ID: 1168876119

View in Genome Browser
Species Human (GRCh38)
Location 20:1173399-1173421
Sequence CACGAGGGGCTTCCCACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168876105_1168876119 18 Left 1168876105 20:1173358-1173380 CCCCAATACCACCATCCCTTCAA 0: 1
1: 0
2: 1
3: 20
4: 256
Right 1168876119 20:1173399-1173421 CACGAGGGGCTTCCCACTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 113
1168876110_1168876119 7 Left 1168876110 20:1173369-1173391 CCATCCCTTCAAGTCAGCGTGGG No data
Right 1168876119 20:1173399-1173421 CACGAGGGGCTTCCCACTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 113
1168876112_1168876119 3 Left 1168876112 20:1173373-1173395 CCCTTCAAGTCAGCGTGGGCTGT 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1168876119 20:1173399-1173421 CACGAGGGGCTTCCCACTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 113
1168876113_1168876119 2 Left 1168876113 20:1173374-1173396 CCTTCAAGTCAGCGTGGGCTGTT 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1168876119 20:1173399-1173421 CACGAGGGGCTTCCCACTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 113
1168876106_1168876119 17 Left 1168876106 20:1173359-1173381 CCCAATACCACCATCCCTTCAAG 0: 1
1: 0
2: 2
3: 18
4: 139
Right 1168876119 20:1173399-1173421 CACGAGGGGCTTCCCACTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 113
1168876103_1168876119 25 Left 1168876103 20:1173351-1173373 CCCTGATCCCCAATACCACCATC 0: 1
1: 0
2: 2
3: 46
4: 590
Right 1168876119 20:1173399-1173421 CACGAGGGGCTTCCCACTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 113
1168876107_1168876119 16 Left 1168876107 20:1173360-1173382 CCAATACCACCATCCCTTCAAGT 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1168876119 20:1173399-1173421 CACGAGGGGCTTCCCACTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 113
1168876108_1168876119 10 Left 1168876108 20:1173366-1173388 CCACCATCCCTTCAAGTCAGCGT 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1168876119 20:1173399-1173421 CACGAGGGGCTTCCCACTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 113
1168876102_1168876119 28 Left 1168876102 20:1173348-1173370 CCTCCCTGATCCCCAATACCACC 0: 1
1: 0
2: 1
3: 23
4: 348
Right 1168876119 20:1173399-1173421 CACGAGGGGCTTCCCACTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 113
1168876104_1168876119 24 Left 1168876104 20:1173352-1173374 CCTGATCCCCAATACCACCATCC 0: 1
1: 0
2: 1
3: 14
4: 225
Right 1168876119 20:1173399-1173421 CACGAGGGGCTTCCCACTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168876119 Original CRISPR CACGAGGGGCTTCCCACTTC AGG Intronic
900414966 1:2530635-2530657 CCCCAGCGGCTTCCCACTGCTGG + Intergenic
902078494 1:13805446-13805468 CACGTGGGCCTTCCCACTTGGGG + Intronic
903191292 1:21657785-21657807 CACAAGTGCCTTCCCACTTCTGG + Intronic
