergenic
1089129453 11:116200506-116200528 TGGGGAATTGTCCTGCTGGGAGG + Intergenic
1090541292 11:127708963-127708985 TTGGGCACTTTCCATGTGGTGGG + Intergenic
1091532916 12:1376689-1376711 TTGTGAAGATTCCAGATGGTTGG + Intronic
1095167126 12:38987186-38987208 ATGGGTATTCTCCAGCTGTTGGG - Intergenic
1095542973 12:43331830-43331852 CTGGGCTTTTTTCAGCTGGTAGG + Intergenic
1100384611 12:94094065-94094087 TTGGGAATTTCTAAGCTGGTAGG - Intergenic
1100787828 12:98097166-98097188 TTGGTACTTTTCTAGGTGGTAGG + Intergenic
1103041905 12:117702709-117702731 CTGGGAATATTCCAGCTTGGTGG - Intronic
1103203926 12:119113269-119113291 TTGGGTAATTTCCAGATGATTGG + Intronic
1105022344 12:132825417-132825439 TTGGGAGTGTTCAAGGTGGTGGG - Intronic
1105480418 13:20770535-20770557 TTGGAAATTTTCCGGCCTGTTGG - Intronic
1109793203 13:67276655-67276677 TTGTGAATTTTGTAGGTGGTAGG - Intergenic
1111818708 13:93187640-93187662 TTGGGAATTTTCCCTTTGGGGGG - Intergenic
1116384136 14:44310202-44310224 CTTGGAATTTTCCAGTTGATAGG + Intergenic
1116796541 14:49396940-49396962 CTGGGCTTTTTCCAGTTGGTAGG - Intergenic
1118981056 14:70717456-70717478 TTTGGAATTTGCCATCTAGTGGG - Intergenic
1120910508 14:89662461-89662483 TTAGGAAGTTGCCAGTTGGTGGG - Intergenic
1122229436 14:100298280-100298302 TTGGGGAATTTCCAGCTGGAGGG + Intronic
1124155390 15:27220581-27220603 GTGGGCATTTTCCATCTGGTAGG + Intronic
1125909266 15:43421583-43421605 TCGGGAATTTATCATCTGGTGGG - Intronic
1127689668 15:61383025-61383047 TTGGGAACTCTCCACATGGTAGG - Intergenic
1127965125 15:63917582-63917604 TTGGCAATTTTCCTGCTGAGGGG + Intronic
1129340790 15:74885129-74885151 GTGGGCATTTTCCATCTGGTAGG + Intergenic
1129853248 15:78807169-78807191 TTGAGAATTTTAGAGCTGGTTGG - Intronic
1129988383 15:79939209-79939231 ATAGGAAGTTTCAAGCTGGTAGG - Intergenic
1135915218 16:26599487-26599509 CTGGGAATCTTCGAACTGGTGGG + Intergenic
1136863293 16:33715984-33716006 TTGGGAATGCTGCAGCTGGGAGG - Intergenic
1136927936 16:34391871-34391893 TTGGGCTTTTTCTAGTTGGTAGG + Intergenic
1136936796 16:34475846-34475868 TTTGGAATGTTGCAGCTGGGAGG - Intergenic
1136947876 16:34677235-34677257 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1136955266 16:34777119-34777141 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1136958998 16:34823620-34823642 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1136963023 16:34872724-34872746 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1136967120 16:34926928-34926950 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1136976638 16:35019935-35019957 TTGGGCTTTTTCTAGTTGGTAGG - Intergenic
1137087726 16:36149042-36149064 TTTGGACTGTTGCAGCTGGTAGG + Intergenic
1137092172 16:36207199-36207221 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1137221664 16:46458408-46458430 TTTGGAATGTTGCAGCTGGGAGG - Intergenic
1138340032 16:56283008-56283030 ATGGGCATTTTCCATCTGGTGGG + Intronic
1144436594 17:15248090-15248112 TTGGGCATGTTTGAGCTGGTGGG - Intronic
1148749923 17:49939738-49939760 TAGGGAAGTTTCCAGCAGATGGG + Intergenic
1150993665 17:70290864-70290886 TTGGGAAATTTCCCTCTGCTGGG - Intergenic
1153486962 18:5608594-5608616 TTGTGAATTTTCCATCTGTCTGG - Intronic
1154516545 18:15173597-15173619 TTGGGAATGTTACAGCTGGGAGG - Intergenic
