ID: 1168874916

View in Genome Browser
Species Human (GRCh38)
Location 20:1164765-1164787
Sequence TACCCAAGACTGCTGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168874916_1168874919 16 Left 1168874916 20:1164765-1164787 CCTTTCTTCAGCAGTCTTGGGTA 0: 1
1: 0
2: 1
3: 11
4: 116
Right 1168874919 20:1164804-1164826 TTTTATAGATGCAGAAAATGAGG 0: 1
1: 12
2: 298
3: 2053
4: 7720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168874916 Original CRISPR TACCCAAGACTGCTGAAGAA AGG (reversed) Intronic
902554449 1:17238749-17238771 TACCCAAGGATGGTGATGAAAGG - Intronic
906970174 1:50505082-50505104 TATCTAACACTGCTGAAGAGTGG + Intronic
909396286 1:75174284-75174306 AACCCCTGTCTGCTGAAGAAGGG + Intergenic
911267773 1:95763219-95763241 TACCCAAGACTGGGAAAAAAAGG + Intergenic
911880407 1:103231381-103231403 TATCCAAAACTGATGAAGATAGG - Intergenic
915895214 1:159806739-159806761 TGGCCAAGACTCCTGAGGAAGGG - Intronic
916214391 1:162383291-162383313 TACTCCAGACTGCTGAGGACAGG - Exonic
918701067 1:187608594-187608616 AACCCAAAATTGTTGAAGAAAGG + Intergenic
919331273 1:196175281-196175303 TACACTAGACTTCTGAAGAAAGG + Intergenic
920039856 1:203088553-203088575 AAGCCAAAACTGCTGAAGACTGG + Intergenic
921755943 1:218855840-218855862 AACCCAAGAGAGCTGAAGCATGG + Intergenic
923230845 1:231984800-231984822 TGGCCAAGACAGCTGAGGAAAGG + Intronic
923546755 1:234928933-234928955 TTACAGAGACTGCTGAAGAAGGG + Intergenic
1063920440 10:10926996-10927018 AACAGAAGACTGATGAAGAATGG - Intergenic
1064649445 10:17493705-17493727 TAAACCAGACTGCTGAAGCAAGG + Intergenic
1066482438 10:35809961-35809983 TACCCAAGAAAGCAGCAGAATGG - Intergenic
1067050604 10:43016388-43016410 TACCCAAGACTGAGAAAAAAAGG - Intergenic
1072007365 10:91266109-91266131 TACCCAATACTGTTGAGGAATGG + Intronic
1072194664 10:93106943-93106965 TACACAAGACTGCAGAAAAGTGG - Intergenic
1074998815 10:118779978-118780000 TCCACAAGACTGATGAAGAGAGG - Intergenic
1076089193 10:127665901-127665923 CATGCAAGACTGCTGCAGAAGGG - Intergenic
1077866849 11:6229511-6229533 TACCTCAGTCAGCTGAAGAAAGG + Intronic
1079170079 11:18085083-18085105 TACCCAATAATGCTTAACAATGG + Intronic
1084055192 11:66627435-66627457 AACCCAGGACTGGTGAGGAAAGG + Intronic
1085814101 11:79717335-79717357 TACCCAAGGAAACTGAAGAAGGG - Intergenic
1092436727 12:8453449-8453471 TCCCCAAGACTGCTTCAGGATGG - Intergenic
1092493664 12:8970074-8970096 TAGCCCAGACTGGTGGAGAATGG - Intronic
1093539012 12:20258312-20258334 TATCCAAGACTGCTTAAGAAAGG - Intergenic
1097037615 12:56134098-56134120 TACCCACCACAGCTGAAGAAGGG + Exonic
1099078688 12:78146498-78146520 TCCACAGGACTGCTGAAGTAAGG + Intronic
1105466558 13:20647643-20647665 TACCTAATGCTGCTGAAGAATGG - Intronic
1105815039 13:24027569-24027591 AACCCAAGAATGTAGAAGAAAGG - Intronic
1107239585 13:38215910-38215932 TACTCAAAACTGCTGTGGAATGG + Intergenic
1107448104 13:40486048-40486070 GCCCCAAGACTTCTGAAGCAAGG + Intergenic
1108498653 13:51048804-51048826 TAGCCAAGCCTGCTGAAAAGAGG + Intergenic
1108809337 13:54202108-54202130 TAACCAAAACTGCTGGATAATGG + Intergenic
1111200083 13:84924856-84924878 TACTCAAAACTTCAGAAGAAAGG - Intergenic
1112681981 13:101777387-101777409 TTACCAAGACTGCTCAACAAAGG - Intronic