906892257 1:49730140-49730162 CACAGTGGGCTACCCACTTCAGG + Intronic
907871811 1:58450369-58450391 GAGGAGTGGCTTCCCACTCCGGG + Intronic
908000053 1:59670983-59671005 CAGTAGGGGTTTCCCTCTTCTGG + Intronic
911839387 1:102660869-102660891 CACGGAGGGCTGCCCACTTTGGG + Intergenic
912057967 1:105630534-105630556 CCCGAGGGGGTTGCCACTGCTGG + Intergenic
912644858 1:111383097-111383119 CCAGAGGGGCTGCCCACTGCGGG + Intergenic
920279789 1:204834234-204834256 CATGAGGGGCCTTCAACTTCTGG + Intronic
923215322 1:231843522-231843544 CACGAGGGCCATCCCCCTGCAGG + Intronic
923574004 1:235141556-235141578 CCCGAGTGGCTTGCCACTGCTGG - Intronic
1062830365 10:601541-601563 CACGAGAGAATTCCCACTTCTGG + Intronic
1065170610 10:23023183-23023205 TACGAGGGGTTTCCCCGTTCTGG - Intronic
1067044988 10:42980474-42980496 CACAAAGGGCTTACCTCTTCAGG - Intergenic
1068044001 10:51862487-51862509 CACAGAGGGCTACCCACTTCAGG - Intronic
1073862744 10:107766342-107766364 CACGAGGGGTCCCCAACTTCCGG + Intergenic
1076278420 10:129225043-129225065 CACTAGGGGCTTCACGCTGCCGG + Intergenic
1077102472 11:828309-828331 CAGGAGGGGCTGCCAACTTCAGG - Intronic
1080469670 11:32532934-32532956 AAAGAAGGGCTTCCCACTTTGGG + Intergenic
1081533697 11:43982485-43982507 CAAGAGGGCCTTGCCACTTTGGG - Intergenic
1083140720 11:60718947-60718969 CACGTGGGACTACCCACCTCTGG - Intergenic
1084050417 11:66595840-66595862 GACAAGGAACTTCCCACTTCAGG + Intronic
1085714758 11:78862677-78862699 CATTAGGGGCTTCACACTGCTGG - Intronic
1089070953 11:115699351-115699373 TACTAGGGGCTTTTCACTTCGGG - Intergenic
1091219307 11:133920747-133920769 CTCAGGGGGCTGCCCACTTCTGG + Exonic
1093973097 12:25392261-25392283 CCCGAGTGGGTTCCCACTGCTGG - Intergenic
1098377984 12:69837697-69837719 CACATGGGGCTTCCTCCTTCTGG + Intronic
1098753151 12:74321786-74321808 CAGTAGGGACTACCCACTTCGGG - Intergenic
1099049725 12:77768014-77768036 CAAAAGGAGCTACCCACTTCAGG - Intergenic
1107912139 13:45115202-45115224 TACCAGGGGCTTCCCTCCTCAGG + Intergenic
1109804133 13:67415978-67416000 CACAGAGGGCTACCCACTTCAGG + Intergenic
1113562875 13:111297676-111297698 CACGAGGGGCGTCCTGGTTCTGG + Intronic
1114912630 14:27219838-27219860 CAGTAGGGGCTACCCACGTCAGG + Intergenic
1116390669 14:44385563-44385585 CCCGAGGGGGTTGCCACTGCTGG - Intergenic
1116809584 14:49526235-49526257 CATGAAAAGCTTCCCACTTCAGG - Intergenic
1117612906 14:57502793-57502815 CTCCTGGGCCTTCCCACTTCAGG - Intergenic
1119749982 14:77070322-77070344 CAGGAGGGGCAGCCCCCTTCTGG - Intergenic
1120198476 14:81513262-81513284 CCCGAGGGGGTTGCCACTGCTGG - Intronic
1122878345 14:104678984-104679006 CAGGAGCGGCTTCCCATGTCAGG - Intergenic
1127300073 15:57644247-57644269 CACCAGCAGCTTCCCACCTCAGG - Intronic
1127612452 15:60650376-60650398 CAGGAGGGCATTCCAACTTCAGG + Intronic
1128651158 15:69414618-69414640 CACGTGGAGGTTCCCACTTTGGG - Intronic