1157678242 18:49583502-49583524 GTGGCAGTTTTCCAGCTGTTAGG + Intronic
1159584018 18:70265645-70265667 TGGGGGATTTTCCAGGTCGTAGG - Intergenic
1160220225 18:76971181-76971203 TTGGGCATTATCTAGCAGGTGGG - Intergenic
1162781265 19:13008123-13008145 CTGGGATTCTTCCAGCTGGTGGG + Intronic
1162882138 19:13667693-13667715 TTGGAAAAATTCCAGCTGGCCGG + Intergenic
1163309610 19:16505621-16505643 CTGGGAAATTTCCAGCTTTTGGG - Intronic
1165709119 19:37997231-37997253 TTGGGAAGATTCCACATGGTAGG + Intronic
1165725645 19:38110763-38110785 TTGGGGGATTTGCAGCTGGTAGG - Intronic
1166714185 19:44955858-44955880 TTGGGAGTTTTCTAGCTGTGGGG + Intronic
1167738127 19:51310094-51310116 TAGGGAATTTTCCACCTTGCAGG + Intergenic
1167744342 19:51341857-51341879 TCTGGAACTTTCCAGCTGGGAGG + Exonic
925731695 2:6923581-6923603 TTGGCAATTTTACAGCTGGAAGG - Intronic
927077285 2:19591291-19591313 TAGTGAATTTTTCAGCTGGGAGG - Intergenic
927516904 2:23677146-23677168 ATGAGAATGTTCCAGCTGGAAGG + Intronic
927805610 2:26144033-26144055 TGGGGAATATACCTGCTGGTGGG - Intergenic
928592002 2:32826661-32826683 TTGGGATTTTTACAGCTGTCTGG + Intergenic
929252015 2:39768494-39768516 TTGGTACTTTTCCAGGAGGTAGG - Exonic
931795882 2:65709581-65709603 TTGGGTAGTTTCCAGCTTGGGGG - Intergenic
932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG + Intronic
932762460 2:74447733-74447755 TTGGGAACATTCCAGTTAGTTGG - Intergenic
934252394 2:90369252-90369274 TTTGGAATGTTTCAGCTGGGAGG - Intergenic
934257047 2:91433693-91433715 TTTGGAATGTTTCAGCTGGGAGG + Intergenic
934765544 2:96878221-96878243 TTGGGAATGGCTCAGCTGGTGGG + Intronic
934944973 2:98534287-98534309 TGAGGAATTGACCAGCTGGTGGG + Intronic
937898308 2:126995712-126995734 GTTGGCATTTTCCATCTGGTGGG - Intergenic
938452012 2:131429437-131429459 TAGGGAATGGTCCAGCTGATGGG - Intergenic
938516868 2:132018591-132018613 TTGGGAATGTTGCAGCTGGGAGG - Intergenic
938888175 2:135675347-135675369 TTGGTAGTTTTGCTGCTGGTTGG - Exonic
939490856 2:142874491-142874513 TTGGGAAGTTCCCAGATGGGAGG - Intergenic
941040570 2:160617606-160617628 TTGGGAATTTTCTAGTTAATTGG - Intergenic
941498256 2:166235035-166235057 GTGGGAACTTTCTTGCTGGTGGG - Intronic
942017218 2:171829330-171829352 CTGGGAGTTTTGCAGATGGTTGG - Intronic
942214762 2:173707810-173707832 TGGGGAATTCACGAGCTGGTGGG - Intergenic
942540410 2:177009540-177009562 TTGGGAGTTTTGCAGGTGGTTGG - Intergenic
945950263 2:216032804-216032826 TTTAGAATCTTCCTGCTGGTTGG + Intronic
946749639 2:222880895-222880917 TTGTGAATTCTCCCTCTGGTTGG + Intronic
947015469 2:225614971-225614993 TCGGGAAGTTTCCATCTAGTGGG + Intronic
1168874071 20:1158435-1158457 TTGGGAATTTTCCAGCTGGTTGG - Intronic
1172873569 20:38150676-38150698 TTGGGAACTGTGAAGCTGGTTGG - Intronic
1173395513 20:42676152-42676174 TTAGGAATATTCCACCTGGATGG + Intronic
1175242781 20:57562056-57562078 CTGTGATTTTTGCAGCTGGTTGG + Exonic
1175460671 20:59149821-59149843 TGTGGAATGTTCCAGCTGGCCGG + Intergenic
1180717644 22:17882662-17882684 TTGCGAATTTACCAGGTGGCAGG - Intronic
1182990023 22:34758666-34758688 TTGGGCATTTTCCCGGTGCTAGG - Intergenic
1184087318 22:42272657-42272679 TGGGGAAGTTTCCAGGTGGAGGG - Intronic
1184533260 22:45070375-45070397 TGGGGAAGATTCCAGCAGGTGGG + Intergenic