1113816523 13:113175528-113175550 TACCCAACACTGCAAGAGAACGG + Intergenic
1115900389 14:38140749-38140771 GACCCAAACCTGCTGAAGAAGGG - Intergenic
1116996533 14:51330571-51330593 TTCCCATGACTGCTCAAGACAGG - Intergenic
1117313509 14:54551784-54551806 TACTCAAGTCAGCTTAAGAACGG + Intergenic
1121262389 14:92575969-92575991 TGGCCAAGGTTGCTGAAGAAAGG - Intronic
1124430991 15:29608450-29608472 TTCCCAAGACTGATCAGGAAGGG - Intergenic
1126278594 15:46915660-46915682 TGCCCAACACTGCTTATGAAAGG - Intergenic
1127613031 15:60655708-60655730 TACTCATACCTGCTGAAGAAGGG + Intronic
1127644835 15:60947727-60947749 TACCCATGACTTCTGGAAAACGG - Intronic
1127677123 15:61250751-61250773 TACCCAGAACTGGTGAGGAATGG + Intergenic
1128608981 15:69058794-69058816 TTCCCAAGCCTGATGAAGAGGGG - Intronic
1128698663 15:69788140-69788162 GACCCAAGGCCCCTGAAGAATGG - Intergenic
1129180707 15:73873161-73873183 TACCCAAGACATCTGAAGCCTGG + Intergenic
1130809391 15:87360548-87360570 TAGCCAAGGCTGCTGAGAAATGG - Intergenic
1130870391 15:87966838-87966860 TACCCAAGACTAGTGAATACTGG + Intronic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1134446479 16:14335143-14335165 CCCCCAACACTGCTGCAGAAAGG + Intergenic
1134781137 16:16896433-16896455 TACCCAAGGATGCTGAGCAAGGG + Intergenic
1135376612 16:21952919-21952941 TACCCAATACCTCTGCAGAAAGG + Exonic
1135482016 16:22828508-22828530 TTCCCAAAGCTGCTGAAGCATGG + Intronic
1135486932 16:22873925-22873947 CAGGCAAGCCTGCTGAAGAATGG - Intronic
1137738258 16:50741317-50741339 TTCCCAAGGATGGTGAAGAAGGG - Intergenic
1142730831 17:1855895-1855917 TACCAAAGTCTACTCAAGAAGGG - Intronic
1143017965 17:3901520-3901542 TACCCAAGTCAGCTGTGGAAGGG - Intronic
1143607538 17:7998005-7998027 TACCCAAAACAACTGAAGGAAGG + Intergenic
1143877980 17:10007314-10007336 TAACCAAGACGTCTAAAGAATGG + Intronic
1149401586 17:56301951-56301973 TTGCCAAGACTGTTGAAGAGTGG - Intronic
1151256671 17:72882720-72882742 GACCCAATACTGCTGAAGTCAGG - Intronic
1156294683 18:35778745-35778767 CAGCTGAGACTGCTGAAGAAGGG - Intergenic
932061277 2:68501050-68501072 TACACAAGATTGCATAAGAATGG - Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
941405965 2:165089005-165089027 TAACCAAGACTTGTGAAGAATGG + Exonic
947420447 2:229937625-229937647 AAGCCAACACTGCTGAAGCAGGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170045945 20:12085330-12085352 TTCCCAAGATTGCTGGAGAGTGG + Intergenic
1172780026 20:37431087-37431109 TACCAAAGACAGCTGAGGATTGG - Intergenic
1176935492 21:14861727-14861749 TACCCAAGACTGGTAAGAAAAGG + Intergenic
1177890178 21:26795452-26795474 TTCCTAAAACTGCTTAAGAAAGG + Intergenic
1178750371 21:35297049-35297071 TACCCAAGACTGGTTAATGAAGG - Intronic
1183248980 22:36714906-36714928 TACACGAGAATGCTCAAGAAAGG + Intergenic
1185302843 22:50091606-50091628 TACCCAAGAGAGCTGCTGAAGGG - Intronic
949400220 3:3657830-3657852 TTCACAAGACCGCTGAAAAAAGG + Intergenic
955091217 3:55752503-55752525 TTGCCAAGACTGCTGAACAAGGG + Intronic
956085462 3:65604379-65604401 TAGCAAATACTGCTGGAGAAAGG + Intronic
956168311 3:66413071-66413093 TAGCCAGGACTGCTTCAGAATGG - Intronic
956628639 3:71292012-71292034 TACCCAAGACTTTTAAAAAATGG - Intronic