1130634196 15:85600869-85600891 TAAGAGGGTCTTCCCACTCCTGG - Intronic
1131589470 15:93732281-93732303 CAGGAGGGACTTCCCACTGTGGG - Intergenic
1132828299 16:1915762-1915784 CTTGAGGGGCCTCCCACTTGGGG - Intronic
1137945803 16:52732175-52732197 CCCGAGGGGGTTGCCACTGCTGG - Intergenic
1139286299 16:65817427-65817449 CAAGTGGGGCTACCAACTTCAGG + Intergenic
1143427659 17:6853070-6853092 AAAGAGGGGCCTCCCACTTTGGG + Intergenic
1146399238 17:32490288-32490310 CACCAGGGGCCTCCCACCTCTGG - Exonic
1150387718 17:64774350-64774372 CACCTGGGCCTTCCCACTTCTGG + Intergenic
1150450324 17:65261245-65261267 CACAAGGTGGTCCCCACTTCTGG + Intergenic
1150521073 17:65866679-65866701 CAAGAGGAGCTACCCACCTCAGG + Intronic
1155806158 18:30174526-30174548 CCCCAGGGGCTTGCCACTGCTGG + Intergenic
1158896245 18:61916470-61916492 CTCTTGGGGCCTCCCACTTCCGG - Intergenic
1161264998 19:3359910-3359932 CGCGAGGGGCCCCCCACTTGGGG - Intronic
1161911394 19:7197271-7197293 CCAGAGGGCCTTCCCGCTTCGGG + Intronic
1161939764 19:7395113-7395135 CTCGCGCGGCTTCCCGCTTCCGG + Intronic
1162039085 19:7958432-7958454 CACGAGGGGACACCCAGTTCGGG - Intergenic
1167140371 19:47646351-47646373 CACGAGGGGCTGGCGATTTCTGG - Intronic
928223582 2:29426226-29426248 CATGAAAGGCTTCCCACTGCAGG + Intronic
928880710 2:36093127-36093149 CCCCAGGGGGTTGCCACTTCTGG - Intergenic
930442362 2:51425077-51425099 CACAGAGGGCTGCCCACTTCAGG - Intergenic
930516820 2:52418982-52419004 CACAAGGGCTTTCCCTCTTCAGG + Intergenic
930668269 2:54121199-54121221 CACAGAGGGCTACCCACTTCGGG - Intronic
942830287 2:180231928-180231950 CAAAGGGGGCTTCCCACTCCCGG - Intergenic
943049016 2:182893701-182893723 CACAGAGGGCTACCCACTTCAGG + Intergenic
945335177 2:208583489-208583511 CATTAGGGCCTTCCCACTTCAGG - Intronic
948823839 2:240564797-240564819 CAGGAGGGGCTTCCCATGTTCGG - Intronic
949064552 2:241981807-241981829 CATGAGGGGCTTCTCATTGCAGG + Intergenic
1168876119 20:1173399-1173421 CACGAGGGGCTTCCCACTTCAGG + Intronic
1169815560 20:9652546-9652568 CACTGGGTGCTTCCCACTCCAGG + Intronic
1171456260 20:25274438-25274460 CAGGTCGGGATTCCCACTTCTGG - Intronic
1173884523 20:46445717-46445739 AAAGAGGAGCTTCCCACTCCAGG - Intergenic
1175570916 20:60020922-60020944 CAGGAGGGACTTTCCATTTCAGG - Intronic
1175645491 20:60667293-60667315 CACGTGGGGTTTGCCTCTTCAGG - Intergenic
1175967798 20:62668345-62668367 GACGAGGGGCTTCCCACTTGGGG + Intronic
1183872891 22:40753859-40753881 CACACAGGGCTACCCACTTCAGG - Intergenic
1184509631 22:44926026-44926048 CACGTGGGCCTTCCCACCACAGG - Intronic
951021151 3:17781970-17781992 CCCGAGTGGCTTGCCACTGCTGG - Intronic
951562393 3:23981847-23981869 AACAAGGTGCTTCCCACTCCAGG - Intergenic
951576097 3:24115782-24115804 CCCGTGGTGCTTCACACTTCAGG - Intergenic
954655219 3:52190433-52190455 CAGGAGAGGTTGCCCACTTCCGG - Intergenic
955869205 3:63418788-63418810 CACCAGGTGCCTCCCACTTGTGG + Intronic