1203325745 22_KI270738v1_random:14730-14752 TTTGGAATGTTGCAGCTGGGAGG - Intergenic
949189093 3:1230059-1230081 TTAGGAACTTTCCATTTGGTTGG - Intronic
950651197 3:14408030-14408052 TTGGGTTGTTTCCAGCTGGGGGG + Intronic
950934002 3:16820435-16820457 TTGACAATTTTCCAGATGGTGGG - Intronic
951014740 3:17718184-17718206 TTGGGAATATGCCAGTGGGTGGG - Intronic
951619601 3:24586816-24586838 TTGGGAAATTTCCACCTGGGGGG + Intergenic
952091982 3:29898355-29898377 TCTTGAATTTTGCAGCTGGTGGG + Intronic
952173717 3:30838525-30838547 TTTTGCATTTTCCAGCTGTTTGG + Intronic
952694538 3:36250115-36250137 TTGGGCAGTCTCCAGCTGGGTGG - Intergenic
954602626 3:51881453-51881475 TTGGGCATTCTACAACTGGTAGG + Intergenic
955020888 3:55120043-55120065 TTGTGAATCTGCCACCTGGTTGG - Intergenic
959206701 3:103317052-103317074 TTGCCAATTTTCAAGCTAGTTGG - Intergenic
959933839 3:112010096-112010118 TTGGGAATTTTCTAGATGCAGGG + Intronic
959956851 3:112249570-112249592 TTGGGCTTTTTCTAGTTGGTAGG + Intronic
960602251 3:119469591-119469613 TTGGGAATTTTCCAGTTTCTTGG + Intronic
960829128 3:121826557-121826579 TTGGGCATTTTTCAGCTATTAGG - Intronic
961452994 3:127010857-127010879 CTGGGCATTTTTCAGTTGGTTGG + Intronic
962069739 3:132020808-132020830 TTGGGCATGTTCCAGCTGTGCGG - Intronic
963737991 3:149042850-149042872 TTGGGTTATTTCCTGCTGGTCGG + Intronic
966964512 3:184976963-184976985 TTGGGTATATTCCAAATGGTGGG + Intronic
967264188 3:187675696-187675718 CTGGGAATTTTCCAGCTGAATGG - Intergenic
967863587 3:194172219-194172241 TTGGGAATTTTTCTGATGGACGG - Intergenic
969453331 4:7287182-7287204 TCTGGGATTTTCCAGTTGGTCGG - Intronic
970740746 4:19234845-19234867 GTAGGAATTTACCAGCTGTTTGG - Intergenic
971164988 4:24173610-24173632 TTCAGACTTTTCCAGCTGCTGGG - Intergenic
973555069 4:52074419-52074441 ATGGTAATGTCCCAGCTGGTTGG + Intronic
973837127 4:54821264-54821286 ATGGGAATTTTCTACCTGTTCGG + Intergenic
978637087 4:110822459-110822481 TTGGGTATTTTCCACATGATGGG + Intergenic
979117236 4:116841025-116841047 TTGGGAATTTTCCACCTGAAAGG + Intergenic
980022146 4:127722817-127722839 TTAGGCAGTTTCTAGCTGGTGGG + Exonic
980568093 4:134572495-134572517 CTGGGATTTTTTCAGTTGGTAGG - Intergenic
982275116 4:153630360-153630382 GTGGGATTTGTTCAGCTGGTTGG - Intronic
984163693 4:176283863-176283885 GTGGGAATTGTTCAGCTGATGGG - Intergenic
984988039 4:185350537-185350559 TTGGGAACTTTCCAGTTTGAGGG + Intronic
985870008 5:2546970-2546992 TGGGAAATTTTCCAGCAGGAAGG - Intergenic
986336564 5:6759817-6759839 GTTGGAATTTTCAAGCTGGGTGG + Intergenic
987239046 5:15973755-15973777 TTGGGAATTTTACTGCTGGCAGG - Intergenic
989314453 5:40061215-40061237 TTGGGAATCTGCCATGTGGTAGG + Intergenic
996368070 5:122723934-122723956 ATGGGAATTTCCCATCTGATAGG - Intergenic
997458678 5:134037235-134037257 ATGGGCATTTTCCATCTGGTGGG - Intergenic
997736622 5:136217042-136217064 TTTGGATTTTGCCAGCTAGTTGG + Intronic
1001568213 5:172714025-172714047 CTGGGGCTTTTCCACCTGGTGGG - Intergenic
1001895805 5:175379406-175379428 ATGGGATTTGTTCAGCTGGTAGG - Intergenic
1001902849 5:175445385-175445407 TAGGTAATTTTCCAGTTTGTGGG - Intergenic
1003033480 6:2622906-2622928 CTGGGAAGTTTCTAGGTGGTGGG + Exonic
1003478689 6:6511266-6511288 ATGGGAGTTGTTCAGCTGGTTGG - Intergenic