960253675 3:115487073-115487095 TCTCCAGGACTGCTGACGAAGGG - Intergenic
966030388 3:175339116-175339138 TCCTCAAGTCTGCTGAAGAATGG - Intronic
966177731 3:177157358-177157380 GACTAATGACTGCTGAAGAATGG - Intronic
966427726 3:179798328-179798350 TCCCCATGACTCCTGAAAAATGG - Exonic
971327547 4:25656504-25656526 TCCCCAAGACGGCTGAAGGACGG - Intronic
972857929 4:43130557-43130579 TACCCAAGACTATTGTAAAAGGG - Intergenic
974522455 4:63000754-63000776 TACCCAAGACTGAGGGAGAAGGG + Intergenic
976177827 4:82373061-82373083 TGCCCAAGACTGTAGAAAAAGGG + Intronic
978227312 4:106352895-106352917 TGCCTAGGATTGCTGAAGAATGG + Intergenic
979720736 4:123897223-123897245 TACAGATGACTGCTGAATAAGGG + Intergenic
981464721 4:145055094-145055116 TACCCAAAAGAGCTGAATAAAGG + Intronic
986177622 5:5365344-5365366 TACCCCAGACTGCCGAAATAGGG + Intergenic
986361778 5:6985347-6985369 TACCAAATGCTGCTGAGGAATGG - Intergenic
988724000 5:33907416-33907438 TCACCAAGCCTGCAGAAGAATGG + Intergenic
993250766 5:85519259-85519281 GAGCCAAGACTGCTGAGGACTGG - Intergenic
996880147 5:128287829-128287851 CAACCAAGTCTGCTAAAGAAAGG + Intronic
1000489201 5:161888151-161888173 TCCCCTAGACTGTTGAAGGAGGG + Intronic
1002075531 5:176706112-176706134 TATCCAAGACAGCTGGATAAAGG + Intergenic
1003391775 6:5719544-5719566 TACCTGAGATTTCTGAAGAAAGG - Intronic
1007506924 6:42342731-42342753 CAGCCAAGACTGTTGAAGACAGG - Intronic
1010335002 6:74670529-74670551 AACCCAAGACTATTGGAGAAAGG + Intergenic
1011553373 6:88549742-88549764 TCCACATAACTGCTGAAGAATGG - Intergenic
1015773041 6:136788347-136788369 TTCCCAAGGCTGATGCAGAATGG - Intronic
1015953479 6:138576861-138576883 TACCCATCACTGCTGACAAAGGG + Intronic
1018747933 6:166776899-166776921 TACCCAAGATTGTTGAAAACAGG - Intronic
1019004844 6:168788121-168788143 TGCCCAACACTGCAGAGGAAAGG - Intergenic
1021961938 7:25881654-25881676 TACACAAGGCGGCTGAAGGAGGG + Intergenic
1037634352 8:20687793-20687815 TTCCCAAGACCTCTGAAGACCGG - Intergenic
1041493286 8:58458854-58458876 TACCCAAAACTGCAGGACAATGG - Intergenic
1042187175 8:66148370-66148392 TATCCAATACTGCCTAAGAATGG - Intronic
1044646601 8:94449974-94449996 TAGTCCAGTCTGCTGAAGAAGGG - Intronic
1046368815 8:113272645-113272667 TACCCAATACTGGGGAAAAAAGG - Intronic
1047978046 8:130151070-130151092 AACAAAAGATTGCTGAAGAAGGG + Intronic
1048215658 8:132492210-132492232 TATCCAGGACTGCTGAACACAGG + Intergenic
1050145690 9:2565013-2565035 TACAAAAGACTCCTCAAGAATGG - Intergenic
1052794232 9:32908261-32908283 TAGCCAAGATTCCTGAAGAGAGG + Intergenic
1054875537 9:70092544-70092566 GACCCAAGACTGCCTAAGTAGGG + Intronic
1061969511 9:134036310-134036332 TGCCCCAGACAGCTGAAGAAAGG - Exonic
1062605980 9:137349066-137349088 TCCCCAAGAATGCTGACAAACGG + Intronic
1186902467 X:14071880-14071902 TACCCAAGAGAACTGAAAAAAGG - Intergenic
1188944738 X:36285492-36285514 TTGTCAAGACAGCTGAAGAAAGG - Intronic
1190063928 X:47227424-47227446 TCCCCCAGACTGAGGAAGAATGG - Exonic
1193498542 X:82241914-82241936 TACCCAAAACTGGGGAAAAAAGG - Intergenic
1198069116 X:133130463-133130485 CAGCCAAGACAGATGAAGAAAGG + Intergenic
1200782779 Y:7231908-7231930 CACCCAAGTCTGCTGTTGAATGG - Intergenic