ID: 1168874919

View in Genome Browser
Species Human (GRCh38)
Location 20:1164804-1164826
Sequence TTTTATAGATGCAGAAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10084
Summary {0: 1, 1: 12, 2: 298, 3: 2053, 4: 7720}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168874916_1168874919 16 Left 1168874916 20:1164765-1164787 CCTTTCTTCAGCAGTCTTGGGTA 0: 1
1: 0
2: 1
3: 11
4: 116
Right 1168874919 20:1164804-1164826 TTTTATAGATGCAGAAAATGAGG 0: 1
1: 12
2: 298
3: 2053
4: 7720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168874919 Original CRISPR TTTTATAGATGCAGAAAATG AGG Intronic
Too many off-targets to display for this crispr