1004433028 6:15563624-15563646 GTGGGGATCTTCAAGCTGGTTGG - Intronic
1006350042 6:33514283-33514305 TTGGGAATTTGCCACCGGATTGG - Intergenic
1009913144 6:69959061-69959083 TTAGGAATTTTCCTGCTTATAGG - Intronic
1012499081 6:99868984-99869006 GTGAGAACCTTCCAGCTGGTGGG + Intergenic
1013732554 6:113185530-113185552 CTGGGAATTTCCCAGGTGCTTGG + Intergenic
1013820941 6:114153065-114153087 CTGGGAATATTCAAGCTGATAGG - Intronic
1014177791 6:118349194-118349216 TTTGTCATTTCCCAGCTGGTTGG - Intergenic
1015817983 6:137230129-137230151 TAGGAAATTTTCCAGAAGGTGGG + Intergenic
1016402527 6:143696079-143696101 TTCGCAATTTCCCAGCTGGTAGG + Intronic
1017603543 6:156109110-156109132 TTTGGAACTTTCCATCTTGTGGG + Intergenic
1022012964 7:26325028-26325050 TTGGGGATAATCCAGCTGGGAGG + Intronic
1022502274 7:30889410-30889432 GTGGCCATTTTCCTGCTGGTTGG + Intronic
1022972520 7:35530716-35530738 CTGGGAATGGTCCTGCTGGTAGG - Intergenic
1024485997 7:49920330-49920352 ATGTAAATTTTCCAGCTGGAAGG + Exonic
1024536285 7:50437250-50437272 ATGGGAACTTTGAAGCTGGTTGG - Intergenic
1025483246 7:61012900-61012922 TTTGGAATATTGCAGCTGGGAGG + Intergenic
1025554301 7:62285310-62285332 TTTGGAATGTTGCAGCTGGGAGG - Intergenic
1025560480 7:62367964-62367986 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1025564560 7:62417268-62417290 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1026861490 7:73792969-73792991 CTGGGAATTTTCTGGGTGGTAGG - Intergenic
1028227975 7:88271986-88272008 TTGTATAGTTTCCAGCTGGTTGG + Intergenic
1028305660 7:89260435-89260457 CTGGGAATTTTGCTGCTGCTTGG + Intronic
1034428822 7:151029841-151029863 TTGGGAATCTTCTATCTGTTTGG - Intronic
1039652960 8:39363134-39363156 TTGGGAATTTTTTAGTTGATAGG - Intergenic
1041694475 8:60721087-60721109 CTGGGCATTTTCCTTCTGGTTGG + Intronic
1043379907 8:79691530-79691552 TAGGGAATTGTGCAGCTGATGGG + Intergenic
1045967015 8:108036575-108036597 TTGGGAATGTTCAAACTTGTGGG - Intronic
1050154817 9:2655302-2655324 TAGTGAATTTTCCATCAGGTTGG + Exonic
1053505880 9:38642789-38642811 TTCGGAATTTTCCAGAGAGTTGG + Intergenic
1056391194 9:86143024-86143046 GTTGGCATTTTCCATCTGGTGGG - Intergenic
1057920777 9:99094933-99094955 CTGGGAACTTTCAAGCCGGTTGG + Intergenic
1058053652 9:100428993-100429015 TTGGGTATTCTGCAGATGGTGGG - Intronic
1061184334 9:129043300-129043322 TTAGGAATCATTCAGCTGGTTGG + Intronic
1061423326 9:130483958-130483980 TCTGGAATGTTCCAGATGGTGGG - Intronic
1188573242 X:31615013-31615035 TTGAGAATTTTCCAGTAGGATGG + Intronic
1189865585 X:45323759-45323781 TTGGGGAGTTTTCAGCTGGATGG + Intergenic
1190142647 X:47861683-47861705 ATGGGATTTGTTCAGCTGGTTGG - Intronic
1190447420 X:50541393-50541415 TTGGTATTTATCCAGCTTGTTGG - Intergenic
1190515111 X:51215762-51215784 TTGGGACCTTTCCAGGTGGAGGG - Intergenic
1191204723 X:57821715-57821737 ATGGCAATTTTCCTGCTGATGGG + Intergenic
1192982658 X:76363120-76363142 TTGGGATTTTTCTGGTTGGTAGG + Intergenic
1195304520 X:103566971-103566993 TTGTGAATTCTACAGATGGTGGG - Intergenic
1195948689 X:110243403-110243425 TGGGGAATTTTCCAGATGTTTGG - Intronic
1196094110 X:111780236-111780258 TTGGCTGTTTTCTAGCTGGTGGG + Intronic
1198845348 X:140904450-140904472 TTGGGAATTATCCCACTGTTTGG + Intergenic
1201160469 Y:11161059-11161081 TTTGGGATTTTGCAGCTGGCAGG - Intergenic