956384546 3:68702944-68702966 CACCAGGTGCTTCCCAAATCTGG - Intergenic
963353093 3:144176401-144176423 CACAGGGGGCTACCCACTTAAGG - Intergenic
964996794 3:162891887-162891909 AAAGAGGAGCTACCCACTTCAGG + Intergenic
967975747 3:195033975-195033997 CACCCGCGGCTTCCCACTTCAGG + Intergenic
970911738 4:21284831-21284853 CACTTGGGGGTGCCCACTTCTGG + Intronic
975745080 4:77467311-77467333 CCCGAGGGGGTTGCCACTGCTGG - Intergenic
977470560 4:97437475-97437497 CCCGAGCGGCTTGCCACTGCTGG + Intronic
979899880 4:126202353-126202375 CACCAGGAGCTATCCACTTCAGG - Intergenic
985779510 5:1862810-1862832 CACAAGGGTCTTCCCATTGCTGG + Intergenic
986826346 5:11526818-11526840 CACGTGGGTCCTTCCACTTCGGG - Intronic
988358403 5:30204934-30204956 CCCGAGTGGCTTACCACTGCTGG - Intergenic
988956439 5:36324523-36324545 CCCGAGAGGCTTGCCACTGCAGG - Intergenic
989718276 5:44492491-44492513 CACAGAGGGCTACCCACTTCAGG + Intergenic
990392926 5:55345898-55345920 CACGATGGGCATATCACTTCAGG - Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
993792410 5:92223691-92223713 TACAAGGGGCTTCCCCCTTTGGG - Intergenic
993809587 5:92458875-92458897 CAAGAGGGGCTAGGCACTTCAGG - Intergenic
1004914743 6:20321114-20321136 CACGAGCGGCTTGCCACTGCCGG - Intergenic
1011285222 6:85715650-85715672 CACGGAGGGCTACCAACTTCAGG - Intergenic
1016200044 6:141395302-141395324 AAAGAGGAGCTTCCCACTCCAGG + Intergenic
1020763691 7:12295948-12295970 CACAGAGGGCTACCCACTTCTGG + Intergenic
1023699455 7:42878088-42878110 AGAGAGGAGCTTCCCACTTCAGG + Intergenic
1027402441 7:77822631-77822653 CAGGAGGGACTTCCCATTTCAGG - Intronic
1030710253 7:112740638-112740660 CAGGAGGAACTTCCCATTTCAGG - Intergenic
1035999389 8:4583813-4583835 CACGAGTGGGTTGCCACTGCTGG - Intronic
1038012988 8:23489489-23489511 CACGAGTGGGTTGCCACTGCTGG - Intergenic
1038533282 8:28336040-28336062 CACTAGGGGCGTCCCAGTCCTGG + Intronic
1039409794 8:37343124-37343146 CACAAGAAGTTTCCCACTTCTGG - Intergenic
1040063954 8:43128682-43128704 CAGGAGGGGAATCCCATTTCTGG - Intergenic
1040843551 8:51810162-51810184 AACGAGGTGCTGCTCACTTCAGG - Intergenic
1042325342 8:67522282-67522304 CACAGTGGGCTACCCACTTCAGG + Intronic
1049639474 8:143708213-143708235 CCCGAGGCGCGTCCCACCTCTGG - Intronic
1051973830 9:22924288-22924310 CACCAGGTCCTTCCCACTACAGG - Intergenic
1056557042 9:87698228-87698250 CACAAAGAGCCTCCCACTTCGGG - Intronic
1057175298 9:92992906-92992928 CAGGAGGGACTTCCCTTTTCAGG - Intronic
1057790205 9:98119392-98119414 CATTAGGAGCTTCCCATTTCTGG - Intergenic
1058736668 9:107900118-107900140 CAGGGGGGGCTTCCCAGTTGGGG - Intergenic
1060193366 9:121607144-121607166 GACAGGGGGCTTCCTACTTCAGG - Intronic
1061731409 9:132617209-132617231 CACGGGGCTCATCCCACTTCAGG + Intronic
1062140649 9:134956106-134956128 AGAGAGGGGCTGCCCACTTCGGG + Intergenic
1189186656 X:39060842-39060864 CACAGAGGGCTACCCACTTCAGG - Intergenic